CN115927354A

CN115927354A - SH3TC2 gene pathogenic mutant and application thereof in preparation of peroneal muscular atrophy 4C type diagnostic kit

Info

Publication number: CN115927354A
Application number: CN202211039435.8A
Authority: CN
Inventors: 曾桥; 邓亚兰; 吴伟娟; 王维
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-08-29
Filing date: 2022-08-29
Publication date: 2023-04-07
Anticipated expiration: 2042-08-29
Also published as: CN115927354B

Abstract

The invention relates to the technical field of gene diagnosis, in particular to an SH3TC2 gene pathogenic mutant and application thereof in preparation of a peroneal muscular atrophy 4C type diagnostic kit. The invention discovers the c.590_591insAATG mutation for the first time by exome sequencing technology, and the mutation and the historically discovered c.3733_3734delGG mutation form a compound heterozygous mutation to cause the peroneal muscular atrophy 4C type, and a diagnostic reagent or a kit prepared by utilizing the compound heterozygous mutation can specifically distinguish peroneal muscular atrophy 4C type patients, carriers and normal people, can be used for quickly and effectively predicting or diagnosing the peroneal muscular atrophy 4C type, and can provide the guidance of eugenic care and treatment intervention. On the other hand, the SH3TC2 gene pathogenic mutant provided by the invention can provide new technical support for drug screening, drug effect evaluation and targeted therapy of peroneal muscular atrophy 4C type.

Description

SH3TC2 gene pathogenic mutant and application thereof in preparation of peroneal muscular atrophy 4C type diagnostic kit

Technical Field

The invention relates to the technical field of gene diagnosis, in particular to an SH3TC2 gene pathogenic mutant and application thereof in preparing a peroneal muscular atrophy 4C type diagnostic kit.

Background

The Charcot-Marie-Tooth disease is also called peroneal muscular atrophy, is a hereditary motor sensory neuropathy and is clinically mainly characterized by progressive muscle weakness and atrophy with sensory disturbance at the far end of limbs. Is the most common hereditary neuromuscular disease with an incidence of about 1/2500. The Charcot-Marie-Tooth disease type 4C (CMT 4C, MIM 601596) is a subtype of Charcot-Marie-Tooth disease, is an autosomal recessive hereditary hemorrhagic disease, the pathogenic gene SH3TC2 (MIM 608206) of which is positioned on chromosome 5q32, the gene is 80.9kb in full length, comprises 17 exons and 15 introns, and codes a repetitive sequence (tetratopopitide repeat, TPR) domain which consists of 1288 amino acids and contains multiple Src domains (Srcholography domains, SH 3) and tetrapeptide (34 amino acids), and the two domains form a special spatial structure to mediate the interaction of proteins, and the gene is specifically expressed in Schwann cells of the peripheral nervous system. The SH3TC2 gene encodes the Rab11 effector molecule, rab11 is a small CTP enzyme that regulates cellular endosomes and receptors back to the cell membrane, and mutations in the SH3TC2 gene fail to bind to Rab11 and result in failure to localize in intracellular recirculating endosomes, which is the fundamental molecular defect leading to CMT 4C. SH3TC2 protein also interacts with neuregulin-1 (Nrg 1)/ERBB, which is critical for the proliferation and migration of schwann cells and the formation of myelin. Thus, SH3TC2 is necessary to maintain the structural integrity of the myelin sheath of peripheral nerves. More than 100 kinds of mutation sites of the pathogenic SH3TC2 gene are found in the world. The gene mutation causes SH3TC2 dysfunction, so that the integrity of the peripheral nervous system cannot be maintained to cause diseases.

Gene mutation is an important genetic basis for the occurrence and development of diseases, and gene diagnosis is a gold standard for determining peroneal muscular atrophy type 4C. The clinical need is to establish corresponding detection technology aiming at different mutations and to be used for determining the cause and disease diagnosis. However, no diagnostic kit is reported for specifically distinguishing patients with peroneal muscular atrophy type 4C, carriers and normal population.

Disclosure of Invention

In order to solve the problems, the invention provides an SH3TC2 gene pathogenic mutant and application thereof in preparing a peroneal muscular atrophy 4C type diagnostic kit. The diagnostic kit prepared by using the SH3TC2 pathogenic mutant gene provided by the invention can assist in screening and diagnosing the mutation of the peroneal muscular atrophy 4C type gene, and can specifically distinguish peroneal muscular atrophy 4C type patients, carriers and normal people.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides an SH3TC2 pathogenic mutant gene, wherein the SH3TC2 pathogenic mutant gene comprises c.590_591insAATG; the c.590_591insAATG has AATG insertion mutation between positions 590 and 591 of exon6 with accession NM _ 024577.4.

The invention also provides an SH3TC2 gene pathogenic mutant, wherein the SH3TC2 gene pathogenic mutant is a composite heterozygous mutation and comprises c.3733_3734delGG and c.590_591insAATG described in the scheme; the c.3733_3734delGG has GG deletion mutations at positions 3733 and 3734 of exon17 with accession No. NM _ 024577.4.

The invention also provides a primer group for amplifying the SH3TC2 gene pathogenic mutant, wherein the primer group comprises: primer pair 1 and primer pair 2; the primer pair 1 comprises SH3TC2-1F and SH3TC2-1R; the primer pair 2 comprises SH3TC2-2F and SH3TC2-2R; the nucleotide sequence of the SH3TC2-1F is shown in SEQ ID NO. 1; the nucleotide sequence of the SH3TC2-1R is shown in SEQ ID NO. 2; the nucleotide sequence of the SH3TC2-2F is shown in SEQ ID NO. 3; the nucleotide sequence of the SH3TC2-2R is shown in SEQ ID NO. 4.

The invention also provides the SH3TC2 pathogenic mutant gene or the application of the SH3TC2 pathogenic mutant gene or the primer group in preparing a peroneal muscular atrophy 4C type diagnostic reagent or a kit.

The invention also provides a diagnosis kit for peroneal muscular atrophy 4C type, which comprises the primer group in the scheme.

Preferably, the diagnostic kit further comprises a sequencing primer; the sequencing primer comprises: primer pair 3 and primer pair 4; the primer pair 3 comprises SH3TC2-Seq1F and SH3TC2-Seq1R; the primer pair 4 comprises SH3TC2-Seq2F and SH3TC2-Seq2R; the nucleotide sequence of the SH3TC2-Seq1F is shown in SEQ ID NO. 5; the nucleotide sequence of the SH3TC2-Seq1R is shown in SEQ ID NO. 6; the nucleotide sequence of the SH3TC2-Seq2F is shown in SEQ ID NO. 7; the nucleotide sequence of the SH3TC2-Seq2R is shown in SEQ ID NO. 8.

Preferably, the diagnostic kit further comprises c.3733_3734delGG site positive mutation reference substance DNA1 and c.590_591insAATG site positive mutation reference substance DNA2; the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9; the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.

The invention also provides a method for identifying the genotype of the SH3TC2 gene pathogenic mutant, which comprises the following steps: taking the DNA of a sample to be detected as a template, and carrying out PCR amplification by using the primer group to obtain an amplification product; sequencing the amplified product to determine the genotype of the pathogenic mutant of the SH3TC2 gene.

Preferably, the reaction system for PCR amplification comprises 2 μ L of 10 XPCR buffer, 0.4 μ L of dNTPs, 0.5 μ L of SH3TC2-1F or SH3TC2-2F, 0.5 μ L of SH3TC2-1R or SH3TC2-2R, 1 μ L of template, 0.2 μ L of Taq enzyme and the balance ddH in terms of 20 μ L ₂ O。

Preferably, the reaction process of the PCR amplification comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 60s,30 cycles; the reaction was carried out at 72 ℃ for 7min.

Has the advantages that:

the invention provides an SH3TC2 pathogenic mutant gene, wherein the SH3TC2 pathogenic mutant gene comprises c.590_591insAATG; the c.590_591insAATG has AATG insertion mutation between positions 590 and 591 of exon6 with accession NM _ 024577.4. The invention discovers for the first time a SH3TC2: NM _ 024577.4. On the other hand, the invention lays an important foundation for the research of the pathogenesis of the peroneal muscular atrophy 4C type and provides a brand new theoretical basis for the treatment of the peroneal muscular atrophy 4C type patient. In a third aspect, the SH3TC2 gene pathogenic mutant provided by the invention can provide new technical support for drug screening, drug effect evaluation and targeted therapy of peroneal muscular atrophy 4C type.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments will be briefly described below.

FIG. 1 is a fibular muscular atrophy type 4C family 1 genetic map;

FIG. 2 is a graph showing the results of genotype detection of the c.3733-3734 delGG site of family No.1 by Sanger sequencing, wherein the A layer and the C layer: those mutated in family 1; layer B: genotype in family 1 is wild type;

FIG. 3 is a graph showing the results of detecting genotype of the c.590_591insAATG locus of family No.1 by Sanger sequencing, wherein layers B and C: those in family 1; layer A: genotype in family 1 is wild type;

FIG. 4 is a Charcot-tooth syndrome 4C type 2 pedigree genetic map of peroneal muscular atrophy;

FIG. 5 is a diagram showing the results of using the kit to detect the genotype of the ancestor pedigree 2 loci c.3733_3734delGG and c.590_591insAATG loci;

in FIGS. 2, 3 and 5, the arrows indicate the mutation sites.

Detailed Description

The invention provides an SH3TC2 pathogenic mutant gene, wherein the SH3TC2 pathogenic mutant gene comprises c.590_591insAATG; the c.590_591insAATG has AATG insertion mutations between positions 590 and 591 of exon6 with accession NM _ 024577.4.

The invention provides an SH3TC2 gene pathogenic mutant, wherein the SH3TC2 gene pathogenic mutant is a compound heterozygous mutation and comprises c.590_591insAATG and c.3733_3734delGG;

the c.590_591insAATG has AATG insertion mutation between the 590 th site and the 591 th site of the No.6 exon with the accession number NM _ 024577.4;

the c.3733_3734delGG has GG deletion mutations at positions 3733 and 3734 of exon17 with accession number NM _ 024577.4.

The c.590_591insAATG and c.3733_3734delGG are composite heterozygous mutations of peroneal muscular atrophy 4C-type pathogenic genes, are respectively derived from parent alleles and maternal alleles, and the cDNA sequence of the wild SH3TC2 gene refers to the sequence with Genbank accession number NM _ 024577.4; wherein c.590-591 insAATG is AATG insertion mutation between position 590 and position 591 of exon6 with the accession number NM-024577.4, so that the 197 th amino acid of the encoded protein is changed from cysteine to a stop codon; c.3733_3734delGG deletion mutations at positions 3733 and 3734 of exon17 with accession number NM _024577.4, resulting in the change of amino acid residue 1245 of the encoded protein from glycine to the stop codon.

The SH3TC2 gene pathogenic mutant screened by the invention can distinguish patients with peroneal muscular atrophy 4C, carriers and normal people, can be used as a biomarker for diagnosing peroneal muscular atrophy 4C, and can provide new technical support for medicament screening, medicament effect evaluation and targeted treatment of peroneal muscular atrophy 4C.

The invention provides a primer group for amplifying the SH3TC2 gene pathogenic mutant, which comprises the following components in percentage by weight: primer pair 1 and primer pair 2; the primer pair 1 comprises SH3TC2-1F and SH3TC2-1R; the primer pair 2 comprises SH3TC2-2F and SH3TC2-2R;

the nucleotide sequence of the SH3TC2-1F is shown in SEQ ID NO. 1: actcaggaggatggatt;

the nucleotide sequence of the SH3TC2-1R is shown in SEQ ID NO. 2: ggaaggcaacagtcaacc;

the nucleotide sequence of the SH3TC2-2F is shown in SEQ ID NO. 3: cgtcactttacttccagg;

the nucleotide sequence of the SH3TC2-2R is shown in SEQ ID NO. 4: ggtccccagccataca.

In the invention, the primer pair 1 can specifically amplify a gene fragment containing a c.3733_3734delGG mutation site or a corresponding wild-type gene fragment; the primer pair 2 can specifically amplify a gene fragment containing a c.590_591insAATG mutation site or a corresponding wild-type gene fragment.

The invention also provides application of the SH3TC2 pathogenic mutant gene or the SH3TC2 pathogenic mutant or the primer group in preparation of a peroneal muscular atrophy 4C type diagnostic reagent or a kit. The SH3TC2 pathogenic mutant gene or the SH3TC2 pathogenic mutant is used as a target, and a reagent or a kit capable of diagnosing the target genotype is designed, so that patients, carriers and normal people with peroneal muscular atrophy 4C can be specifically distinguished, peroneal muscular atrophy 4C can be quickly and effectively predicted or diagnosed, and the guidance of prenatal and postnatal care and therapeutic intervention can be provided.

The invention also provides a diagnosis kit for the peroneal muscular atrophy 4C type, which comprises the primer group, and preferably also comprises a sequencing primer. In the present invention, the sequencing primer preferably comprises: primer pair 3 and primer pair 4;

the primer pair 3 comprises SH3TC2-Seq1F and SH3TC2-Seq1R;

the primer pair 4 comprises SH3TC2-Seq2F and SH3TC2-Seq2R;

the nucleotide sequence of the SH3TC2-Seq1F is shown in SEQ ID NO. 5: tgggattggatgttgggg;

the nucleotide sequence of the SH3TC2-Seq1R is shown in SEQ ID NO. 6: gggcaggtggggtcaggata;

the nucleotide sequence of the SH3TC2-Seq2F is shown in SEQ ID NO. 7: tgaatagcattacttgtgt;

the nucleotide sequence of the SH3TC2-Seq2R is shown in SEQ ID NO. 8: aggctccaaggctgcgaca.

In the present invention, the primer pair 3 can sequence the gene fragment containing the c.3733_3734delGG mutation site or the corresponding wild-type gene fragment; the primer pair 4 can sequence the gene fragment containing the c.590_591insAATG mutation site or the corresponding wild-type gene fragment.

In the present invention, the diagnostic kit preferably further comprises c.3733_3734delGG site positive mutation reference DNA1 and c.590_591insAATG site positive mutation reference DNA2;

the single-stranded nucleotide sequence of the DNA1 is preferably shown as SEQ ID NO. 9: <xnotran> actcaggagatggggattggatgttgggcaaacaaacaaacaaacaaacaaacaaaaaaaactagagtggccagcacagcctcctagcctgtcctggaagtgtttgctaatgctgtctcttctttgcccccataccacggggttaggatgcccatgatgccactgagtacttccttctggccctggcagcagcggtcctgctgtgatgaggagcttcaggacaccattaggagcaggctggacaacatctgccagagccccctgtggcacagcaggccctccgggtgctcctcagagagggcgcggtggctgagtggtggtggcctggccctctgaggaaagctgtcctgtctctggacatttggcatggccagactctgaccccactgccctaggctcttaaatactcattgggagggtccgagtccttacctggcctagccccctcatttcacaagaagaagaatgaagtccaggaggagaagggctcattgcaggccacagaaagatttgatggtgcagcgatgagaattcctggttccaggctttgcatctggagcctttaccggttgactgttgccttcc; </xnotran>

The single-stranded nucleotide sequence of the DNA2 is preferably shown as SEQ ID NO. 10: <xnotran> cgtctactttacttccaggaagaaaagtactccagctctgaatagaagcattactttgtgtgataatccgttttcacttcctgctactccttagaaagccattgcttttctcattatccacaggccacttcttctgcagagccctgtgctccgtgactccaccagccgagaaggaaggggaatgaatgcttgacactttgcaagaatgagttaatctcagtgaagatggcagaagctggctccgagttggaaggcgtgtctttggtgacaggtcagcggggcctggtactggtgtcagccttggagcctctgcctctccctttccaccagtgagtagccatctgcctcctgggagcaagtcccagagcagactgaggtttgcacagaacagagtaggcatgctttcagatatgggcatccatagtgtggaggagagaacagattctgggtgggtctttatctttctgtctttttcttttcttttttaacaaccaagaattttaacaatctgatgaaattggagacaactctaaatttcagatgggcattgtacctagcagcaaatataccacacgaccgccaatgtagtgtttctccatgtatggactggggacc. </xnotran>

The invention also provides a method for identifying the genotype of the SH3TC2 gene pathogenic mutant, which comprises the following steps:

using the DNA of a sample to be detected as a template, and carrying out PCR amplification by using the primer group to obtain an amplification product;

sequencing the amplified product to determine the genotype of the SH3TC2 gene pathogenic mutant.

In the bookIn the invention, the reaction system for PCR amplification is 20 μ L, preferably comprises 2 μ L of 10 XPCR buffer, 0.4 μ L of dNTPs, 0.5 μ L of SH3TC2-1F or SH3TC2-2F, 0.5 μ L of SH3TC2-1R or SH3TC2-2R, 1 μ L of template, 0.2 μ L of Taq enzyme and the balance ddH ₂ O。

In the present invention, the reaction progress of the PCR amplification preferably includes: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 60s,30 cycles; the reaction was carried out at 72 ℃ for 7min.

In the present invention, the PCR buffer preferably comprises KCl 500mmol/L, tris-HCl100mmol/L and MgCl ₂ 15mmol/L; the pH of the Tris-HCl is preferably 8.3.

In the present invention, the sample preferably comprises blood.

The method preferably can determine the correlation between the individuals providing the samples to be detected and the peroneal muscular atrophy 4C type according to the genotype of the biomarker, and specifically comprises the following steps: comparing the sequencing result with the sequences of DNA1 and DNA2 described in the above scheme, wherein the C.3733-3734 delGG mutation is generated when the sequence is identical to the sequence of DNA1, and the C.590-591 insAATG mutation is generated when the sequence is identical to the sequence of DNA2;

when the genotype of the c.590_591insAATG site is a wild type (namely, the c.590_591insAATG mutation does not occur), and the genotype of the c.3733_3734delGG site is a wild type (namely, the c.3733_3734delGG mutation does not occur), providing that the individual to be detected is a normal individual;

when the genotype of the c.590_591insAATG site is c.590_591insAATG heterozygous mutation (one gene generates c.590_591insAATG mutation, the allele of which does not generate c.590_591insAATG mutation), the genotype of the c.3733_3734delGG site is c.3733_3734delGG heterozygous mutation (one gene generates c.3733_3734delGG mutation, the allele of which does not generate c.3733_3734delGG mutation), and the two mutated sites are on two chromosomes,

or the genotype of the c.590_591insAATG site is c.590_591insAATG homozygous mutation, the genotype of the c.3733_3734delGG site is c.3733_3734delGG heterozygous mutation,

or the genotype of the c.590_591insAATG site is c.590_591insAATG homozygous mutation, the genotype of the c.3733_3734delGG site is wild type,

or the genotype of the c.590_591insAATG site is wild type, the genotype of the c.3733_3734delGG site is c.3733_3734delGG homozygous mutation,

or the genotype of the c.590_591insAATG site is c.590_591insAATG heterozygous mutation, the genotype of the c.3733_3734delGG site is c.3733_3734delGG homozygous mutation,

or when the genotype of the c.590_591insAATG site is c.590_591insAATG homozygous mutation and the genotype of the c.3733_3734delGG site is c.3733_3734delGG homozygous mutation, the individual providing the sample to be detected is a fibula muscular atrophy 4C type patient;

when the genotype of the c.590_591insAATG site is c.590_591insAATG heterozygous mutation, the genotype of the c.3733_3734delGG site is c.3733_3734delGG heterozygous mutation, and the two mutated sites are on the same chromosome,

or when the genotype of the c.590_591insAATG site is a wild type, and the genotype of the c.3733_3734delGG site is c.3733_3734delGG heterozygous mutation,

or the genotype of the c.590_591insAATG site is c.590_591insAATG heterozygous mutation, and the genotype of the c.3733_3734delGG site is wild type, the individual providing the sample to be detected is a peroneal muscular atrophy 4C type carrier.

In order to further illustrate the present invention, the pathogenic mutant of SH3TC2 gene and its application in the preparation of a peroneal muscular atrophy 4C type diagnostic kit provided by the present invention are described in detail below with reference to the accompanying drawings and examples, which should not be construed as limiting the scope of the present invention.

Example 1

Sample acquisition

A peroneal muscular atrophy 4C family (abbreviated as family 1), and the clinical information of the partial members of family 1 is shown in table 1. FIG. 1 shows a family map of SH3TC2 gene mutation No.1, wherein,

indicates a male carrier to be present>

It is indicated as female carrier, \\ 9632and male patient, \\ 8599and as probation.

1. Diagnostic criteria:

reference may be made to "human monogenic genetic diseases" 2010 edition.

The Charcot-Marie-Tooth disease type 4C is an early-onset autosomal recessive demyelinating peripheral polyneuropathy, the clinical development of CMT4C is slow, the disease generally starts in childhood, the clinical manifestations are progressive distal muscle weakness and atrophy, arch feet, tendon reflex weakening or disappearance, distal limb somatosensory loss, the clinical characteristics are early severe scoliosis and cranial nerve involvement, and the early-onset hearing loss, mild facial paralysis, dysarthria and the like are usually presented. The arch foot and the scoliosis account for about 80 percent, and cranial nerve involvement, including hearing loss, facial muscle weakness, pupil dysreflexia, nystagmus and tongue muscle tremor, exists in about 50 percent of patients. Where hearing loss occurs most frequently. Nerve biopsy is characterized by reduction of marrow fibers, massive proliferation of Schwann cells, and changes like onion bulbs.

TABLE 1 clinical information of Charcot-Marie-Tooth disease type 4C family member of family No.1

Note: table 1/indicates that the age of the abandoned individual is unknown; is there a The phenotype of the abandoned individual is indicated by suspicious positive symptoms and signs.

As shown in FIG. 1, I (first generation) and II (second generation) are used as the numbering.

The family member No. 1I 1, I2, II 2 peripheral blood DNA was used for sequencing.

Exon sequencing

2. The instrumentation is shown in table 2.

Table 2 Instrument and Equipment List

3. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).

4. Reagent formulation

A stock solution of 5 XTBE electrophoresis solution was prepared as shown in Table 3.

TABLE 3 formulation of 5 XTBE electrophoretic solutions

Reagent	Tris	Boric acid	EDTA(pH 8.0,0.5mol/L)	ddH ₂ O
					Volume/weight	5.4g	750mg	2mL	90mL

By ddH ₂ O the final volume was adjusted to 100mL.

Working solution of 0.5 XTBE electrophoresis solution, ddH ₂ Dilution of O by 10 timesAnd (4) finishing.

10 × erythrocyte lysates were prepared according to table 4.

TABLE 4 erythrocyte lysate recipe

Reagent	NH ₄ Cl	KHCO ₃	EDTA	Add ddH ₂ O
					Volume/weight	82.9g	10g	0.37g	To 1000mL

Autoclaving, and storing at 4 deg.C.

1 × cell nucleus lysate was prepared according to Table 5.

TABLE 5 cell nucleus lysate recipe

Reagent	2M Tris-HCl，pH8.2	4M NaCl	2mM EDTA
				Volume/weight	0.5mL	10mL	0.4mL

5. Experimental procedure

After signing an informed consent, 3-5 mL of peripheral blood of members I: 1, I: 2 and II: 1in family No.1 was collected as a study sample.

5.1 sample DNA extraction

1) 3-5 mL of peripheral blood is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with 2-3 times volume is added, the mixture is evenly mixed and stands for 30 minutes on ice until the solution becomes transparent.

2) Centrifuge at 3000rpm for 10 minutes at 4 ℃ and carefully remove the supernatant. The pellet was mixed with 1mL of 1 Xcell nucleus lysate, followed by addition of 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS, and the mixture was shaken until it became viscous and transparent. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion was carried out at 37 ℃ for more than 6 hours or overnight.

3) Add equal volume of saturated phenol, shake gently and mix well, centrifuge at 3000rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform mixture (phenol: chloroform =1, v/v), and centrifuged at 3000rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.

6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out using a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring the OD value by ultraviolet.

7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.

5.2 exon sequencing

1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering 150-250 bp fragments;

2) Carrying out end repair on the DNA fragment and adding A at the 3' end;

3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing agarose gel electrophoresis on a small sample for quality control analysis;

5) NextSeq500 sequencer and data analysis.

5.3 results

The resulting disease-causing genetic composite hybrid mutations SH3TC2: NM — 024577.4; wherein the mutation of c.3733_3734delGG results in a change of the amino acid residue 1245 of the encoded protein from glycine to a stop codon; c.590-591 insAATG was mutated to change the amino acid at position 197 of the encoded protein from cysteine to a stop codon. The genotypes of the c.3733_3734delGG and c.590_591insAATG sites in the individual family 1 are the compound hybrid mutation of "C.3733_3734delGG hybrid mutation + C.590_591insAATG hybrid mutation", and the genotype at two sites in the individual SH3TC2 family carrier is the single hybrid mutation of "C.3733_3734delGG hybrid mutation" or "C.590_591insAATG hybrid mutation".

Example 2

Sanger sequencing validation

The c.3733_3734delGG and c.590_591insAATG sites were further verified using Sanger sequencing for exome sequencing results. The genotype detection of the c.3733_3734delGG and c.590_591insAATG loci was performed on 3 persons (proband, proband mother) in family 1 and 100 normal persons out of the family in example 1, respectively.

The method comprises the following specific steps:

1. DNA extraction

Normal human genomic DNA was extracted according to the method of example 1.

2. Candidate primer design, validation and optimization

2.1 candidate primer design reference human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome.ucsc.edu/cgi-bin/hgGateway.

2.2 for the mutation sites c.590_591insAATG and c.3733_3734delGG, 15 pairs of candidate primers are respectively designed (see Table 6), and PCR experiments are used for verifying and evaluating the advantages and disadvantages of each pair of candidate primers.

TABLE 6 summary of the basic conditions and the results of the verification experiment for each pair of candidate primers

2.3 candidate primer PCR validation reactions

Performing PCR according to the reaction system in Table 7 and keeping the reaction system on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 7) were provided for each pair of primers.

TABLE 7 primer detection PCR reaction System

Reaction conditions are as follows: placing the test reaction tube into a PCR instrument, and executing the following reaction procedures:

the first step is as follows: 95 ℃ for 5min;

the second step is that: 30 cycles (95 ℃,30sec → Tm,30sec → 72 ℃,60 sec); (PCR amplification parameters were set based on Tm values of the respective primers in Table 6).

The third step: 72 ℃,7min;

the fourth step: 4 ℃ until sampling.

2.4 agarose gel electrophoresis detection of the candidate primer PCR results to assess the effectiveness, specificity of the primer reaction:

1) The two ends of the cleaned and dried gel sample applicator are sealed by an adhesive tape, the gel sample applicator is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample applicator.

2) Weighing 2g agar powder in a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, taking out, shaking, heating until the gel is completely melted, taking out, and cooling at room temperature.

3) And when the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sample injector to ensure that the thickness is about 5 mm.

4) The gel is solidified, the adhesive tape is removed, and the gel and the sample injector are placed into an electrophoresis tank.

5) Adding electrophoresis buffer solution to make the liquid level 1-2 mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively and uniformly mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipette, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.

6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate the electrophoresis.

7) The power supply was cut off, the gel was taken out and placed in an EB aqueous solution of 0.5g/ml to dye for 10 to 15 minutes.

8) The gel was placed under a transmission ultraviolet irradiator to observe the result at a wavelength of 254nm, and photographed with a camera with a red color filter or the electrophoresis result was recorded with a gel scanning system.

2.5 evaluation of results:

1) If the No.7 tube only has a bright strip and no other strips, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;

2) If no target band appears in the No.7 tube, judging that the pair of primers and the reaction system are invalid;

3) If the primer-primer dimer band outside the target entry appears in the No.7 tube and the primer-dimer band also appears in the No.2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;

4) If the non-specific band outside the target band appears in the No.7 tube and also appears in the No.5 and No.6 tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If the primer dimer and the non-specific band appear outside the target band in the No.7 tube, and the primer dimer and the non-specific band also appear in the No.2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the statistical results after the verification test of the table 6 (the results are shown in the table 6), an optimal pair of SEQ ID NO.1 and SEQ ID NO.2 is selected as a primer for detecting the c.3733_3734delGG locus;

an optimal pair of SEQ ID NO.3 and SEQ ID NO.4 is selected as a primer for detecting the c.590_591insAATG site.

3. PCR amplification of mutation sites of pedigrees and 100 out-of-pedigrees

Samples of DNAs of family members and 100 family members were obtained according to step 5.1 in example 1, and PCR was carried out according to the reaction system in Table 8 while keeping the reaction system on ice.

TABLE 8 mutant site PCR reaction System

Reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction sequence was performed:

the first step is as follows: 95 ℃ for 5min;

the second step is that: 30 cycles (95 ℃,30sec → 58 ℃,30sec → 72 ℃,60 sec);

the third step: 72 ℃ for 7min;

the fourth step: 4 ℃ until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. And (3) carrying out enzymolysis purification on the PCR product: mu.L of exonuclease I (ExoI) and 1. Mu.L of alkaline phosphatase (AIP) were added to 5. Mu.L of the LPCR product, and the enzyme was digested at 37 ℃ for 15min and inactivated at 85 ℃ for 15min, respectively.

6. BigDye reaction

The BigDye reaction system is shown in table 9.

TABLE 9 BigDye reaction System

Reagent	Amount of the composition
		DNA after purification of PCR product	2.0μL
3.2 pmol/. Mu.L sequencing primer	1.0μL
		BigDye	0.5μL
5 × BigDye sequencing buffer	2.0μL
		ddH ₂ O	4.5μL

Sequencing PCR cycling conditions:

the first step is as follows: at 96 deg.C for 1min;

the second step is that: 33 cycles (96 ℃,30sec → 55 ℃,15sec → 60 ℃,4 min);

the third step: 4 ℃ until sampling.

7. Purification of BigDye reaction product:

1) Add 1. Mu.L 125mM EDTA (pH8.0) to each tube, add to the bottom of the tube, add 1. Mu.L 3mol/L NaAc (Ph5.2);

2) Adding 70 μ L70% ethanol, shaking and mixing for 4 times, standing at room temperature for 15min;

3) 3000g, centrifuging at 4 ℃ for 30min; immediately inverting 96-well plate, centrifuging at 185g for 1min;

4) Standing at room temperature for 5min, allowing residual alcohol to evaporate at room temperature, adding 10 μ L Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on computer.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, and designing a nested primer (the second group of primers are designed in the sequence range of the product obtained by amplifying the first group of primers) as a sequencing primer on the basis of the PCR optimal primer by using a sequencing primer.

The sequencing primer sequences aiming at the c.3733_3734delGG locus are shown as SEQ ID NO.5 and SEQ ID NO. 6;

the sequencing primer sequences aiming at the c.590_591insAATG site are shown as SEQ ID NO.7 and SEQ ID NO. 8.

9. Analysis of results

The sequencing results are shown in fig. 2 and fig. 3, wherein the positions indicated by the arrows in the sequencing diagram in fig. 2, layer a and layer C, show that the genotype of the individual SH3TC2: NM — 024577.4. The positions B and C indicated by the arrows in the profile in fig. 3 show that the genotype at the site of individual SH3TC2: NM — 024577.4.

Sanger sequencing results show that the genotypes of the c.3733_3734delGG and c.590_591insAATG loci of 1 patient in family 1 are composite hybrid mutations of 'C.3733 _3734delGG hybrid mutation + C.590_591insAATG hybrid mutation'; the genotype of the locus of 2 carriers in family No.1 is a single heterozygous mutation of "C.3733_3734delGG heterozygous mutation" or "C.590_591insAATG heterozygous mutation", respectively; the genotypes of the c.3733_3734delGG and c.590_591insAATG loci of the 100 normal controls without kindred relationship are "wild-type". The SH3TC2 gene pathogenic mutant c.3733_3734delGG and c.590_591insAATG provided by the invention can specifically distinguish patients, carriers and normal people with peroneal muscular atrophy 4C.

Example 3

Fibula amyotrophic lateral sclerosis 4C type diagnostic kit and application

1. The kit comprises the following components:

1) An amplification primer: concentrations and volumes are as in table 8, as shown in 2.6 of example 2;

2) Buffer concentrations and volumes are as in table 8;

3) The Taq enzyme concentration and volume are as shown in Table 8;

4) dNTPs concentrations and volumes are as in Table 8;

5) c.590_591insAATG and c.3733_3734delGG positive mutation reference substance DNA, wherein the reference substance is a section of double-stranded DNA, and the specific sequence of a single strand of the c.3733_3734delGG positive mutation reference substance is shown as SEQ ID NO. 9;

the specific sequence of the single chain of the c.590_591insAATG positive mutation reference substance is shown in SEQ ID No. 10.

6) Sequencing primers: shown as SEQ ID NO. 5-SEQ ID NO. 8.

2. The using method comprises the following steps: clinical information for application to family 2, the fibular muscular atrophy 4C type 2 family member, is shown in table 10.

TABLE 10 clinical information on Charcot-tooth 4C family 2 members

As shown in FIG. 4, I (first generation) and II (second generation) are used as the numbering. Wherein,

indicates a male carrier to be present>

Indicating a female carrier, \9632; indicating a male patient, \ 8599indicating a fetus, \ 8599and indicating a proband patient.

The 2 family II 3 peripheral blood DNA is used for the detection of the kit.

1) Extracting genome DNA: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;

3) Purifying the PCR amplification product;

4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;

5) Purifying BiyDye reaction products;

6) Sequencing the BiyDye reaction product, and comparing the sequencing sequence with a normal sequence; the specific procedures of steps 2) to 6) refer to steps 3 to 8 in example 2. The sequencing results are shown in FIG. 5.

Sequencing results show that the pro-mutant in family 2, SH3TC2: NM _ 024577.4. The position indicated by the arrow in the sequencing diagram of FIG. 5 shows that the genotype of the proband sibling c.3733_3734delGG locus is the "C.3733_3734delGG heterozygous mutation" heterozygous mutation, and the genotype of the c.590_591insAATG locus is the "C.590_591insAATG heterozygous mutation"; FIG. 5 shows the results of the proband brother also being a Charcot-Marie-Tooth disease type 4C patient, with the genetic counseling being a suggestion for early intervention treatment; and advising the patient that the patient later, if pregnant, must go to the hospital for prenatal diagnosis.

In conclusion, the diagnostic kit prepared by using the SH3TC2 gene pathogenic mutant provided by the invention can assist in screening and diagnosing the peroneal muscular atrophy 4C type gene mutation, and can specifically distinguish peroneal muscular atrophy 4C type patients, carriers and normal people.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. An SH3TC2 pathogenic mutant gene is characterized in that the SH3TC2 pathogenic mutant gene comprises c.590_591insAATG;

the c.590_591insAATG has AATG insertion mutations between positions 590 and 591 of exon6 with accession NM _ 024577.4.

2. An SH3TC2 gene pathogenic mutant is characterized in that the SH3TC2 gene pathogenic mutant is a compound hybrid mutation and comprises c.590_591insAATG and c.3733_3734delGG;

the c.3733_3734delGG has GG deletion mutations at positions 3733 and 3734 of exon17 with accession No. NM _ 024577.4.

3. A primer set for amplifying pathogenic mutants of SH3TC2 gene according to claim 2, wherein the primer set comprises: primer pair 1 and primer pair 2;

the primer pair 1 comprises SH3TC2-1F and SH3TC2-1R;

the primer pair 2 comprises SH3TC2-2F and SH3TC2-2R;

the nucleotide sequence of the SH3TC2-1F is shown in SEQ ID NO. 1;

the nucleotide sequence of the SH3TC2-1R is shown in SEQ ID NO. 2;

the nucleotide sequence of the SH3TC2-2F is shown in SEQ ID NO. 3;

the nucleotide sequence of the SH3TC2-2R is shown in SEQ ID NO. 4.

4. Use of the SH3TC2 pathogenic mutant gene of claim 1 or the SH3TC2 pathogenic mutant of claim 2 or the primer set of claim 3 in the preparation of a peroneal muscular atrophy 4C-type diagnostic reagent or kit.

5. A diagnostic kit for peroneal muscular atrophy type 4C, comprising the primer set of claim 3.

6. The diagnostic kit of claim 5, further comprising a sequencing primer; the sequencing primer comprises: primer pair 3 and primer pair 4;

the primer pair 3 comprises SH3TC2-Seq1F and SH3TC2-Seq1R;

the primer pair 4 comprises SH3TC2-Seq2F and SH3TC2-Seq2R;

the nucleotide sequence of the SH3TC2-Seq1F is shown in SEQ ID NO. 5;

the nucleotide sequence of the SH3TC2-Seq1R is shown in SEQ ID NO. 6;

the nucleotide sequence of the SH3TC2-Seq2F is shown in SEQ ID NO. 7;

the nucleotide sequence of the SH3TC2-Seq2R is shown in SEQ ID NO. 8.

7. The diagnostic kit according to claim 5 or 6, wherein the diagnostic kit further comprises c.3733_3734delGG site-positive mutation reference DNA1 and c.590_591insAATG site-positive mutation reference DNA2;

the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9;

the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.

8. A method for identifying the genotype of a pathogenic mutant of SH3TC2 gene according to claim 2, which comprises the steps of:

carrying out PCR amplification by using a sample DNA to be detected as a template and using the primer group of claim 3 to obtain an amplification product;

sequencing the amplified product to determine the genotype of the pathogenic mutant of the SH3TC2 gene.

9. The method as claimed in claim 8, wherein the reaction system for PCR amplification comprises 2 μ L of 10 XPCR buffer, 2 μ L of dNTPs0.4 μ L, SH3TC2-1F or SH3TC2-2F0.5 μ L, SH3TC2-1R or SH3TC2-2R0.5 μ L, 1 μ L of template, 0.2 μ L of Taq enzyme, and the balance ddH, in 20 μ L ₂ O。

10. The method of claim 8, wherein the PCR amplification reaction process comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 60s,30 cycles; the reaction was carried out at 72 ℃ for 7min.