CN115927360B

CN115927360B - Codon-optimized insulin aspart precursor gene, recombinant vector, genetically engineered bacterium and application thereof

Info

Publication number: CN115927360B
Application number: CN202210999985.8A
Authority: CN
Inventors: 曹海燕; 张世野; 纪晓影; 王洪宇; 池营; 徐霞
Original assignee: Jilin Huisheng Biopharmaceutical Co ltd; Beijing Huizhiheng Biological Technology Co Ltd
Current assignee: Jilin Huisheng Biopharmaceutical Co ltd; Beijing Huizhiheng Biological Technology Co Ltd
Priority date: 2020-05-26
Filing date: 2020-05-26
Publication date: 2023-07-14
Anticipated expiration: 2040-05-26
Also published as: CN111560379A; CN115927360A; CN111560379B

Abstract

The application belongs to the technical field of genetic engineering, and discloses a codon-optimized insulin aspart precursor gene, a recombinant vector, genetic engineering bacteria and application thereof. The vector containing the further optimized insulin aspart precursor gene sequence converts pichia pastoris to obtain the pichia pastoris gene engineering strain with high expression efficiency. The genetically engineered strain of the invention can be used for producing the insulin aspart precursor, so that the aim of further improving the expression quantity of the insulin aspart precursor protein can be fulfilled.

Description

Codon-optimized insulin aspart precursor gene, recombinant vector, genetically engineered bacterium and application thereof

The application is a divisional application of Chinese patent application with application date of 2020, application number of 26 months and application number of 202010455882.6, and the invention is named as 'codon optimized insulin aspart precursor gene, recombinant vector, genetic engineering bacteria and application thereof'.

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to genetic modification of an insulin aspart precursor and expression of exogenous proteins, in particular to a codon-optimized insulin aspart precursor gene, a recombinant vector, genetic engineering bacteria and application thereof.

Background

Diabetes is a group of metabolic diseases characterized by hyperglycemia, and is mainly characterized by polydipsia, polyphagia, and polyuria due to chronic hyperglycemia. The prolonged presence of hyperglycemia in diabetes leads to chronic damage, dysfunction of various tissues, especially the eyes, kidneys, heart, blood vessels, nerves. The main cause of hyperglycemia is due to insulin secretion deficiency or impaired biological action, or both. Wherein the insulin secretion or action is defective, i.e. the pancreas is not able to secrete enough insulin or the body is not able to use the insulin secreted by it effectively.

Insulin is a protein hormone secreted by islet beta cells within the pancreas by stimulation with endogenous or exogenous substances such as glucose, lactose, ribose, arginine, glucagon, and the like. Insulin consists of two peptide chains, the a chain and the B chain, which total 51 amino acid residues. A. The sulfhydryl groups of four Cys between the chains A7-B7 and A20-B19 form two pairs of disulfide bonds, and two Cys in the chains A6-A11 form one pair of intrachain disulfide bonds. Insulin is a therapeutic drug for type I and type II diabetics. The requirement of energy metabolism is met by simulating the physiological insulin secretion of a human body. Insulin has become an ideal treatment for diabetics because it is effective in reducing or alleviating the occurrence and development of symptoms of type I and type II diabetes through the treatment of insulin.

Although natural insulin has the function of reducing blood sugar, the natural insulin cannot simulate basic insulin secretion and supplementary insulin secretion of normal people after injection, so that dangerous situations of poor curative effect and even low blood sugar are caused. Therefore, on the basis of the study of the structure of the insulin, the physical and chemical properties of the insulin are modified by changing the sequence of amino acids at certain specific sites on the insulin, changing isoelectric points, changing the strength of polymers, modifying fatty acid chains and the like, so that quick-acting insulin with shorter peak-reaching action time and long-acting insulin with longer decomposition, absorption and action time are respectively constructed, and are respectively used for simulating the additional secretion and basic secretion of the insulin of normal people in postprandial and fasting states.

Insulin aspart is quick-acting insulin, which is developed by Danenox and Norde, and has the design principle that proline at the 28 th position of B chain is replaced by aspartic acid by utilizing a gene recombination technology, and the introduction of anions can increase mutual repulsion among insulin molecules and prevent the formation of insulin intermolecular dimers. The insulin aspart preparation contains phenol, can be quickly absorbed after subcutaneous injection, and has similar speed of dispersing in blood in vivo, affinity for specific binding with insulin receptor and efficacy of lowering blood sugar. Insulin aspart has a much faster absorption rate than natural human insulin due to the existence of the insulin monomer, has a response rate of about 2 times that of the natural human insulin, and has a shorter action time than the natural human insulin, so that the incidence rate of hypoglycemia can be reduced. Insulin aspart has been widely used as a common fast acting insulin.

At present, the insulin aspart is mainly expressed and produced by using saccharomyces cerevisiae, but the expression yield is low, the expression product has an excessive glycosylation phenomenon, and the effect is not ideal. Compared with Saccharomyces cerevisiae, pichia pastoris has simple operation, easy culture, high growth speed, high expression quantity of exogenous protein, high density fermentation by taking methanol as a unique carbon source by an AOX Jiang Xiaoqi promoter, and is strictly regulated and controlled by the methanol, thus being one of the strongest promoters with the strictest regulating and controlling mechanism at present, being capable of controlling the mass expression of the exogenous protein and releasing the exogenous protein outside cells in a secretion form, and having the same simple post-treatment of the product. Compared with Saccharomyces cerevisiae, the system has higher expression quantity of exogenous protein and low glycosylation degree, and the expression product can not have excessive glycosylation phenomenon. Pichia is therefore one of the most desirable eukaryotic expression systems at present.

The insulin precursor gene sequence has been rarely reported, and the applicant refers to Xu Yan et al in the prior study to optimize the insulin sequence and uses the insulin sequence for optimizing the insulin precursor gene sequence, but the expression effect in pichia pastoris is still poor. Therefore, the gene sequence of the insulin aspart precursor is further optimized to improve the expression quantity of the insulin aspart precursor at present, and the method has important practical significance in the aspect of industrialization requirements.

Disclosure of Invention

Therefore, the invention aims at solving the problems in the prior art, further optimizing the gene sequence of the insulin aspart precursor, and constructing the Pichia pastoris engineering strain for producing the insulin aspart precursor, which has high expression efficiency and convenient processing of the expression product, so as to reduce the production cost of the insulin aspart.

In order to achieve the purpose of the invention, the invention adopts the following technical scheme:

a codon optimized insulin aspart precursor gene has a sequence shown in SEQ ID NO 7-10.

The invention also provides a recombinant vector containing the codon-optimized insulin aspart precursor gene sequence.

In some embodiments, the recombinant vector is a ppiczαa vector.

The invention also provides a genetically engineered bacterium, and a host bacterium containing the recombinant vector.

In some embodiments, the host bacterium is pichia pastoris.

In some specific embodiments, the pichia is pichia X33, KM71, GS115, SDM1168, or SMD1165.

The invention also provides a preparation method of the genetically engineered bacterium, the codon-optimized insulin aspart precursor gene is connected to a constructed recombinant vector in the vector, and the host bacterium is transformed after identification.

The invention also provides application of the codon-optimized insulin aspart precursor gene, the recombinant vector and the genetically engineered bacterium in preparing medicaments for treating diabetes related diseases.

The invention also provides a production method of the insulin aspart precursor, which comprises the steps of inoculating the genetically engineered bacterium into a culture medium for fermentation culture.

According to the technical scheme, the invention provides a codon-optimized insulin aspart precursor gene, a recombinant vector, a genetic engineering bacterium and application thereof. The vector containing the further optimized insulin aspart precursor gene sequence converts pichia pastoris to obtain the pichia pastoris gene engineering strain with high expression efficiency. The genetically engineered strain of the invention can be used for producing the insulin aspart precursor, so that the aim of further improving the expression quantity of the insulin aspart precursor protein can be fulfilled.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a diagram of the digestion of recombinant plasmid XhoI, notI; m:5000bpMaker; a: plasmid cleavage results containing insulin aspart precursor Sequence No. 1; b: plasmid cleavage results containing insulin aspart precursor Sequence No.2; c: plasmid cleavage results containing insulin aspart precursor Sequence No.3; d: plasmid cleavage results containing insulin aspart precursor Sequence No.4; e: plasmid cleavage results containing insulin aspart precursor Sequence No.5; f: plasmid cleavage results containing insulin aspart precursor Sequence No.6; g: plasmid cleavage results containing insulin aspart precursor Sequence No.7; h: plasmid cleavage results containing insulin aspart precursor Sequence No.8; i: plasmid cleavage results containing insulin aspart precursor Sequence No.9; j: plasmid cleavage results containing insulin aspart precursor Sequence No. 10;

FIG. 2 shows colony PCR identification using Sequence No.14 and Sequence No.15 primers after electrotransformation of the insulin aspart precursor plasmid with Pichia pastoris; m:5000bpMaker; a: positive transformant PCR results containing Sequence No. 1; b: positive transformant PCR results containing Sequence No.2; c: positive transformant PCR results containing Sequence No.3; d: positive transformant PCR results containing Sequence No.4; e: positive transformant PCR results containing Sequence No.5; f: positive transformant PCR results containing Sequence No.6; g: positive transformant PCR results containing Sequence No.7; h: positive transformant PCR results containing Sequence No.8; i: positive transformant PCR results containing Sequence No.9; j: positive transformant PCR results containing Sequence No. 10;

FIG. 3 shows a pre-induction liquid phase profile; sample injection amount is 10 μl, and no target peak appears about 10 minutes;

FIG. 4 shows a shaking flask experimental induction 72h liquid phase profile of an original strain of insulin aspart precursor Sequence No. 1; sample injection amount 10 μl, peak time 10.309 min, peak area 544.566, expression amount 0.021g/L;

FIG. 5 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.2 strain; sample injection amount 10 μl, peak time 10.337 min, peak area 720.942, expression amount 0.036g/L;

FIG. 6 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.3 strain; sample injection amount 10 μl, peak time 10.355 min, peak area 1029.600, and expression amount 0.064g/L;

FIG. 7 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.4 strain; sample injection amount is 10 μl, peak time is 10.380 minutes, peak area is 1228.023, and expression amount is 0.072g/L;

fig. 8: shaking flask experiment of insulin aspart precursor Sequence No.5 strain induces a 72h liquid phase map; sample injection amount 10 μl, peak time 10.358 min, peak area 1128.812, and expression amount 0.083g/L;

FIG. 9 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.6 strain; sample injection amount 10 μl, peak time 10.398 min, peak area 1668.964, expression amount 0.102g/L;

FIG. 10 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.7 strain; sample injection amount 10 μl, peak time 10.329 min, peak area 2021.716, expression amount 0.114g/L;

FIG. 11 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.8 strain; sample injection amount 10 μl, peak time 10.390 min, peak area 2231.163, expression amount 0.133g/L;

FIG. 12 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.9 strain; sample injection amount 10 μl, peak time 10.371 min, peak area 2363.445, expression amount 0.145g/L;

FIG. 13 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.10 strain; sample injection amount 10 μl, peak time 10.409 min, peak area 2771.315, expression amount 0.170g/L;

FIG. 14 shows a shaking flask experimental induction 72h liquid phase diagram of insulin aspart precursor Sequence No.16 strain; sample injection amount 10 μl, peak time 10.293 min, peak area 1547.705, expression amount 0.091g/L;

FIG. 15 shows a liquid phase diagram of a 1000L fermentation culture 92h tank sample of insulin aspart precursor Sequence No.1 strain; sample injection amount 10 μl, peak time 10.368 min, peak area 4513.029, expression amount 0.390g/L;

FIG. 16 shows a liquid phase diagram of a 92h tank sample of 1000L fermentation culture of insulin aspart precursor Sequence No.10 strain. Sample injection amount 10 μl, peak time 10.368 min, peak area 6067.344, expression amount 5.310g/L;

FIG. 17 shows a shaking flask experimental induction 92h liquid phase diagram of insulin aspart precursor Sequence No.16 strain; sample injection amount 10 μl, peak time 10.298 min, peak area 5253.177, expression amount 3.200g/L;

FIG. 18 shows a pPICZ alpha A vector plasmid map;

FIG. 19 shows the protein expression before and after optimization of the insulin aspart precursor gene sequence;

FIG. 20 shows the expression of 1000L fermentations of insulin aspart precursor strain Sequence No.1, sequence No.10, sequence No.16 before and after optimization of the gene sequences of the insulin aspart precursors.

Detailed Description

The invention discloses a codon-optimized insulin aspart precursor gene, a recombinant vector, genetically engineered bacteria and application thereof. Those skilled in the art can, with the benefit of this disclosure, suitably modify the process parameters to achieve this. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the method and product of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods described herein without departing from the spirit and scope of the invention.

In order to further understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

In the present invention, there is no particular limitation concerning the design of the gene of the present invention and the method for producing the gene of the present invention, and the person skilled in the art can refer to any known method in the art for producing the gene. The optimized insulin aspart precursor gene design and synthesis are described in detail below. It is merely illustrative of the relevant method and is not limiting; other known methods, or modified methods, may also be employed. The method comprises the following specific steps:

1) Optimizing the original gene sequence according to the preferred codon of pichia pastoris to obtain an optimized insulin aspart precursor gene;

according to the amino acid sequence of the insulin aspart precursor, the codons of individual amino acids are replaced by codons favored by pichia pastoris, the codons are reasonably optimized according to the related content and technology of biological information, the stability of the gene is increased, the corresponding optimized insulin aspart precursor gene is obtained, and the expression level of the insulin aspart precursor in pichia pastoris is improved.

2) Constructing and identifying an expression vector containing the optimized insulin aspart precursor gene;

a) Construction of an expression vector containing an optimized insulin aspart precursor gene:

the sequences of sequences No.1, no.2, no.3, no.4, no.5, no.6, no.7, no.8, no.9 and No.10 were ligated between NotI and XhoI cleavage sites in pPICZ. Alpha.A vector, E.coli competent TOP10 was transformed, coated with kanamycin resistance plates containing 50. Mu.g/ml, and transformants were obtained after overnight incubation at 37 ℃.

tttgttaaccaacatttgtgtggttctcatttggttgaagctttgtacttggtttgtggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.1)。

tttgttaatcaacatttgtgtggttctcatttggttgaagctttgtacttggtttgtggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.2)。

tttgttaaccaacatttgtgtggatctcatttggttgaagctttgtacttggtttgtggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.3)。

tttgttaaccaacatttgtgtggttctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.4)。

tttgttaaccaacatttgtgtggttctcatttggttgaagctttgtacttggtttgtggtgaaagaggtttcttctatactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.5)。

tttgttaatcaacatttgtgtggttctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(Sequence NO.6)。

tttgttaaccaacatttgtgtggatctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(SEQ ID NO:7)。

tttgttaatcaacatttgtgtggatctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(SEQ ID NO:8)。

tttgttaatcaacatttgtgtggttctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctatactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(SEQ ID NO:9)。

tttgttaatcaacatttgtgtggatctcatttggttgaagctttgtacttggtttgcggtgaaagaggtttcttctatactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactgataa(SEQ ID NO:10)。

b) Identification of DNA transformants containing optimized aspen precursor: taking 3' AOX (Sequence No. 14) as an upstream primer and alpha-factor (Sequence No. 15) as a downstream primer, picking up transformants for colony PCR identification, defining the transformants with the DNA fragment size of 424bp as positive transformants by PCR, and carrying out DNA identification by checking and sequencing PCR samples.

gcaaatggcattctgacatcc(Sequence NO.14)；tactattgccagcattgctgc(Sequence NO.15)。

3) And (3) converting and expressing the optimized insulin aspart precursor gene into pichia pastoris.

a) Conversion of optimized insulin aspart precursor gene to pichia pastoris: after linearizing the positive recombinant plasmid with restriction endonuclease SacI, electrically transforming Pichia pastoris by adopting an electric shock method, screening recombinants on a YPD plate containing Zeocin resistance, carrying out colony PCR identification on the recombinants, defining the transformant with the DNA fragment size of 424bp as a positive transformant by PCR, and carrying out DNA identification by checking and sequencing PCR samples.

b) Inducible expression of Pichia pastoris containing optimized insulin aspart precursor gene in shake flask medium: positive transformants were inoculated into 100ml BMGY medium, after overnight culture, the medium was changed to BMMY medium, methanol was added to a final concentration of 0.5%, 0.5% methanol was added every 24 hours for induction, and after induction for 72 hours, the culture was terminated. And collecting fermentation liquor, centrifuging, and taking supernatant to carry out liquid phase detection on target protein.

Unless otherwise specified, all reagents involved in the examples of the present invention are commercially available products and are commercially available.

Example 1 optimal design of insulin aspart precursor Gene

1. Experimental materials

Primers and gene sequences used in the experiments were synthesized by the division of biological engineering (Shanghai); DNA polymerase, DNA ligase, restriction enzyme, pichia pastoris strain, pPICZ alpha A vector, purchased from Thermo Fisher company; both the plasmid extraction kit and the gel recovery kit are products of the division of biological engineering (Shanghai); gene sequencing was done by the division of bioengineering (Shanghai); other relevant reagents are all commercially available.

2. Method results

The method comprises the steps of obtaining an original insulin precursor gene Sequence (Sequence No. 1) based on a human insulin precursor gene Sequence (tttgttaaccaacatttgtgtggttctcatttggttgaagctttgtacttggtttgtggtgaaagaggtttcttctacactccaaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactaa (Sequence No. 12)) reported by Gurramkonda et al (Application of simple fed-batch technique to highlevel secretory production of insulin precursor using Pichia pastoris with subsequent purification and conversion to human insolal Cell industries 2010, 9:3), wherein the corresponding human insulin precursor amino acid Sequence is Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn (Sequence No. 13), replacing codons of individual amino acids with pichia pastoris preferred codons, reasonably optimizing the stability of exogenous genes and the expression level thereof in pichia pastoris through bioinformatics technology, and obtaining 9 optimized insulin precursor gene sequences (Sequence No.2, sequence No.3, sequence No.4, sequence No.5, sequence No.6, sequence No.7, sequence No.8, sequence No.9 and Sequence No. 10).

The specific optimization scheme is as follows:

replacing the 3-amino acid codon of the B chain in the Sequence NO.1 to obtain a Sequence NO.2;

replacing the 8-position amino acid codon of the B chain in the Sequence No.1 to obtain Sequence No.3;

replacing the 19 th amino acid codon of the B chain in the Sequence No.1 to obtain Sequence No.4;

replacing the 27 th amino acid codon of the B chain in the Sequence No.1 to obtain a Sequence No.5;

replacing the 19 th amino acid codon of the B chain in the Sequence No.2 to obtain Sequence No.6;

replacing the 19 th amino acid codon of the B chain in the Sequence No.3 to obtain Sequence No.7;

replacing the amino acid codon at the 8 th position of the B chain in the Sequence No.6 to obtain the Sequence No.8;

replacing 27 th amino acid codon of B chain in Sequence No.6 to obtain Sequence No.9;

substitution of the 27 th amino acid codon of the B chain in Sequence No.8 gives Sequence No.10.

The amino acid sequences corresponding to Sequence No. 1-10 are Sequence No.11.

Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Asp Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn(Sequence NO.11)。

1. Primer design

The PCR reaction and sequencing were performed using universal primers, including Primer No.1 and Primer No.2.

TABLE 1 first set of experimental primer sequence listing

Primer nameWeighing scale	Sequence numbering	Primer sequences
			Primer NO.1(3’AOX1)	Sequence NO.14	GCAAATGGCATTCTGACATCC
Primer NO.2(α-factor)	Sequence NO.15	TACTATTGCCAGCATTGCTGC

2. Gene synthesis and vector construction

Sequence No.1, sequence No.2, sequence No.3, sequence No.4, sequence No.5, sequence No.6, sequence No.7, sequence No.8, sequence No.9, sequence No.10 were synthesized by the company division of biological engineering (Shanghai). Pichia pastoris expression vectors are obtained by connecting the gene sequences with pPICZalpha A and are respectively named as pPICZalpha AA/B/C/D/E/F/G/H/I/J.

Example 2 expression and characterization of optimized insulin aspart precursor Gene in Pichia pastoris

1. Experimental materials

Pichia pastoris strains, restriction enzymes (SacI) were purchased from Thermo Fisher; both the plasmid extraction kit and the gel recovery kit are products of the division of biological engineering (Shanghai); gene sequencing was performed by biological engineering (Shanghai) Inc.

2. Method results

1. Conversion of optimized insulin aspart precursor genes to Pichia pastoris

Linearizing the expression vector pPICZ alpha AA/B/C/D/E/F/G/H/I/J containing the optimized insulin aspart precursor gene with restriction enzyme SacI, wherein the reaction system is 500 μl, and the method comprises the following steps: 10×fd buffer50μl、Sac I 25μl、pPICZαAA/B/C/D/E/F/G/H/I/J 50μl、ddH ₂ O375. Mu.l. The reaction conditions were 37℃for 15 minutes.

The linearized expression vector pPICZ alpha AA/B/C/D/E/F/G/H/I/J was transferred into the Pichia genome according to the electric shock transformation method on the Pichia expression operating manual. Positive recombinants were selected by incubation on zeocin-resistant plates at 30℃for 2-3 days. Transformants were streaked and colony PCR identified using Sequence No.14 and Sequence No.15 as upstream and downstream primers. Transformants amplified with the 424bp fragment of interest were designated as positive transformants. The reaction system was 50. Mu.l, comprising: 5 Xbuffer 10. Mu.l, dNTPs 1. Mu.l, 2.5. Mu.l each of the upstream and downstream primers, and MgCl as a single colony of the recombinant template ₂ 1.5. Mu.l, 1.5. Mu.l DMSO, and 0.5. Mu.l DNA polymerase. The reaction conditions are as follows: 98℃2min,98℃20s,64℃20s,72℃30s,30 cycles, 72℃5min.

2. Expression of Pichia pastoris containing optimized insulin aspart precursor gene in shake flask medium

After the positive transformants were kept, they were inoculated into 100ml of BMGY medium and cultured at 30℃for 24 hours, when the OD600 reached about 6, BMGY was discarded, 100ml of BMMY containing anhydrous methanol at a final concentration of 0.5% was added, and the culture was completed after 72 hours of induction. After centrifugation, the target protein was detected by using a Kromasil 100-5C4 liquid chromatography column, and the target protein was peaked at about 10 minutes.

As calculated from the results of the liquid phase detection, the expression level of the original gene Sequence (Sequence No. 1) was only 0.030g/L, while the optimized sequences Sequence No.2, sequence No.3, sequence No.4, sequence No.5, sequence No.6, sequence No.7, sequence No.8, sequence No.9 and Sequence No.10 were respectively 0.036, 0.064, 0.072, 0.083, 0.102, 0.114, 0.133, 0.145, 0.170g/L, and the expression levels were respectively improved by 1.7, 3.0, 3.4, 4.0, 4.9, 5.4, 6.3, 6.9 and 8.1 times. Meanwhile, the expression quantity of the optimized gene Sequence (Sequence No. 16) of Xu Yan and the like is 0.091, and the expression quantity is improved by 4.3 times.

3. Pichia pastoris containing optimized insulin aspart precursor gene for induced expression in 1000L fermenter

The highest expressed Sequence No.10 in shake flask medium was subjected to fermentation culture in a 1000L fermenter, while the strain of the original gene Sequence No.1 and the strain of the optimized gene Sequence (Sequence No. 16) of Xu Yan et al were used as controls. Inoculating the strain into YPG culture medium according to 1% proportion, activating at 30deg.C overnight, transferring into 50L seed tank for culturing for 14-18 h when OD600 reaches about 6, and inoculating into 1000L fermentation tank. After the target protein grows to the proper OD, the target protein is induced for 92 hours, and after sampling and centrifugation, the target protein is detected by using a Kromasil 100-5C4 liquid chromatographic column, and the target protein is peaked in about 10 minutes.

The calculation of the liquid phase detection results shows that the expression level of the 1000L fermentation tank of the strain with the original gene Sequence (Sequence No. 1) is only 0.390g/L, the expression level of the strain with the Sequence Sequnence No.16 reaches 3.200g/L, the expression level is improved by 8.2 times, the expression level of the optimized Sequence Sequnence No.10 can reach 5.310g/L, and the expression level is improved by 13.6 times. Therefore, the invention achieves the aim of further improving the expression quantity of the insulin aspart precursor protein after a series of codon optimization.

tttgttaaccagcacttgtgtggttctcatttggttgaggctttgtacttggtttgtggtgaaagaggtttcttctacactgacaaggctgctaagggtattgttgaacaatgttgtacttctatttgttctttgtaccaattggaaaactactgtaactaa(Sequence NO.16)。

Claims

1. A codon-optimized insulin aspart precursor gene, the sequence of which is shown in SEQ ID NO: 8-10.

2. A recombinant vector comprising the insulin aspart precursor gene sequence according to claim 1.

3. The recombinant vector of claim 2, which is a ppicza-a vector.

4. A genetically engineered bacterium which is a host bacterium comprising the recombinant vector according to claim 2 or 3.

5. The genetically engineered bacterium of claim 4, wherein the host bacterium is pichia pastoris.

6. The genetically engineered bacterium of claim 5, wherein the pichia is pichia X33, KM71, GS115, SDM1168, or SMD1165.

7. The method for preparing genetically engineered bacteria of claim 4, wherein the insulin aspart precursor gene of claim 1 is connected to a vector to construct a recombinant vector, and the host bacteria are transformed after identification.

8. Use of the codon optimized insulin aspart precursor gene of claim 1, the recombinant vector of claim 2 or 3, the genetically engineered bacterium of any one of claims 4-6 in the manufacture of a medicament for treating diabetes-related diseases.

9. A method for producing an insulin aspart precursor, comprising fermenting and culturing the genetically engineered bacterium of any one of claims 4 to 6 in an inoculation medium.