CN111560379B

CN111560379B - Codon-optimized insulin aspart precursor gene, recombinant vector, genetic engineering bacterium and application thereof

Info

Publication number: CN111560379B
Application number: CN202010455882.6A
Authority: CN
Inventors: 曹海燕; 张世野; 纪晓影; 王洪宇; 池营; 徐霞
Original assignee: Jilin Huisheng Biopharmaceutical Co ltd; Beijing Huizhiheng Biological Technology Co Ltd
Current assignee: Jilin Huisheng Biopharmaceutical Co ltd; Beijing Huizhiheng Biological Technology Co Ltd
Priority date: 2020-05-26
Filing date: 2020-05-26
Publication date: 2022-09-13
Anticipated expiration: 2040-05-26
Also published as: CN115927360A; CN111560379A; CN115927360B

Abstract

The application belongs to the technical field of genetic engineering, and discloses a codon-optimized insulin aspart precursor gene, a recombinant vector, a genetic engineering bacterium and application thereof. The vector containing the further optimized insulin aspart precursor gene sequence converts pichia pastoris to obtain the pichia pastoris gene engineering strain with high expression efficiency. The purpose of further improving the expression quantity of insulin aspart precursor protein can be achieved by adopting the genetic engineering strain to produce the insulin aspart precursor.

Description

Codon-optimized insulin aspart precursor gene, recombinant vector, genetic engineering bacterium and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to modification of an insulin aspart precursor gene and expression of a foreign protein, in particular to an insulin aspart precursor gene with optimized codons, a recombinant vector, a genetic engineering bacterium and application thereof.

Background

Diabetes is a group of metabolic diseases characterized by hyperglycemia, and is mainly characterized by polydipsia, polyphagia and polyuria emaciation caused by chronic hyperglycemia. Hyperglycemia occurring in the long term of diabetes results in chronic damage to, and dysfunction of, various tissues, particularly the eyes, kidneys, heart, blood vessels, nerves. The major causes of hyperglycemia are due to defects in insulin secretion or impaired biological action, or both. Among them, there is a defect in secretion or action of insulin, i.e., a disorder in metabolism of sugar, fat and protein caused by the pancreas failing to secrete sufficient insulin or the body failing to effectively use insulin secreted therefrom.

Insulin is a protein hormone secreted by the beta cells of the islets of langerhans in the pancreas stimulated by endogenous or exogenous substances such as glucose, lactose, ribose, arginine, glucagon, etc. Insulin is composed of two peptide chains, an A chain and a B chain, and has 51 amino acid residues in total. A. The sulfydryl of four Cys of A7-B7 and A20-B19 are arranged between the chains B to form two pairs of disulfide bonds, and the two Cys of A6-A11 in the chain A have one pair of intra-chain disulfide bonds. Insulin is a therapeutic drug for type I and type II diabetic patients. The requirement of energy metabolism is met by simulating the physiological insulin secretion condition of human body. For diabetic patients, the treatment by insulin can effectively reduce or alleviate the occurrence and development of the symptoms of type I and type II diabetes, so insulin becomes a more ideal treatment method.

Although natural insulin has the function of reducing blood sugar, the basic secretion and additional secretion of insulin of normal people cannot be simulated after injection, so that the dangerous condition of poor curative effect and even low blood sugar is caused. Therefore, on the basis of the research on the structure of insulin, the physicochemical and biological properties of insulin are modified by changing the amino acid sequence of certain specific sites on the insulin, the isoelectric point, the polymer strength, the fatty acid chain modification and other methods, and quick-acting insulin with short action time of peak onset and peak arrival and long-acting insulin with long action time of decomposition, absorption and absorption are respectively constructed to be used for simulating the additional secretion and the basal secretion of insulin in postprandial and fasting states of normal people.

Insulin aspart (insulin aspart) is a quick-acting insulin, developed and developed by danish norand norder, and is designed according to the principle that proline at position 28 of a B chain is replaced by aspartic acid by utilizing a gene recombination technology, and the introduction of anions can increase mutual repulsion among insulin molecules and prevent the formation of dimers among the insulin molecules. The insulin aspart preparation contains phenol, can be quickly absorbed after subcutaneous injection, and has the speed of dispersing in blood in vivo, the affinity of specific binding with an insulin receptor and the effect of reducing blood sugar of a medicament. Because insulin aspart exists in the form of insulin monomer, the absorption speed after subcutaneous injection is much faster than that of natural human insulin, the onset speed is about 2 times of that of the natural human insulin, and the incidence rate of hypoglycemia can be reduced because the insulin aspart has shorter action time than the natural human insulin. Insulin aspart has been widely used as a common rapid-acting insulin.

At present, insulin aspart is mainly produced by expression of saccharomyces cerevisiae, but the expression yield is low, the expression product has an over glycosylation phenomenon, and the effect is not ideal. Compared with saccharomyces cerevisiae, pichia pastoris is simple to operate, easy to culture, high in growth speed and high in exogenous protein expression amount, and the AOX strong promoter takes methanol as a unique carbon source to perform high-density fermentation, is strictly regulated by methanol, is one of the strongest promoters with the most strict regulation mechanism at present, can control a large amount of exogenous protein to be expressed and released to the outside of cells in a secretion mode, and is simple in product post-treatment. Compared with saccharomyces cerevisiae, the system has higher foreign protein expression level and low glycosylation degree, and the expression product does not generate excessive glycosylation. Therefore, pichia is one of the most ideal eukaryotic expression systems at present.

The sequence of the insulin aspart precursor gene is rarely reported, and the applicant refers to Xuyan and the like in previous researches to optimize the insulin sequence and uses the insulin sequence for optimizing the sequence of the insulin aspart precursor gene, but the expression effect of the insulin aspart precursor gene in pichia pastoris is still poor. Therefore, further optimizing the gene sequence of the insulin aspart precursor to improve the expression level of the insulin aspart precursor at present has important practical significance in the aspect of industrial requirements.

Disclosure of Invention

In view of the above, the present invention aims to further optimize the gene sequence of insulin aspart precursor and construct a pichia pastoris engineering strain for producing insulin aspart precursor, which has high expression efficiency and an expression product convenient to process, so as to reduce the production cost of insulin aspart.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

a codon optimized insulin aspart precursor gene has a sequence shown in SEQ ID NO 7-10.

The invention also provides a recombinant vector containing the codon-optimized insulin aspart precursor gene sequence.

In some embodiments, the recombinant vector is a pPICZ α a vector.

The invention also provides a genetic engineering bacterium, a host bacterium containing the recombinant vector

In some embodiments, the host bacterium is pichia pastoris.

In some embodiments, the pichia pastoris is pichia X33, KM71, GS115, SDM1168, or SMD 1165.

The invention also provides a preparation method of the genetic engineering bacteria, wherein the codon-optimized insulin aspart precursor gene is connected to a constructed recombinant vector in the vector, and the host bacteria are transformed after identification.

The invention also provides the codon-optimized insulin aspart precursor gene, the recombinant vector and the application of the genetic engineering bacteria in preparing medicaments for treating diabetes related diseases.

The invention also provides a production method of the insulin aspart precursor, and specifically relates to a method for inoculating the genetic engineering bacteria into a culture medium for fermentation culture.

According to the technical scheme, the invention provides the codon-optimized insulin aspart precursor gene, the recombinant vector, the genetic engineering bacteria and the application thereof. The vector containing the further optimized insulin aspart precursor gene sequence is used for transforming pichia pastoris to obtain a pichia pastoris gene engineering strain with high expression efficiency. The gene engineering strain of the invention is adopted to produce insulin aspart precursor, thus achieving the purpose of further improving the protein expression of the insulin aspart precursor.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows recombinant plasmid XhoI, NotI enzymatic cleavage map; m: 5000 bpMaker; a: the result of the enzyme digestion of the plasmid containing the aspartyl insulin precursor sequence NO.1; b: the result of the enzyme digestion of the plasmid containing the aspartyl insulin precursor sequence NO.2; c: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 3; d: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 4; e: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 5; f: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 6; g: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 7; h: the result of the enzyme digestion of the plasmid containing the aspartyl insulin precursor sequence NO.8; i: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 9; j: the result of the restriction enzyme digestion of the plasmid containing the aspartyl insulin precursor Sequence No. 10;

FIG. 2 shows the colony PCR identification using the Sequence No.14 and 15 primers after electroporation of insulin aspart precursor plasmid into Pichia pastoris; m: 5000 bpMaker; a: PCR results of the positive transformant containing Sequence No. 1; b: PCR results of the positive transformant containing Sequence No. 2; c: PCR results of the positive transformant containing Sequence No. 3; d: PCR results of the positive transformant containing Sequence No. 4; e: PCR results of the positive transformant containing Sequence No. 5; f: PCR results of the positive transformant containing Sequence No. 6; g: PCR results of the positive transformant containing Sequence No. 7; h: PCR results of the positive transformant containing Sequence No. 8; i: PCR results of the positive transformant containing Sequence No. 9; j: PCR results of the positive transformant containing Sequence No. 10;

FIG. 3 shows a pre-induction liquidus profile; the sample amount is 10 mul, and no target peak appears in about 10 minutes;

FIG. 4 shows the liquid chromatogram of shaking flask experiment induction for 72h of the aspart insulin precursor original strain Sequence NO. 1; the sample amount is 10 mul, the peak-out time is 10.309 minutes, the peak area is 544.566, and the expression amount is 0.021 g/L;

FIG. 5 shows the liquid phase chromatogram of shake flask experiment induction of aspartyl insulin precursor Sequence No.2 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.337 minutes, the peak area is 720.942, and the expression amount is 0.036 g/L;

FIG. 6 shows a liquid chromatogram of shake flask experiment induction of the aspart insulin precursor Sequence No.3 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.355 minutes, the peak area is 1029.600, and the expression amount is 0.064 g/L;

FIG. 7 shows a liquid phase diagram of the shaking flask experiment induction of the aspartyl insulin precursor Sequence No.4 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.380 minutes, the peak area is 1228.023, and the expression amount is 0.072 g/L;

FIG. 8: inducing a liquid phase map for 72h by a shake flask experiment of an insulin aspart precursor Sequence NO.5 strain; the sample amount is 10 mul, the peak-out time is 10.358 minutes, the peak area is 1128.812, and the expression amount is 0.083 g/L;

FIG. 9 shows a liquid chromatogram of shake flask experiment induction of the aspart insulin precursor Sequence No.6 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.398 minutes, the peak area is 1668.964, and the expression amount is 0.102 g/L;

FIG. 10 shows a liquid chromatogram of shake flask experiment induction for 72h of the aspart insulin precursor Sequence No.7 strain; the sample amount is 10 mul, the peak-off time is 10.329 minutes, the peak area is 2021.716, and the expression amount is 0.114 g/L;

FIG. 11 shows a liquid chromatogram of shake flask experiment induction of the aspart insulin precursor Sequence No.8 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.390 minutes, the peak area is 2231.163, and the expression amount is 0.133 g/L;

FIG. 12 shows a liquid chromatogram of shake flask experiment induction of aspart insulin precursor Sequence No.9 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.371 minutes, the peak area is 2363.445, and the expression amount is 0.145 g/L;

FIG. 13 shows a liquid chromatogram of shake flask experiment induction of the aspart insulin precursor Sequence No.10 strain for 72 h; the sample amount is 10 mul, the peak-out time is 10.409 minutes, the peak area is 2771.315, and the expression amount is 0.170 g/L;

FIG. 14 shows a liquid chromatogram of shake flask experiment induction of the aspart insulin precursor Sequence No.16 strain for 72 h; the sample injection amount is 10 mu L, the peak-off time is 10.293 minutes, the peak area is 1547.705, and the expression amount is 0.091 g/L;

FIG. 15 shows a liquid phase chromatogram of a sample placed in a tank after 1000L fermentation culture of an insulin aspart precursor Sequence No.1 strain for 92 h; the sample amount is 10 mul, the peak-off time is 10.368 minutes, the peak area is 4513.029, and the expression amount is 0.390 g/L;

FIG. 16 shows a liquid phase chromatogram of a sample placed in a tank after 1000L fermentation culture of an insulin aspart precursor Sequence No.10 strain for 92 h. The sample injection amount is 10 mu L, the peak-off time is 10.368 minutes, the peak area is 6067.344, and the expression amount is 5.310 g/L;

FIG. 17 shows a 92h liquid chromatogram of shake flask induction of the aspart insulin precursor Sequence No.16 strain; the sample amount is 10 mul, the peak-off time is 10.298 minutes, the peak area is 5253.177, and the expression amount is 3.200 g/L;

FIG. 18 shows a plasmid map of pPICZ α A vector;

FIG. 19 shows: optimizing protein expression conditions before and after the sequence of the insulin aspart precursor gene;

FIG. 20 shows the expression profiles of the aspartyl insulin precursor Sequence No.1 strain, Sequence No.10 strain, and Sequence No.16 strain 1000L fermentation before and after optimization of the aspartyl insulin precursor gene Sequence.

Detailed Description

The invention discloses a codon-optimized insulin aspart precursor gene, a recombinant vector, a genetic engineering bacterium and application thereof. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and products of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications of the methods described herein, as well as appropriate variations and combinations, may be made to implement and use the techniques of the present invention without departing from the spirit and scope of the invention.

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the present invention, there is no particular limitation concerning the design of the gene of the present invention and the method for preparing the gene of the present invention, and those skilled in the art can prepare the gene by referring to any known method in the prior art. The optimized aspart insulin precursor gene design and synthesis are described in detail below. It is merely illustrative of the relevant method and is not limiting; other known methods or modified methods may also be employed. The method comprises the following specific steps:

1) optimizing the original gene sequence according to the pichia pastoris preference codon to obtain an optimized insulin aspart precursor gene;

according to the amino acid sequence of the insulin aspart precursor, the codons of individual amino acids are designed to be replaced by the codons preferred by pichia pastoris, the codons are reasonably optimized through relevant content and technologies of biological information, the stability of the genes is improved, the optimized insulin aspart precursor genes are obtained, and the expression level of the insulin aspart precursor in the pichia pastoris is improved.

2) Constructing and identifying an expression vector containing an optimized insulin aspart precursor gene;

a) construction of expression vector containing optimized insulin aspart precursor Gene:

the Sequence of the genes Sequence No.1, 2, 3, 4, 5, 6, 7, 8, 9, 10 were ligated between NotI and XhoI cleavage sites in the pPICZ. alpha.A vector, and E.coli competent TOP10 was transformed, plated with kanamycin resistant plates containing 50. mu.g/ml, and cultured overnight at 37 ℃ to obtain transformants.

b) Identification of transformants containing optimized aspartyl precursor DNA: taking 3' AOX (Sequence NO.14) as an upstream primer and alpha-factor (Sequence NO.15) as a downstream primer, selecting a transformant to carry out colony PCR identification, defining the transformant with the DNA fragment size of 424bp obtained by PCR as a positive transformant, and sending a PCR sample to check and Sequence to carry out DNA identification.

3) And (3) transforming and expressing the optimized insulin aspart precursor gene into pichia pastoris.

a) Transformation of optimized insulin aspart precursor gene into pichia pastoris: after linearization of positive recombinant plasmids by using restriction endonuclease SacI, electrically transforming pichia pastoris by adopting an electric shock method, screening recombinants on a YPD plate containing Zeocin resistance, carrying out colony PCR identification on the recombinants, defining transformants with DNA fragments of 424bp obtained by PCR as positive transformants, and carrying out DNA identification by carrying out inspection sequencing on PCR samples.

b) Induced expression of pichia pastoris containing optimized insulin aspart precursor genes in shake flask culture medium: inoculating the positive transformant to 100ml of BMGY culture medium, culturing overnight, changing to BMMY culture medium, adding methanol to a final concentration of 0.5%, adding 0.5% methanol every 24h for induction, and finishing the culture after the induction lasts for 72 h. Collecting fermentation liquor, centrifuging, and taking supernatant to perform liquid phase detection on the target protein.

Unless otherwise specified, the reagents used in the examples of the present invention are commercially available products, and all of them can be purchased from commercial sources.

Example 1 optimal design of insulin aspart precursor Gene

First, experimental material

The primers and gene sequences used in the experiments were synthesized by Biotechnology engineering (Shanghai) GmbH; DNA polymerase, DNA ligase, restriction enzyme, Pichia strain, pPICZ. alpha.A vector were purchased from Thermo Fisher; the plasmid extraction kit and the glue recovery kit are both products of the company Limited in the biological engineering (Shanghai); gene sequencing was performed by Biotechnology engineering (Shanghai) Inc.; other relevant reagents are commercially available.

Second, method results

Based on the human insulin precursor gene Sequence (Sequence NO.12) reported by Gurramkoda et al (Application of simple fed-batch technology to high-grade Cell culture production of insulin precursor using Pichia pastoris with sub-Sequence purification and conversion to human insulin. Microbiological Cell industries 2010,9:3), an insulin aspart precursor original gene Sequence (Sequence NO.1) was obtained, in which codons of individual amino acids were replaced with Pichia preferred codons, and the stability and expression level of the exogenous gene in Pichia were reasonably optimized by bioinformatics techniques to increase the stability of the exogenous gene and the expression level thereof, to obtain 9 optimized insulin aspart precursor gene sequences (Sequence NO.2, Sequence NO.3, Sequence NO.4, Sequence NO.5, Sequence NO.8, Sequence NO.7, Sequence NO.8, and Sequence NO. 8).

The specific optimization scheme is as follows:

replacing the codon of amino acid at position 3 of the B chain in Sequence NO.1 to obtain Sequence NO. 2;

replacing 8 th amino acid codon of the B chain in the Sequence NO.1 to obtain Sequence NO. 3;

replacing 19 th amino acid codon of a B chain in the Sequence No.1 to obtain Sequence No. 4;

replacing the amino acid codon 27 of the B chain in the Sequence NO.1 to obtain Sequence NO. 5;

replacing 19 th amino acid codon of the B chain in the Sequence NO.2 Sequence to obtain Sequence NO. 6;

replacing 19 th amino acid codon of the B chain in the Sequence NO.3 to obtain Sequence NO. 7;

replacing 8 th amino acid codon of the B chain in the Sequence NO.6 to obtain Sequence NO. 8;

replacing the amino acid codon 27 of the B chain in the Sequence No.6 Sequence to obtain Sequence No. 9;

the Sequence NO.10 is obtained by replacing the codon of the amino acid 27 of the B chain in the Sequence NO. 8.

The amino acid Sequence corresponding to Sequence No.1 to No.10 is Sequence No. 11.

1. Primer design

The universal primers are used for PCR reaction and sequencing, and comprise a Primer NO.1 and a Primer NO. 2.

TABLE 1 sequence Listing of the first set of Experimental primers

Primer name	Sequence numbering	Primer sequences
			Primer NO.1(3’AOX1)	Sequence NO.14	GCAAATGGCATTCTGACATCC
Primer NO.2(α-factor)	Sequence NO.15	TACTATTGCCAGCATTGCTGC

2. Gene synthesis and vector construction

The sequences No.1, No.2, No.3, No.4, No.5, No.6, No.7, No.8, No.9 and No.10 were synthesized by Biotechnology works (Shanghai) Ltd. The gene sequence is connected with pPICZ alpha A to obtain a pichia pastoris expression vector which is named as pPICZ alpha AA/B/C/D/E/F/G/H/I/J respectively.

Example 2 expression and identification of optimized insulin aspart precursor Gene in Pichia pastoris

First, experimental material

Pichia pastoris strain, restriction endonuclease (SacI) from Thermo Fisher; the plasmid extraction kit and the glue recovery kit are both products of the company Limited in the biological engineering (Shanghai); gene sequencing was performed by Biotechnology engineering (Shanghai) Inc.

Second, method results

1. Optimized conversion of insulin aspart precursor gene into pichia pastoris

The optimized insulin aspart precursor gene expression vector pPICZ alpha AA/B/C/D/E/F/G/H/I/J is linearized by using restriction enzyme SacI, and the reaction system is 500 mu l and comprises the following steps: 10 XDD buffer 50. mu.l, Sac I25. mu.l, pPICZ. alpha. AA/B/C/D/E/F/G/H/I/J50. mu.l, ddH ₂ O375. mu.l. The reaction was carried out at 37 ℃ for 15 minutes.

The linear expression vector pPICZ alpha AA/B/C/D/E/F/G/H/I/J is transferred into a pichia pastoris genome according to an electric shock transformation method on a pichia pastoris expression operation manual. Positive recombinants were selected by culturing on a zeocin-resistant plate at 30 ℃ for 2-3 days. After the transformants were streaked, colony PCR was performed using Sequence No.14 and Sequence No.15 as upstream and downstream primers. The transformant in which the 424bp target fragment is amplified is determined as a positive transformant. The reaction system was 50. mu.l, comprising: 5 XBuffer 10 mul, dNTPs 1 mul, upstream and downstream primers 2.5 mul each, template as recombinant single colony, MgCl ₂ 1.5. mu.l, DMSO 1.5. mu.l, DNA polymerase 0.5. mu.l. The reaction conditions are as follows: 2min at 98 ℃, 20s at 64 ℃, 30s at 72 ℃ and 5min at 72 ℃ after 30 cycles.

2. Expression of Pichia pastoris containing optimized insulin aspart precursor gene in shake flask culture medium

After the positive transformants were kept, the transformants were inoculated into 100ml BMGY medium and cultured at 30 ℃ for 24 hours, when OD600 reached about 6, BMGY was discarded, 100ml BMMY containing absolute methanol at a final concentration of 0.5% was supplemented, and induction was completed after 72 hours. After sampling and centrifuging, the target protein is detected by using a Kromasil 100-5C4 liquid chromatography column, and the target protein is peaked in about 10 minutes.

The expression level of the original gene Sequence (Sequence NO.1) is only 0.030g/L, while the expression levels of the optimized

sequences

2, 3, 4, 5, 6, 7, 8, 9 and 10 are respectively 0.036, 0.064, 0.072, 0.083, 0.102, 0.114, 0.133, 0.145 and 0.170g/L, and are respectively increased by 1.7, 3.0, 3.4, 4.0, 4.9, 5.4, 6.3, 6.9 and 8.1 times. Meanwhile, the expression level of the optimized gene Sequence (Sequence NO.16) of Xuyan and the like is 0.091, and the expression level is improved by 4.3 times.

3. Pichia pastoris containing optimized insulin aspart precursor gene is induced to express in 1000L fermentation tank

The Sequence No.10, which was most highly expressed in the shake flask medium, was subjected to fermentation culture in a 1000L fermentor while using the strain of the protogenic Sequence No.1 and the strain of the optimized gene Sequence (Sequence No.16) such as Xuyan as controls. Inoculating the strain into YPG culture medium at a ratio of 1% for overnight activation at 30 deg.C, transferring into 50L seed tank when OD600 reaches about 6, culturing for 14-18 h, and inoculating into 1000L fermentation tank. Inducing for 92h after the growth to the proper OD, sampling and centrifuging, detecting the target protein by using a Kromasil 100-5C4 liquid chromatography column, and peaking the target protein about 10 minutes.

The liquid phase detection result shows that the expression level of the 1000L fermentation tank of the strain of the original gene Sequence (Sequence NO.1) is only 0.390g/L, the expression level of the strain of the Sequence Sequnce NO.16 reaches 3.200g/L, the expression level is improved by 8.2 times, the expression level of the optimized Sequence Sequnce NO.10 reaches 5.310g/L, and the expression level is improved by 13.6 times. Therefore, after a series of codon optimization, the purpose of further improving the expression level of insulin aspart precursor protein is achieved.

Sequence listing

<110> Jilin Hui Sheng biopharmaceutical Co., Ltd

<130> MP1937682

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tttgttaacc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 2

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tttgttaatc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 3

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tttgttaacc aacatttgtg tggatctcat ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 4

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tttgttaacc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 5

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tttgttaacc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctatac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 6

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tttgttaatc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 7

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tttgttaacc aacatttgtg tggatctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 8

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tttgttaatc aacatttgtg tggatctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 9

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tttgttaatc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctatac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 10

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tttgttaatc aacatttgtg tggatctcat ttggttgaag ctttgtactt ggtttgcggt 60

gaaagaggtt tcttctatac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact gataa 165

<210> 11

<211> 53

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr

1 5 10 15

Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Asp Lys Ala Ala Lys

20 25 30

Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu

35 40 45

Glu Asn Tyr Cys Asn

50

<210> 12

<211> 162

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tttgttaacc aacatttgtg tggttctcat ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tccaaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact aa 162

<210> 13

<211> 53

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr

1 5 10 15

Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys

20 25 30

Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu

35 40 45

Glu Asn Tyr Cys Asn

50

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcaaatggca ttctgacatc c 21

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tactattgcc agcattgctg c 21

<210> 16

<211> 162

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tttgttaacc agcacttgtg tggttctcat ttggttgagg ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tgacaaggct gctaagggta ttgttgaaca atgttgtact 120

tctatttgtt ctttgtacca attggaaaac tactgtaact aa 162

Claims

1. A codon optimized insulin aspart precursor gene having the amino acid sequence as set forth in SEQ ID NO:7, and (b) a sequence shown in the specification.

2. A recombinant vector comprising the sequence of insulin aspart precursor gene according to claim 1.

3. The recombinant vector according to claim 2, which is a pPICZ α A vector.

4. A genetically engineered bacterium which is a host bacterium containing the recombinant vector according to claim 2 or 3.

5. The genetically engineered bacterium of claim 4, wherein the host bacterium is Pichia pastoris.

6. The genetically engineered bacterium of claim 5, wherein the Pichia pastoris is Pichia pastoris X33, KM71, GS115, SDM1168 or SMD 1165.

7. The method for preparing the genetically engineered bacterium of claim 4, wherein the insulin aspart precursor gene of claim 1 is ligated to a vector to construct a recombinant vector, and the host bacterium is transformed after the recombinant vector is identified.

8. Use of the codon optimized insulin aspart precursor gene of claim 1, the recombinant vector of claim 2 or 3, the genetically engineered bacterium of any one of claims 4 to 6 for the manufacture of a medicament for the treatment of diabetes related diseases.

9. A method for producing insulin aspart precursor, comprising inoculating the genetically engineered bacterium of any one of claims 4 to 6 into a culture medium, and performing fermentation culture.