CN115216534A - Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma - Google Patents

Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma Download PDF

Info

Publication number
CN115216534A
CN115216534A CN202210767426.4A CN202210767426A CN115216534A CN 115216534 A CN115216534 A CN 115216534A CN 202210767426 A CN202210767426 A CN 202210767426A CN 115216534 A CN115216534 A CN 115216534A
Authority
CN
China
Prior art keywords
alox12b
mutation
snp1
snp2
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210767426.4A
Other languages
Chinese (zh)
Inventor
曾桥
李婵艺
刘鑫林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Jiahui Biotechnology Co Ltd
Original Assignee
Hunan Jiahui Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Jiahui Biotechnology Co Ltd filed Critical Hunan Jiahui Biotechnology Co Ltd
Priority to CN202210767426.4A priority Critical patent/CN115216534A/en
Publication of CN115216534A publication Critical patent/CN115216534A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of gene diagnosis, in particular to a diagnostic reagent and a kit for nonbullous congenital ichthyosis erythroderma. The invention discovers that the SNP1 and SNP2 site compound heterozygous mutation can cause the non-bullous congenital ichthyosis erythroderma for the first time through exome sequencing technology, and a diagnostic reagent prepared according to the compound heterozygous mutation can specifically distinguish non-bullous congenital ichthyosis erythroderma patients, carriers and normal people, can be used for quickly and effectively predicting or diagnosing the non-bullous congenital ichthyosis erythroderma, and can provide the guidance of sound birth and sound care and therapeutic intervention. On the other hand, the invention lays an important foundation for the research on the pathogenesis of the nonbullous congenital ichthyosiform erythroderma, and provides a brand new theoretical basis for the treatment of the nonbullous congenital ichthyosiform erythroderma patients. In a third aspect, the invention may provide potential drug targets for the treatment of nonbullous congenital ichthyosiform erythroderma.

Description

Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma
Technical Field
The invention relates to the technical field of gene diagnosis, in particular to a diagnostic reagent and a kit for nonbullous congenital ichthyosiform erythroderma.
Background
Ichthyosis is a group of hereditary dyskeratosis skin diseases characterized by dry skin with flaky ichthyosis, and the incidence rate is 1/2000-1/9500. Clinically, the traditional Chinese medicine composition is commonly used for treating autosomal dominant hereditary ichthyosis, X-linked recessive hereditary ichthyosis, bullous ichthyosiform erythroderma, lamellar ichthyosiform and non-bullous congenital ichthyosiform erythroderma. Nonbullous congenital ichthyosiform erythroderma is an autosomal recessive genetic disease. The disease appears as a collodion-like fetus at birth, the later skin lesion gradually fades, and most of the disease tends to be improved in adolescence; the skin damage is white or gray superficial, semi-adhesive bright scale; the face, arms and trunk are fine, soft, feathery scales, which appear as lamellar or discoid scales in both lower extremities, possibly with palmoplantar keratosis and alopecia areata. The pathological examination of skin tissue has hyperkeratosis, mild parakeratosis and acanthosis, and infiltration of superficial dermal lymphocytes. Mutations in the 12-R lipoxygenase gene (ALOX 12B), lipoxygenase 3 gene (ALOXE 3), and transglutaminase 1 gene (TGM 1) can cause the disease. The ALOX12B gene is located on a chromosome 17p13.1, has the full length of 15kb, comprises 15 exons and 14 introns and codes 701 amino acids; at present, a plurality of ALOX12B gene mutation types are reported internationally, and most of the ALOX12B gene mutation types are missense mutations.
Therefore, genetic mutations are an important genetic basis for the development of disease, and genetic diagnosis is the gold standard for the definitive diagnosis of nonbullous congenital ichthyosiform erythroderma. Corresponding detection technologies need to be established aiming at different mutations clinically and used for determining causes of diseases and disease diagnosis, and detection methods for gene mutation sites genotypes in the prior art comprise restriction enzyme fragment length polymorphism, single-strand conformation polymorphism, allele specific oligonucleotide hybridization and the like, but the detection methods can not simultaneously meet the purposes of qualitative, quantitative and determining mutant gene sequences, so that primers need to be designed aiming at specific mutation sites, and the sanger sequencing technology is combined to complete the gene sequence detection work. However, no diagnostic reagent has been reported that can specifically distinguish between patients, carriers and normal population of patients with nonbullous congenital ichthyosiform erythrodermia.
Disclosure of Invention
In order to solve the above problems, the present invention provides a diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma. The diagnostic reagent provided by the invention can assist in screening and diagnosing gene mutation of the non-bullous congenital ichthyosiform erythroderma, and can specifically distinguish non-bullous congenital ichthyosiform erythroderma patients, carriers and normal people.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a biomarker for diagnosing nonbullous congenital ichthyosiform erythroderma, wherein the biomarker is a compound heterozygous mutation of an ALOX12B gene;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
The invention also provides application of the biomarker in preparing a diagnostic reagent or a kit for nonbullous congenital ichthyosiform erythroderma, wherein the biomarker is a compound heterozygous mutation of an ALOX12B gene;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
The invention also provides a diagnostic reagent for nonbullous congenital ichthyosiform erythroderma, which comprises a primer for amplifying a biomarker;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM _ 001139.3;
primers for amplifying the SNP1 comprise ALOX12B-1F and ALOX12B-1R;
primers for amplifying the SNP2 comprise ALOX12B-2F and ALOX12B-2R;
the nucleotide sequence of the ALOX12B-1F is shown as SEQ ID NO. 1;
the nucleotide sequence of the ALOX12B-1R is shown as SEQ ID NO. 2;
the nucleotide sequence of the ALOX12B-2F is shown as SEQ ID NO. 3;
the nucleotide sequence of the ALOX12B-2R is shown as SEQ ID NO. 4.
The invention also provides application of the reagent in preparing a diagnostic kit for the nonbullous congenital ichthyosiform erythroderma.
The invention also provides a diagnostic kit for the non-bullous congenital ichthyosiform erythroderma, which comprises the reagent and a sequencing primer.
Preferably, the sequencing primer comprises a first primer pair for sequencing the amplified fragment containing the SNP1 and a second primer pair for sequencing the amplified fragment containing the SNP2;
the primer pair I comprises ALOX12B-Seq1F and ALOX12B-Seq1R;
the second primer pair comprises ALOX12B-Seq2F and ALOX12B-Seq2R;
the nucleotide sequence of the ALOX12B-Seq1F is shown as SEQ ID NO. 5;
the nucleotide sequence of the ALOX12B-Seq1R is shown in SEQ ID NO. 6;
the nucleotide sequence of the ALOX12B-Seq2F is shown as SEQ ID NO. 7;
the nucleotide sequence of the ALOX12B-Seq2R is shown in SEQ ID NO. 8.
Preferably, the diagnostic kit further comprises an SNP1 site positive mutation reference substance DNA1 and an SNP2 site positive mutation reference substance DNA2;
the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9;
the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.
The present invention also provides a method for identifying the genotype of biomarkers comprising SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM _ 001139.3;
the method comprises the following steps:
using DNA of a sample to be detected as a template, and performing PCR amplification by using the primers in the diagnostic reagent to obtain an amplification product;
sequencing the amplified product to determine the genotype of the biomarker.
Preferably, the reaction process of the PCR amplification comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 60s, and 33 cycles; the reaction was carried out at 72 ℃ for 7min.
Preferably, the reaction system for PCR amplification is 20 μ L, and comprises 2 μ L of 10 XPCR buffer, 0.4 μ L of dNTPs, 0.5 μ L of ALOX12B-1F or ALOX12B-2F, 0.5 μ L of ALOX12B-1R or ALOX12B-2R, 1 μ L of template, 0.2 μ L of Taq enzyme and the balance ddH 2 O。
Has the advantages that:
the invention provides a biomarker for diagnosing nonbullous congenital ichthyosiform erythroderma, wherein the biomarker is a compound heterozygous mutation of an ALOX12B gene; the biomarkers include S NP1 and SNP2; SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3; SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3. The invention discovers for the first time that the complex heterozygous mutation at the SNP1 (NM _ 001139.3. On the other hand, the invention lays an important foundation for the research on the pathogenesis of the nonbullous congenital ichthyosiform erythroderma, and provides a brand new theoretical basis for the treatment of the nonbullous congenital ichthyosiform erythroderma patients. In a third aspect, the invention may provide a potential drug target for the treatment of non-bullous congenital ichthyosiform erythroderma.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required in the embodiments will be briefly described below.
FIG. 1 is a family genetic map of nonbullous congenital ichthyosiform erythroderma No. 1; wherein, the first and the second end of the pipe are connected with each other,
Figure BDA0003722693090000031
it is indicated that the male carrier is,
Figure BDA0003722693090000032
indicating female carrier, \ 8599, indicating probation,
Figure BDA0003722693090000033
o denotes a deceased female patient,. O denotes a fetus;
FIG. 2-1 is a graph showing the results of genotyping ALOX12B: NM-001139.3: a carrier in family; layer C: the first disease of non-bullous congenital ichthyosiform erythroderma in the family; layer D: normal individuals (the arrow in the sequencing graph indicates the site where the mutation occurs);
FIG. 2-2 is a graph showing the results of detection of the genotype of ALOX12B: NM-001139.3: a carrier in family; layer C: a nonperfectic congenital ichthyosiform erythroderma proboscis in the family; layer D: normal individuals (the arrow in the sequencing graph indicates the site where the mutation occurs);
FIG. 3 is a family genetic map of nonbullous congenital ichthyosiform erythroderma No. 2; wherein, the first and the second end of the pipe are connected with each other,
Figure BDA0003722693090000041
it represents a male carrier of the human,
Figure BDA0003722693090000042
indicating female carrier, \ 8599, indicating probation, \9679, indicating female patient,
Figure BDA0003722693090000043
indicating a deceased male patient;
FIG. 4-1 is a graph showing the results of genotyping ALOX12B: NM-001139.3: a carrier in family; layer C: patients with nonbullous congenital ichthyosiform erythroderma in family (mutation position indicated by arrow in sequencing chart)
FIG. 4-2 is a graph of ALOX12B detected by Sanger sequencing NM-001139.3: results plot for exon15: c.2060A > G: p.Y687C site genotype, wherein, layer A and layer B: a carrier in family; layer C: patients with nonbullous congenital ichthyosiform erythrodermic disease in the family (the arrow in the sequencing chart indicates the site of mutation);
FIG. 5 is a graph showing the results of complex heterozygous mutation sites of the ALOX12B gene of the invention.
Detailed Description
The invention provides a biomarker for diagnosing nonbullous congenital ichthyosiform erythroderma, which is a compound heterozygous mutation of an ALOX12B gene;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
SNP1 and SNP2 are complex heterozygous mutations of pathogenic genes of nonbullous congenital ichthyosiform erythroderma, and are respectively from alleles on 17 chromosomes of a father source and a mother source; wherein the 1405 st base of exon11 with accession No. NM _001139.3 is mutated from C to T, resulting in the replacement of the 469 th amino acid of the amino acid sequence expressed by ALOX12B gene with tryptophan; the base at 2060 of exon15 with accession No. NM-001139.3 was mutated from A to G, resulting in the substitution of tyrosine for cysteine at 687 in the amino acid sequence expressed by ALOX12B gene.
The disease causing gene mutation screened by the invention can distinguish patients, carriers and normal population with the non-bullous congenital ichthyosiform erythroderma, so the disease causing gene mutation can be used as a biomarker for diagnosing the non-bullous congenital ichthyosiform erythroderma.
The invention provides application of a biomarker in preparing a diagnostic reagent or a kit for nonbullous congenital ichthyosiform erythroderma, wherein the biomarker is a compound heterozygous mutation of an ALOX12B gene; the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
The invention also provides a diagnostic reagent for nonbullous congenital ichthyosiform erythroderma, which comprises a primer for amplifying a biomarker;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has A > G mutation at position 2060 of exon15 with accession number NM-001139.3;
primers for amplifying the SNP1 comprise ALOX12B-1F and ALOX12B-1R;
primers for amplifying the SNP2 comprise ALOX12B-2F and ALOX12B-2R;
the nucleotide sequence of the ALOX12B-1F is shown as SEQ ID NO. 1: ggaggacttcccatttgc;
the nucleotide sequence of the ALOX12B-1R is shown as SEQ ID NO. 2: gggctgagggtgtgtgtgtgtgt;
the nucleotide sequence of the ALOX12B-2F is shown as SEQ ID NO. 3: tactagcggcgtcaagg;
the nucleotide sequence of the ALOX12B-2R is shown as SEQ ID NO. 4: ccagaccagggaaaggaa.
The diagnostic reagent provided by the invention can specifically amplify the gene segment containing the biomarker sites.
The invention also provides application of the reagent in preparing a diagnostic kit for the nonbullous congenital ichthyosis erythroderma.
The invention also provides a diagnostic kit for the non-bullous congenital ichthyosiform erythroderma, which comprises the reagent and a sequencing primer.
In the present invention, the sequencing primers include a first primer pair for sequencing the amplified fragment containing SNP1 and a second primer pair for sequencing the amplified fragment containing SNP2;
the primer pair I comprises ALOX12B-Seq1F and ALOX12B-Seq1R;
the second primer pair comprises ALOX12B-Seq2F and ALOX12B-Seq2R;
the nucleotide sequence of the ALOX12B-Seq1F is shown as SEQ ID NO. 5: atctgccctctctcaca;
the nucleotide sequence of the ALOX12B-Seq1R is shown in SEQ ID NO. 6: cccaccgctccacaaaagtc;
the nucleotide sequence of the ALOX12B-Seq2F is shown in SEQ ID NO. 7: gagggagcaggcaggtga;
the nucleotide sequence of the ALOX12B-Seq2R is shown in SEQ ID NO. 8: acccagggaaaggaaggt.
In the present invention, the diagnostic kit preferably further comprises an SNP1 site positive mutation reference DNA1 and an SNP2 site positive mutation reference DNA2;
the single-stranded nucleotide sequence of the DNA1 is preferably shown as SEQ ID NO. 9: <xnotran> ggaggacttcccatttgcctttgggtcatcatgagggggcatgaagggagggagctggatgaagttggttctcctgtctagaaaggagcagaggcagggctggtgtgctggcccagagcaggattgttcctggaggtggggtgggctgggtcaggggttacaggggcacttactgggatcctagaggacctgaaggggttccagggatgcctgtccggctccaggatctgcctccttcctcacagggcatgtccctgggcgtggaaggctttgctggggtgatggtatgggctctgtcggagctcacctatgacagcctctacctccccaatgactttgtggagcgtggggtccaggacctgcctggatattactaccgcgatgacagcttggcggtgtggaatgcactggagaagtgagctcaggacagcagtgggtggctcttagggtggacaacctgggatgttggagagggtgtggggagcttctagagaactgagtgtgggtctggtgtcatccaggggcttggccttggggaaggggcctggggtctgtgtgtccatcacacctacaccctcagccc; </xnotran>
The single-stranded nucleotide sequence of the DNA2 is preferably shown as SEQ ID NO. 10: <xnotran> taactagcggcgtcaagaggggagcagggagtgagaggccactgaaaccaaagggtggaggggccagggccaccg gcaggaggagggggtgctggccggccctggtcccagctgtcgagctctctgcccgcagcggcccctgggacacttcccggacattcacttcgtggaggaggccccgcggaggagcatagaggcgttccgccagcgcctgaaccagatctcacacgacatccgccagcgcaacaagtgccttcccatcccctgctactacctggacccggtgctgattgagaacagcatttctatttaggagcgcgcttcccgtctctcctctccccattctgtgccctactattttcaacaaaacaaaacaaacaagcaaaaaacacaaaaacctcagagaccaaaacaccaaacaaacaaaaaaacaaaaaaccttcctttccctgggtctgg. </xnotran>
The present invention also provides a method for identifying the genotype of biomarkers comprising SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM _ 001139.3;
the method comprises the following steps:
using DNA of a sample to be detected as a template, and performing PCR amplification by using the primers in the diagnostic reagent to obtain an amplification product;
sequencing the amplified product to determine the biomarker genotype.
In the present invention, the reaction progress of the PCR amplification preferably includes: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 60s, and 33 cycles; react for 7min at 72 ℃.
In the present invention, the reaction system for PCR amplification is 20. Mu.L, preferably comprises 10 XPCR buffer 2. Mu.L, dNTPs 0.4. Mu.L, ALOX12B-1F or ALOX12B-2F 0.5. Mu.L, ALOX12B-1R or ALOX12B-2R 0.5. Mu.L, template 1. Mu.L, taq enzyme 0.2. Mu.L, and ddH for the remainder 2 O。
In the present invention, said PThe CR buffer preferably comprises KCl 500mmol/L, tris.Cl 100mmol/L and MgCl 2 15mmol/L; the pH of the Tris.Cl is preferably 8.3.
In the present invention, the sample preferably comprises blood or amniotic fluid.
In the present invention, the correlation between the individual providing the sample to be tested and the nonbullous congenital ichthyosiform erythroderma can preferably be determined according to the genotype of the biomarker, specifically:
when the genotype of the SNP1 site is CC and the genotype of the SNP2 site is AA, providing the individuals of the sample to be detected as normal individuals;
when the genotype of the SNP1 site is CT and the genotype of the SNP2 site is AG, the individual providing the sample to be detected is a patient with nonbullous congenital ichthyosis erythroderma;
when the genotype of the SNP1 site is CT, the genotype of the SNP2 site is AA, or the genotype of the SNP1 site is CC and the genotype of the SNP2 site is AG, the individual providing the sample to be detected is a carrier of the nonbullous congenital ichthyosis erythroderma.
To further illustrate the present invention, the diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma provided by the present invention will be described in detail with reference to the following examples, which should not be construed as limiting the scope of the present invention.
Example 1
Sample acquisition
A family of nonbullous congenital ichthyosiform erythroderma (abbreviated as family 1), the clinical information of some members of the family 1 is shown in Table 1. FIG. 1 shows a dominant family 1 map, wherein,
Figure BDA0003722693090000061
it is indicated that the male carrier is,
Figure BDA0003722693090000062
indicating female carrier, \ 8599, indicating probation,
Figure BDA0003722693090000063
indicating deathFemale patient o denotes a fetus.
1. Diagnostic criteria:
reference may be made to "medical genetics" 2016 edition:
1) The patients are born as pyroxylin-like fetuses, a few are red skin diseases accompanied with characteristic scales, the skin lesions gradually disappear later, and most of the patients tend to be improved in adolescence.
2) The skin lesions are white or gray superficial, semi-adhesive and bright scales, the face, arms and trunk are thin and soft feather-like scales, while the two lower limbs are represented by lamellar or discoid scales, the scales can fall off and regenerate repeatedly within 2-4 weeks, 70% of patients are accompanied by palmoplantar keratosis, and part of the patients are accompanied by alopecia areata.
3) The hyperkeratosis of epidermis is accompanied by parakeratosis and hyperplasia of spinous layer, partial cellular vacuolar degeneration can be seen at the upper part of the spinous layer, the dermal papilla layer and superficial capillary vessel are hyperplastic, and a small amount of lymphocyte infiltration is arranged around the vessel.
TABLE 1 clinical information of family members of Nonbullous congenital ichthyosiform erythroderma 1
Figure BDA0003722693090000071
As shown in FIG. 1, I (first generation) and II (second generation) are used as the numbering.
Family member No. 1I 1, I2, II 1 peripheral blood DNA for sequencing, II 2 amniotic fluid DNA for sequencing.
Exon sequencing
2. The instrumentation is shown in table 2.
Table 2 Instrument and Equipment List
Figure BDA0003722693090000072
3. Reagent consumable
Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).
4. Reagent formulation
A5 XTBE electrophoresis solution stock solution was prepared in accordance with Table 3.
TABLE 3 formulation of 5 XTBE electrophoretic solutions
Reagent Volume/weight
Tris 5.4g
Boric acid 750mg
EDTA(pH8.0,0.5mol/L) 2mL
ddH 2 O 90mL
By ddH 2 O adjusted the final volume to 100mL.
Working solution of 0.5 XTBE electrophoresis solution, ddH 2 Diluting with O10 times.
10 × erythrocyte lysates were prepared according to table 4.
TABLE 4 erythrocyte lysate recipe
Reagent Volume/weight
NH 4 Cl 82.9g
KHCO 3 10g
EDTA 0.37g
Adding dH 2 O To 1000mL
Autoclaving, and storing at 4 deg.C.
1 × cell nucleus lysate was prepared according to Table 5.
TABLE 5 formulation of cell nucleus lysate
Reagent Volume/weight
2MTris-HCl，pH8.2 0.5mL
4MNaCl 10mL
2mMEDTA 0.4mL
5. Experimental procedure
After signing an informed consent, 3-5 mL of peripheral blood of members I1, I2 and II 1 and 5-10 mL of amniotic fluid of members II 2 in family No.1 were collected as study samples.
5.1 sample DNA extraction
1) If the sample is a heparin anticoagulation peripheral blood sample, 3-5 mL of peripheral blood is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with 2-3 times volume is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent; if the sample is amniotic fluid, the next step is directly carried out.
2) Centrifuge at 3000rpm for 10 minutes at 4 ℃ and carefully remove the supernatant. The pellet was mixed with 1mL of 1 Xcell nucleus lysate, followed by addition of 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS, and the mixture was shaken until it became viscous and transparent. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion was carried out at 37 ℃ for more than 6 hours or overnight.
3) Add equal volume of saturated phenol, shake gently and mix well, centrifuge at 3000rpm for 10 minutes at room temperature.
4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1 v/v), and centrifuged at 3000rpm for 10 minutes at room temperature.
5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.
6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out using a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring OD value by ultraviolet.
7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.
5.2 exon sequencing
1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering 150-250 bp fragments;
2) Carrying out end repair on the DNA fragment and adding A at the 3' end;
3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;
4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing agarose gel electrophoresis on a small sample for quality control analysis;
5) NextSeq500 sequencer sequencing and data analysis.
5.3 results
The final 2 genotypic compound heterozygous mutations ALOX12B of pathogenic significance were obtained NM _ 001139.3; wherein the mutation of exon11: c.1405C > T can lead to the change of the amino acid residue 469 position of the encoded protein from Arg to Trp, and the mutation of exon15: c.2060A > G can lead to the change of the amino acid residue 678 position of the encoded protein from Tyr to Cys. The genotype of ALOX12B: NM _ 001139.3; A/G 'complex heterozygous mutation, the genotype at two sites in normal individuals of the ALOX12B family is' C/C; A/A ", the genotype at two sites in the ALOX12B family carrier individuals is" C/T; A/A' or "C/C; A/G' single heterozygous mutation.
Example 2
Sanger sequencing validation
For exome sequencing results, the ALOX12B: NM — 001139.3 t. ALOX12B: NM-001139.3.
The method comprises the following specific steps:
1. DNA extraction
Genomic DNA was extracted according to the method of example 1.
2. Primer design
Primer design was referenced to the human genome sequence database hg 19/built 36.3.
Candidate primer design, validation and optimization
2.1 candidate primer design reference human genome sequence database hg 19/built 36.3.
2.2 for c.1405C > T and c.2060A > G sites, 12 pairs of candidate primers were designed respectively (see Table 6), and PCR experiments were used to verify and evaluate the superiority and inferiority of each pair of candidate primers.
TABLE 6 summary of the basic conditions and the results of the verification experiment for each pair of candidate primers
Figure BDA0003722693090000101
Figure BDA0003722693090000111
2.3 candidate primer PCR validation reaction
PCR was performed according to the reaction system in table 7 and kept on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 7) were provided for each pair of primers.
TABLE 7 primer detection PCR reaction System
Figure BDA0003722693090000112
Figure BDA0003722693090000121
Reaction conditions are as follows: placing the test reaction tube into a PCR instrument, and executing the following reaction procedures:
the first step is as follows: 95 ℃ for 5min;
the second step is that: 30 cycles (95 ℃,30sec → Tm,30sec → 72 ℃,60 sec); (PCR amplification parameters were set based on Tm values of the respective primers in Table 6).
The third step: 72 ℃,7min;
the fourth step: 4 ℃ until sampling.
2.4 agarose gel electrophoresis detection of the candidate primer PCR results to assess the effectiveness, specificity of the primer reaction:
1) The two ends of the washed and dried gel sample former are sealed by an adhesive tape, the gel sample former is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample former.
2) Weighing 2g agar powder into a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, shaking, heating until the gel is completely melted, and cooling at room temperature.
3) After the gel is cooled to about 50 ℃, a sealed gel sample injector is poured into the gel sample injector to ensure that the thickness is about 5 mm.
4) The gel is solidified, the adhesive tape is removed, and the gel and the sample injector are placed into an electrophoresis tank.
5) Adding electrophoresis buffer solution to make the liquid surface 1-2 mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipettor, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.
6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate electrophoresis.
7) The power supply was cut off, the gel was taken out and placed in an EB aqueous solution of 0.5g/ml to dye for 10 to 15 minutes.
8) The gel was placed under a transmission ultraviolet irradiator to observe the result at a wavelength of 254nm, and photographed with a camera with a red color filter or the electrophoresis result was recorded with a gel scanning system.
2.5 evaluation of results:
1) If the No.7 tube only has a bright band and no band, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;
2) If no target band appears in the No.7 tube, judging that the pair of primers and the reaction system are invalid;
3) If the primer-primer dimer band outside the target entry appears in the No.7 tube and the primer-dimer band also appears in the No.2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;
4) If the non-specific band outside the target band appears in the No.7 tube and the non-specific band also appears in the No.5 and No.6 tubes, the specificity of the pair of primers and the reaction system is judged to be poor;
5) If the primer dimer and the non-specific band appear outside the target band in the No.7 tube, and the primer dimer and the non-specific band also appear in the No.2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.
2.6 according to the results of statistics after the test verified in Table 7 (see Table 6 for the results), the optimal pair (primer No.1 for c.1405C > T in Table 6) was selected as the primer for site detection of the mutant family ALOX12B: NM-001139.3:
ALOX12B-1F：5’-ggaggacttcccatttgc-3’(SEQ ID NO.1)；
ALOX12B-1R：5’-gggctgagggtgtaggtgt-3’(SEQ ID NO.2)；
the most preferred pair (No. 1 in table 6 for c.2060a > G) was selected as primers for detection of the p.y687c site of the mutant family ALOX12B: NM _001139.3:
ALOX12B-2F：5’-taactagcggcgtcaagagg-3’(SEQ ID NO.3)；
ALOX12B-2R：5’-ccagacccagggaaaggaa-3’(SEQ ID NO.4)。
3. PCR amplification of mutation sites of pedigrees and 100 out-of-pedigrees
PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.
TABLE 8 mutant site PCR reaction System
Reagent Volume of
10 XPCR buffer 2.0μL
10mmol/LdNTPs 0.4μL
100 ng/. Mu.LALOX 12B-1F (or ALOX 12B-2F) 0.5μL
100 ng/. Mu.LALOX 12B-1R (or ALOX 12B-2R) 0.5μL
DNA extraction at 100 ng/. Mu.L 1.0μL
5 u/. Mu.LTaq enzyme 0.2μL
ddH 2 O 15.4μL
The reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction procedure was performed:
the first step is as follows: 95 ℃ for 5min;
the second step is that: 30 cycles (95 ℃,30sec → 56 ℃,30sec → 72 ℃,60 sec);
the third step: 72 ℃ for 7min;
the fourth step: 4 ℃ until sampling.
4. Agarose gel electrophoresis detection
Refer to step 2.4 above.
5. And (3) carrying out enzymolysis purification on a PCR product: mu.L of exonuclease I (Exo I) and 1. Mu.L of alkaline phosphatase (AIP) were added to 5. Mu.L of the LPCR product, respectively, and digested at 37 ℃ for 15min and the enzyme was inactivated at 85 ℃ for 15min.
6. BigDye reaction
The BigDye reaction system is shown in table 9.
TABLE 9BigDye reaction System
Reagent Dosage of
DNA after purification of PCR product 2.0μL
3.2 pmol/. Mu.L sequencing primer 1.0μL
BigDye 0.5μL
5 xBigDye sequencing buffer 2.0μL
ddH 2 O 4.5μL
Sequencing PCR cycling conditions:
the first step is as follows: at 96 ℃ for 1min;
the second step is that: 33 cycles (96 ℃,30sec → 55 ℃,15sec → 60 ℃,4 min);
the third step: 4 ℃ until sampling.
7. Purification of BigDye reaction product:
1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, to the bottom of the tube, and 1. Mu.L of 3mol/LNaAc (Ph5.2) was added;
2) Adding 70 μ L70% ethanol, shaking and mixing for 4 times, standing at room temperature for 15min;
3) 3000g, centrifuging at 4 deg.C for 30min; immediately inverting 96-well plate, centrifuging at 185g for 1min;
4) Standing at room temperature for 5min, allowing residual ethanol to evaporate at room temperature, adding 10 μ L Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on computer.
8. Sequencing
And (3) carrying out DNA sequencing on the purified BigDye reaction product, and designing a nested primer (the second group of primers are designed in the sequence range of the product obtained by amplifying the first group of primers) as a sequencing primer on the basis of the PCR optimal primer by using a sequencing primer.
The sequencing primer sequences for ALOX12B: NM-001139.3C > -T at p.R469W site were as follows:
5’-atctgcctccttcctcaca-3’(SEQ ID NO.5)；
5’-cccacgctccacaaagtc-3’(SEQ ID NO.6)；
the sequencing primer sequences for the ALOX12B: NM-001139.3:
5’-gaggggagcagggagtga-3’(SEQ ID NO.7)；
5’-acccagggaaaggaaggt-3’(SEQ ID NO.8)。
9. analysis of results
The sequencing results are shown in FIGS. 2-1 and 2-2.Sanger sequencing results showed that the 1 patient in family No.1, AL OX12B: NM _ 001139.3; A/G "; the genotypes of the loci of 2 carriers in family 1 are "C/T" respectively; A/A' and "C/C; a/G ", ALOX12B: NM _001139.3 for 1 normal subject in pedigree No.1 and 100 normal controls without relationship to blood; A/A'.
Example 3
Diagnostic kit for non-bullous congenital ichthyosiform erythroderma and application
1. The kit comprises the following components:
1) Amplification primers: as shown in 2.6 in example 2, concentrations and volumes are as in table 8;
2) Buffer concentrations and volumes are as in table 8;
3) The Taq enzyme concentration and volume are as shown in Table 8;
4) dNTPs concentrations and volumes are as in Table 8;
5) C.1405C > T and c.2060A > G positive mutation reference substance DNA, wherein the reference substance is a section of double-stranded DNA, and the specific sequence of the single strand of the c.1405C > T positive mutation reference substance is shown in SEQ ID NO. 9;
the specific sequence of the single chain of the c.2060A > G positive mutation reference substance is shown as SEQ ID NO. 10.
6) Sequencing primer: shown as SEQ ID NO. 5-SEQ ID NO. 8.
2. The using method comprises the following steps:
TABLE 10 clinical information of family Member No.2
Figure BDA0003722693090000151
As shown in FIG. 3, I (first generation) and II (second generation) are used as the numbers.
The DNA of peripheral blood of family personnel I1, I2 and II 3 is used for the detection of the kit.
1) Extracting genome DNA: and extracting the genomic DNA of the sample.
2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;
3) Purifying PCR amplification products;
4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;
5) Purifying the BiyDye reaction product;
6) Sequencing the BiyDye reaction product, and comparing the sequencing sequence with a normal sequence; the specific procedures of steps 2) to 6) refer to steps 3 to 8 in example 2. The sequencing results are shown in FIGS. 4-1 and 4-2.
Sanger sequencing results showed that the genotype at the ALOX12B: NM-001139.3; A/G "; the genotypes of the loci of 2 carriers in family No.2 are respectively' C/T; A/A' and "C/C; and A/G'.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Hunan Jiahui Biotechnology Ltd
<120> a diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma
<160> 54
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggaggacttc ccatttgc 18
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggctgaggg tgtaggtgt 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taactagcgg cgtcaagagg 20
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccagacccag ggaaaggaa 19
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atctgcctcc ttcctcaca 19
<210> 6
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cccacgctcc acaaagtc 18
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gaggggagca gggagtga 18
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
acccagggaa aggaaggt 18
<210> 9
<211> 583
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ggaggacttc ccatttgcct ttgggtcatc atgagggggc atgaagggag ggagctggat 60
gaagttggtt ctcctgtcta gaaaggagca gaggcagggc tggtgtgctg gcccagagca 120
ggattgttcc tggaggtggg gtgggctggg tcaggggtta caggggcact tactgggatc 180
ctagaggacc tgaaggggtt ccagggatgc ctgtccggct ccaggatctg cctccttcct 240
cacagggcat gtccctgggc gtggaaggct ttgctggggt gatggtatgg gctctgtcgg 300
agctcaccta tgacagcctc tacctcccca atgactttgt ggagcgtggg gtccaggacc 360
tgcctggata ttactaccgc gatgacagct tggcggtgtg gaatgcactg gagaagtgag 420
ctcaggacag cagtgggtgg ctcttagggt ggacaacctg ggatgttgga gagggtgtgg 480
ggagcttcta gagaactgag tgtgggtctg gtgtcatcca ggggcttggc cttggggaag 540
gggcctgggg tctgtgtgtc catcacacct acaccctcag ccc 583
<210> 10
<211> 459
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
taactagcgg cgtcaagagg ggagcaggga gtgagaggcc actgaaacca aagggtggag 60
gggccagggc caccggcagg aggagggggt gctggccggc cctggtccca gctgtcgagc 120
tctctgcccg cagcggcccc tgggacactt cccggacatt cacttcgtgg aggaggcccc 180
gcggaggagc atagaggcgt tccgccagcg cctgaaccag atctcacacg acatccgcca 240
gcgcaacaag tgccttccca tcccctgcta ctacctggac ccggtgctga ttgagaacag 300
catttctatt taggagcgcg cttcccgtct ctcctctccc cattctgtgc cctactattt 360
tcaacaaaac aaaacaaaca agcaaaaaac acaaaaacct cagagaccaa aacaccaaac 420
aaacaaaaaa acaaaaaacc ttcctttccc tgggtctgg 459
<210> 11
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gggcatgaag ggaggga 17
<210> 12
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ttggcaaggt cagaacac 18
<210> 13
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
agggagggag ctggatg 17
<210> 14
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ttggcaaggt cagaacac 18
<210> 15
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cttcccattt gcctttgg 18
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gggctgaggg tgtaggtgt 19
<210> 17
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gaagggaggg agctggat 18
<210> 18
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tgggctgagg gtgtaggt 18
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
agggagggag ctggatga 18
<210> 20
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gggctgaggg tgtaggtgt 19
<210> 21
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ccatttgcct ttgggtca 18
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
tgctgggctg agggtgtag 19
<210> 23
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
tcagttagat gaagaggagg ac 22
<210> 24
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gggctgaggg tgtaggtgt 19
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
agcattggcc gggccgttct 20
<210> 26
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
gggctgaggg tgtaggtgt 19
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
tcccatttgc ctttgggtca 20
<210> 28
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
gggctgaggg tgtaggtgt 19
<210> 29
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
cttcccattt gcctttgggt ca 22
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
tgggctgagg gtgtaggtgt 20
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
attggccggg ccgttctcct 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
ctgctgggct gagggtgtag 20
<210> 33
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
gataactagc ggcgtcaaga g 21
<210> 34
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
ccagacccag ggaaaggaa 19
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
ctgacgacag ggtgcgagac 20
<210> 36
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
agccagaccc agggaaagg 19
<210> 37
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
actagcggcg tcaagaggg 19
<210> 38
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
agccagaccc agggaaagg 19
<210> 39
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
cactgaaacc aaagggtgga agccagaccc agggaaagg 39
<210> 40
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
agccagaccc agggaaagg 19
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
ctgacgacag ggtgcgagac 20
<210> 42
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
gacccaggga aaggaagg 18
<210> 43
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
gaaaccaaag ggtggaggg 19
<210> 44
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
aacggaatcg cggtgaga 18
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
aggataacta gcggcgtcaa 20
<210> 46
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
gctgccctac tcctacctga ac 22
<210> 47
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
ggaggataac tagcggcgtc aa 22
<210> 48
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
aacggaatcg cggtgaga 18
<210> 49
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
agaggccact gaaaccaaag 20
<210> 50
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
tggcgctgcc ctactcctac 20
<210> 51
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
agagcctgac gacagggtgc 20
<210> 52
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
tgccctactc ctacctgaac cc 22
<210> 53
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
acagggtgcg agacgggatg 20
<210> 54
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
acccagggaa aggaaggttt t 21

Claims (10)

1. A biomarker for the diagnosis of nonbullous congenital ichthyosiform erythroderma, characterized in that it is a complex heterozygous mutation of the ALOX12B gene;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
2. The application of the biomarker in preparing a diagnostic reagent or a kit for nonbullous congenital ichthyosiform erythroderma is characterized in that the biomarker is a compound heterozygous mutation of an ALOX12B gene;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM-001139.3.
3. A diagnostic reagent for nonbullous congenital ichthyosiform erythroderma, comprising a primer for amplifying a biomarker;
the biomarkers include SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has A > G mutation at position 2060 of exon15 with accession number NM-001139.3;
primers for amplifying the SNP1 comprise ALOX12B-1F and ALOX12B-1R;
primers for amplifying the SNP2 comprise ALOX12B-2F and ALOX12B-2R;
the nucleotide sequence of the ALOX12B-1F is shown as SEQ ID NO. 1;
the nucleotide sequence of the ALOX12B-1R is shown as SEQ ID NO. 2;
the nucleotide sequence of the ALOX12B-2F is shown as SEQ ID NO. 3;
the nucleotide sequence of the ALOX12B-2R is shown as SEQ ID NO. 4.
4. Use of the reagent of claim 3 for the preparation of a diagnostic kit for nonbullous congenital ichthyosiform erythroderma.
5. A diagnostic kit for nonbullous congenital ichthyosiform erythroderma, comprising the reagent of claim 3 and a sequencing primer.
6. The diagnostic kit of claim 5, wherein the sequencing primer comprises a first primer pair for sequencing the amplified fragment containing SNP1 and a second primer pair for sequencing the amplified fragment containing SNP2;
the primer pair I comprises ALOX12B-Seq1F and ALOX12B-Seq1R;
the second primer pair comprises ALOX12B-Seq2F and ALOX12B-Seq2R;
the nucleotide sequence of the ALOX12B-Seq1F is shown as SEQ ID NO. 5;
the nucleotide sequence of the ALOX12B-Seq1R is shown in SEQ ID NO. 6;
the nucleotide sequence of the ALOX12B-Seq2F is shown in SEQ ID NO. 7;
the nucleotide sequence of the ALOX12B-Seq2R is shown in SEQ ID NO. 8.
7. The diagnostic kit according to claim 5 or 6, wherein the diagnostic kit further comprises SNP1 site positive mutation reference DNA1 and SNP2 site positive mutation reference DNA2;
the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9;
the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.
8. A method of identifying a biomarker genotype, wherein the biomarker comprises SNP1 and SNP2;
SNP1 has a C > T mutation at position 1405 of exon11 with accession number NM _ 001139.3;
SNP2 has an A > G mutation at position 2060 of exon15 with accession number NM _ 001139.3;
the method comprises the following steps:
carrying out PCR amplification by using a sample DNA to be detected as a template and using a primer in the diagnostic reagent according to claim 3 to obtain an amplification product;
sequencing the amplified product to determine the genotype of the biomarker.
9. The method of claim 8, wherein the PCR amplification reaction process comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 60s, and 33 cycles; the reaction was carried out at 72 ℃ for 7min.
10. The method as claimed in claim 7, wherein the reaction system for PCR amplification is 20 μ L, and comprises 2 μ L of 10 XPCR buffer, 0.4 μ L of dNTPs, 0.5 μ L of ALOX12B-1F or ALOX12B-2F, 0.5 μ L of ALOX12B-1R or ALOX12B-2R, 1 μ L of template, 0.2 μ L of Taq enzyme, and the balance ddH 2 O。
CN202210767426.4A 2022-06-30 2022-06-30 Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma Pending CN115216534A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210767426.4A CN115216534A (en) 2022-06-30 2022-06-30 Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210767426.4A CN115216534A (en) 2022-06-30 2022-06-30 Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma

Publications (1)

Publication Number Publication Date
CN115216534A true CN115216534A (en) 2022-10-21

Family

ID=83609881

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210767426.4A Pending CN115216534A (en) 2022-06-30 2022-06-30 Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma

Country Status (1)

Country Link
CN (1) CN115216534A (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"NM_001139.3(ALOX12B)-ClinVar - NCBI", pages 1, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/clinvar> *

Similar Documents

Publication Publication Date Title
CN115141884B (en) Novel ATP7B mutant gene and diagnostic reagent thereof
CN115772214A (en) F8 mutant protein, F8 gene mutant, primer combination for detecting F8 gene mutant, reagent and application
CN106987642A (en) Detect the kit and method of the full extron of MPL genes
CN115141837A (en) Novel SLC9A6 mutant gene and diagnostic reagent thereof
CN115927356B (en) SLC45A2 pathogenic mutant gene, pathogenic mutant and application thereof in preparation of eye skin albinism IV type diagnostic kit
CN116656801A (en) Application of Cowcdock syndrome pathogenic gene AIFM1 mutation site, detection reagent and application thereof
CN116426630A (en) Pathogenic gene for causing Joubert syndrome, detection and application
CN115725716A (en) PKD1 pathogenic mutant gene and application thereof in preparation of polycystic kidney disease diagnostic kit
CN115216534A (en) Diagnostic reagent and kit for nonbullous congenital ichthyosiform erythroderma
CN115216533A (en) Biomarker for diagnosing Wilson&#39;s disease, amplification primer set, detection reagent and application
TW201311908A (en) Method and kit for diagnosis of canine glaucoma
AU2007231141B2 (en) Hereditary cataract status in canines based on HSF4 gene marker
CN116004668B (en) ATP7B gene pathogenic mutant and application thereof in preparation of Wilson disease diagnosis kit
CN115927354B (en) SH3TC2 gene pathogenic mutant and application thereof in preparation of fibula muscular atrophy 4C type diagnostic kit
CN115873861B (en) PAH pathogenic mutant and application thereof in preparation of phenylketonuria diagnostic kit
CN115948530B (en) Turner type X-linked syndrome pathogenic gene and primer pair for mental retardation and application thereof
CN115873938B (en) LRPPRC gene composite mutant for causing French-Canadian Leigh syndrome
CN116004799B (en) CRTAP pathogenic mutant and application thereof in preparation of gristle syndrome VII type diagnosis kit
CN117511954B (en) HCFC1 gene mutant, mutant protein, reagent, kit and application
CN116004789B (en) Application of Seckel syndrome pathogenic gene CEP152 mutation site and diagnostic reagent thereof
CN115851918B (en) Application and detection reagent of pathogenic gene CFAP410 mutation site causing retinal dystrophy
CN115216532A (en) Diagnostic reagent and kit for short-chain acyl coenzyme A dehydrogenase deficiency
CN115927577A (en) Application of SRTD6 type pathogenic gene NEK1 composite heterozygous mutant site and diagnostic reagent thereof
CN115896270A (en) Application of pathogenic gene ASXL3 mutation causing BRPS, detection reagent and application
CN115850430A (en) SCN1A mutant protein, SCN1A gene mutant, amplification primer, detection reagent and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination