CN115925844A - Application of CsLNG gene in regulation and control of cucumber fruit shape - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to application of a CsLNG gene in regulation and control of cucumber fruit shape. The nucleotide sequence of the CsLNG gene provided by the invention is shown in SEQ ID NO. 1; the coded amino acid sequence is shown in SEQ ID NO. 2. Experiments prove that the CsLNG gene loses functions, so that the fruit length of a mutant plant is obviously reduced, the transverse stem of a fruit is obviously increased, and the fruit shape index is obviously reduced; meanwhile, the length and the width of the seeds are reduced and increased. The invention proves that the CsLNG gene participates in regulating and controlling the shapes of the fruits and seeds of the cucumbers for the first time. Therefore, the CsLNG gene can be applied to the improvement of cucumber varieties to cultivate new cucumber varieties with different fruit shapes so as to meet the market demands.

Description

Application of CsLNG gene in regulation and control of cucumber fruit shape

Technical Field

The invention relates to the technical field of biology, in particular to application of a cucumber CsLNG gene in regulation and control of cucumber fruit shape.

Background

Cucumber (Cucumis sativus L.) is an annual herbaceous plant of the genus Cucumis in the family Cucurbitaceae, fruits are the main commodity organs of the cucumber, the commodity is mature 7-14 days after flowering, and the size and shape of the fruits seriously affect the yield and appearance quality of the cucumber. The demand of cucumber breeding for fruit shape diversity is caused by different regions, different purposes (fresh eating or processing), different preference differences of different consumers for fruit shapes and the like. Therefore, the digging of cucumber fruit shape genes has important significance for cultivating cucumbers with ideal appearance quality in different markets.

Cucumber fruits are mostly oblong or cylindrical in shape with a fruit length (L)/diameter (D) determination (Che and Zhang, 2019). In cucumber, a number of Quantitative Trait Loci (QTL) related to fruit size (fruit size), fruit weight (fruit weight) and fruit shape (fruit shape index) are currently screened by means of genetic mapping and development of molecular markers, among others, with repetitive regions between each other (Bo et al, 2015 weng et al, 2015 pan et al, 2020. Wherein QTL loci of fruit size FS1.2, FS2.1 and FS2.2 participate in the transverse growth of cucumber; FS3.2 and FS3.3 regulate fruit elongation; FS5.2 has the greatest effect on the round fruit shape of cucumbers (Pan et al, 2017 a). FS1.2 encodes the tomato SUN homologous gene CsSUM5-26-27a, regulating cucumber fruit aspect ratio (Pan et al, 2017 b). Although more than 10 QTLs regulating the length of cucumber fruits are known, most of the specific candidate genes and the regulation mechanisms thereof have not been analyzed. The former people found an A allele of the MADS-box family transcription factor CsFUL1 to negatively regulate fruit length development by using a reverse biology test (ZHao et al, 2019); SF1 (Short Fruit 1) encodes a RING-type E3 ligase that controls ethylene dose-dependent cell division and Fruit elongation by ubiquitinating and degrading itself and ACS2 (ethylene synthase) to tightly control ethylene synthesis (Xin et al, 2019); SF2 (Short Fruit 2) encodes histone deacetylase 1, whose mutation leads to a reduction in Fruit cell division leading to Fruit shortening (Zhang et al, 2019); csFnl7.1 encodes a protein rich in late embryogenesis, specifically regulates the length of the melon stalk, and influences the shape of the fruit (Xu et al, 2020).

Disclosure of Invention

The invention aims to provide a CsLNG gene and application thereof in regulation and control of cucumber fruit shapes.

In a first aspect, the present invention claims the use of CsLNG protein, or a gene encoding it, or an inhibitor thereof, or a biological material comprising a gene encoding it or an inhibitor thereof, for modulating cucumber fruit shape.

In the above application provided by the present invention, the length of cucumber fruits is reduced and the width of cucumber fruits is increased by suppressing the expression of the gene encoding CsLNG protein.

In the above application provided by the present invention, the CsLNG protein has any one of the following amino acid sequences:

1) An amino acid sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

2) The amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.

In the above application provided by the present invention, the coding gene of CsLNG protein has any one of the following nucleotide sequences:

(1) A nucleotide sequence shown as SEQ ID NO. 1; or the like, or, alternatively,

(2) The coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or the like, or, alternatively,

(3) A nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.1 under strict conditions.

The full-length nucleotide sequence of the cucumber CsLNG gene is shown as SEQ ID NO. 1.

SEQ ID NO.1：

/>

/>

/>

In the sequence, the bold ATG is an initiation codon, and the prefix of the initiation codon is a 5' UTR sequence; bold TAA is a stop codon, and the sequence after the stop codon is 3' UTR; () the internal sequence is an exon; the first and second 19bp target sequences are respectively selected by underlining, and AGG and CGG in bold font after underlining are PAM sites.

The method comprises the steps of screening a spherical fruit mutant material qiu from an EMS mutant library of a south China type cucumber variety 32X constructed in the previous stage, selfing by using the 32X and qiu as female parents to construct an F2 extreme phenotype mixed pool, and discovering the change (C-T) of one base on a CsLNG gene by using MutMap analysis to cause the early termination of amino acid translation so as to finally generate the spherical fruit phenotype. The cucumber CsLNG gene is cloned from the North China type long fruit shaped cucumber material XTMC on the basis of the work.

In a second aspect, the invention provides application of the CsLNG protein or a coding gene thereof, or an inhibitor thereof, or biological materials containing the coding gene or the inhibitor thereof in breeding of cucumbers with spherical fruits.

In a third aspect, the invention provides sgRNA for knocking out a gene with a nucleotide sequence shown as SEQ ID No.1, wherein a target sequence aimed by the sgRNA is shown as SEQ ID No.5 or SEQ ID No. 6.

More specifically, the sgRNA provided by the invention comprises a sequence shown as SEQ ID No.7 or a sequence shown as SEQ ID No.8 in a nucleotide sequence.

According to the understanding of the person skilled in the art, the present invention also claims the use of the above-described cucumber CsLNG gene or the above-described sgRNA for reducing the length of a cucumber fruit, increasing the transverse stem of a cucumber fruit, increasing the fruit shape index of a cucumber fruit.

In a fourth aspect, the invention provides a preparation method of cucumber spherical fruits, which comprises the following steps:

(1) Adopting primers of SEQ ID NO.9-12 to amplify to obtain an sgRNA sequence of the knocked-out cucumber CsLNG gene;

(2) Constructing a CRISPR/Cas9 vector by using the obtained sgRNA sequence to obtain a recombinant plasmid PKSE402G-CRISPR/Cas9-CsLNG; transforming agrobacterium tumefaciens competent EHA105 by using a recombinant plasmid PKSE402G-CR ISPR/Cas9-CsLNG to obtain recombinant agrobacterium tumefaciens EHA10;

(3) Transforming cucumber by using recombinant agrobacterium EHA105 to obtain T0 generation positive transgenic cucumber plants, and harvesting seeds;

(4) And (4) planting the seeds obtained in the step (3), carrying out genotype identification, identifying the plant with the large fragment deletion of the CsLNG gene as a mutant plant, and harvesting the spherical fruits of the mutant plant.

The invention has the beneficial effects that:

the CsLNG gene provided by the invention is positioned in a QTL FS2.1 interval, and the CsLNG gene controls the transverse and longitudinal growth of cucumber fruits and influences the shapes of the fruits through verification by the invention; the method has direct breeding and production guiding values for cucumber fruit shape control.

Compared with wild type, the length and width of cucumber fruits of Cslng #1 and Cslng #2 knockout plants are reduced, which indicates that the CsLNG gene regulates the shape of the cucumber fruits and the shape of seeds.

Drawings

FIG. 1 shows the CsLNG gene sequence editing results in wild-type WT, cslng #1, and Cslng #2 edited plants in example 3 of the present invention.

FIG. 2 shows genotypes of wild-type WT, cslng #1, and Cslng #2 mutants in example 3 of the present invention.

FIG. 3 phenotype graphs of wild type WT, cslng #1 and Cslng #2 mutant cucumber fruits in example 3 of the present invention. Panel A shows fruits 10d after flowering; b shows fruits 30d after blossom; c, longitudinal cutting of 10d fruits after blossom; and D is a longitudinal cutting chart of the fruit 30D after the flower. The scale bar is 1cm.

FIG. 4 is a histogram of cucumber fruit data for wild-type WT, cslng #1 and Cslng #2 mutants in example 3 of the present invention.

FIG. 5 is a seed phenotype plot and data statistics plot of wild type WT, cslng #1, and Cslng #2 mutants in example 3 of the present invention.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental methods and experimental conditions in the following examples are conventional unless otherwise specified. The test materials, reagents, etc., used, may be purchased from conventional biochemical reagent stores, unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The CsLNG gene is short for CsaV3_2G013800 gene. The PKSE402G vector is gifted by the yellow sanwen teacher of Chinese academy of agricultural sciences; the pCBC-DT1T2 template plasmid is offered by the aged army teacher of China university of agriculture. Agrobacterium EHA105 competent cells were purchased from Shanghai Diego Biotechnology, inc.; bsaI endonuclease and T4 ligase were purchased from New England Biolabs (New England Biolabs).

Example 1 cloning of CsLNG Gene

(1) Obtaining of test materials

Experimental materials cucumber 32X and spherical fruit mutant material qiu were offered by yan li ying teacher of north-river science and technology institute, (published in journal literature, gulong yu, louman, song xiao fei, sun zheng, li xiao li, yan li ying. SSR analysis of genetic relationship of drought cucumber germplasm resources [ J ]. North china agrimony, 2015,30 (S1): 32-37.) for BSA sequencing, gene cloning, expression analysis; XTMC was stored by the laboratory for gene cloning, expression analysis and genetic transformation of crispr-cas 9. The cucumber material is planted in an illumination incubator at the seedling stage, and is planted in a sunlight greenhouse of a science and technology park of Chinese agriculture university when three leaves and one heart are used, and standard water and fertilizer management is carried out. And (3) taking the young fruits at the flowering period, quickly putting the young fruits into liquid nitrogen for freezing, and storing the young fruits in a refrigerator at the temperature of minus 80 ℃.

(2) Extraction of RNA

Total RNA of young fruits is extracted by adopting an RNA extraction kit of Hua-Yun-Yang company, and residual DNA in a sample is removed by DNaseI.

(3) Obtaining of cDNA

Using the extracted RNA as a template and utilizing a Novozan reverse transcription kit (

III1st Strand cDNAsSynthesis Kit) was reverse transcribed into cDNA.

(4) Amplification of the Gene of interest

And 3, performing PCR by using the cDNA obtained in the step 3 as a template and primers CsLNG-clone-s and CsLNG-clone-a, wherein an amplification system is shown in Table 1. The obtained PCR product was a cds full length of 2331bp CsLNG gene. The primer sequences are as follows:

CsLNG-clone-s:ATGACGACAGGAATGGTGCAA(SEQ ID NO.3)；

CsLNG-clone-a:TTAGAACACCAGCTTCCTTCTAGGC(SEQ ID NO.4)；

TABLE 1 amplification system for full-length sequence of target gene CsLNG coding region

PCR amplification reaction procedure: pre-denaturing at 98 ℃ for 1min; denaturation at 98 ℃ for 10s, annealing at 56 ℃ for 15s, extension at 72 ℃ for 1min for 15s, and 30 cycles; final extension at 72 ℃ for 5min.

(5) Detection and recovery of PCR products

Electrophoresis detection was performed using 1% agarose gel, the desired target band was cut off, gel recovery was performed using the gel recovery kit from AxyGen corporation, and the gel recovery product was sequenced.

Example 2 CRISPR-CAS9 vector construction of CsLNG Gene

(1) Target sequence design of sgRNA sequence

Finding and designing target sequences on CsLNG genes andhttp://crispr.hzau.edu.cn/ CRISPR2/predicting the miss probability of target points on the website, selecting the probability of target miss predictionThe target sequence with the rate of 0 is 19bp in length.

The nucleotide sequence of the target point I is as follows: 5 'GACCTTCGATCCGCGCGC-doped 3' (SEQ ID NO. 5);

the reverse complement sequence is: 5 'GCGCGCTGGATCGAAGGTC-3' (SEQ ID NO. 6);

the nucleotide sequence of the target point II is as follows: 5 'AGCCTGTTAGGTTCGCAAAG-3' (SEQ ID NO. 7);

the reverse complement sequence is: 5 'CTTTGCGACCTAACAGGCT-doped 3' (SEQ ID NO. 8).

(2) Primer design and amplification for CRISPR-CAS9 vector construction

The following four partially overlapping primers were synthesized based on the target sequences selected in step 1 above. Four-primer PCR amplification was performed using 100-fold diluted pCBC-DT1T2 plasmid as a template. -BsF/-BsR is normal primer concentration; -F0/-R0 diluted 20-fold. The PCR system and the amplification procedure were as described in the first experimental protocol, with an extension time of 40s at 72 ℃ only and the remainder unchanged. The four primer sequences are as follows:

CsLNG-DT1-BsF:5’-ATATATGGTCTCGATTGGACCTTCGATCTCCAGCGCGTT-3’(SEQ ID NO.9)；

CsLNG-DT1-F0:5’-TGGACCTTCGATCTCCAGCGCGTTTTAGAGCTAGAAATAGC-3’(SEQ ID NO.10)；

CsLNG-DT2-R0:5’-AACCTTTGCGACCTAACAGGCTCAATCTCTTAGTCGACTCTAC-3’(SEQ ID NO.11)；

CsLNG-DT2-BsR:5’-ATTATTGGTCTCGAAACCTTTGCGACCTAACAGGCTCAA-3’(SEQ ID NO.12)。

remarking: the target sequence of CsLNG is underlined.

(3) Construction of enzyme digestion-ligation System of vector

The PCR amplification product was purified and recovered to establish the following enzyme digestion-ligation system, as shown in Table 2:

TABLE 2 enzyme digestion-ligation system constructed by CRISPR/Cas9 vector

The reaction procedure was as follows: incubating at 37 deg.C for 2min, incubating at 16 deg.C for 5min, and repeating for 50 times; incubate at 80 ℃ for 5min (heat inactivation of the enzyme).

(4) Coli transformation and colony sequencing

The product ligated in step 3 above was transformed into E.coli competent DH 5. Alpha. And the bacterial suspension was plated on a medium plate containing kanamycin sulfate (50 mg/L) for screening. The single colony obtained is subjected to colony PCR identification by using primers U626-F and U629-R, a colony which is consistent with an expected target band (726 bp) is selected, and vector sequencing is performed by using the primers U626-F and U629-F.

The primer sequences are as follows:

U626-F:5’-TGTCCCAGGATTAGAATGATTAGGC-3’(SEQ ID NO.13)；

U629-F:5’-TTAATCCAAACTACTGCAGCCTGAC-3’(SEQ ID NO.14)；

U629-R:5’-AGCCCTCTTCTTTCGATCCATCAAC-3’(SEQ ID NO.15)。

example 3 application of CsLNG gene in regulation and control of cucumber fruit shape by using CRISPR-CAS9 system

(1) Recombinant vector transformation agrobacterium EHA105

And (3) carrying out plasmid extraction on the PKSE402G-CRISPR/Cas9-CsLNG carrier bacterial liquid with correct sequencing obtained in the second embodiment by using a plasmid extraction kit. The obtained recombinant plasmid PKSE402G-CRISPR/Cas9-CsLNG is extracted to carry out transformation on agrobacterium-induced EHA105 by a heat shock transformation method, so as to obtain recombinant agrobacterium EHA105 (PKSE 401-CRISPR/Cas 9-CsLNG). The specific transformation procedure was performed according to the Agrobacterium competent transformation instruction of Shanghai Dingwei Biotechnology Ltd.

(2) Agrobacterium infection genetic transformation cucumber

The recombinant agrobacterium in the step 1 is subjected to cucumber transgenosis by utilizing an agrobacterium-mediated cucumber cotyledon transformation method, the cucumber variety is Xintai mici, and the specific genetic transformation step is described with reference to a 2017 article (Hu et al, 2017). And performing GFP fluorescence screening on the differentiated regenerated buds under a body type fluorescence microscope to obtain T0 generation positive transgenic cucumber plants. The obtained plants are domesticated and domesticated, planted in a greenhouse, and artificially pollinated to collect progeny seeds.

(3) CsLNG gene editing plant obtaining

And (3) breeding the T0 generation plants in the step (2) in a greenhouse of a scientific and technological garden of Chinese agriculture university to obtain T1 generation seeds, selecting seeds without GFP fluorescence from the T1 generation seeds to carry out seedling culture (the absence of GFP fluorescence indicates that a CRISPR/Cas9 vector is separated to obtain a plant which does not contain a transgenic vector but is edited), and extracting true leaf genome DNA by adopting a classical CTAB method when the first true leaves of the seedlings are completely unfolded. The CsLNG gene adopts primers CsLNG-t-s (SEQ ID NO.16: 5-. And (2) comparing the sequence with the wild CsLNG gene according to the sequencing result of the company, and carrying out genotype identification on the obtained gene editing plant (figure 1). Sequencing chromatogram analysis of fig. 1 and fig. 2 shows that editing of cucumber CsLNG gene is successfully achieved by using CRISPR/Cas9 system, and two complete mutants are obtained: both Cslng #1 (homozygous allele, deletion 593 bp) and Cslng #2 (homozygous allele, deletion 558 bp), produced large fragment deletions, resulting in premature termination of protein translation and large fragment deletion of amino acid sequence (159 AA), respectively, and finally achieved functional deletion of Cslng gene (fig. 2).

(4) Phenotypic observations of cucumber CsLNG Gene-edited plants

And (4) carrying out phenotype observation and photographing on the plants edited by the T2 generation cucumber gene CsLNG obtained in the step (3) after the plants are planted in a greenhouse and grow and develop. The results are shown in FIG. 3, and compared with the wild-type plant fruit, it was found that: fruits (10 d after flowering) and mature melons (30 d after flowering) in the commercial period of the Cslng #1 and Cslng #2 knockout plants show that the fruit length is remarkably reduced, and the fruit transverse stem is remarkably increased. Statistical analysis also showed a significant decrease in fruit length and a significant increase in fruit transverse stem, resulting in a significant increase in fruit shape index (figure 4). Fruit furthermore, the present invention also observed the morphology of seeds, and compared to wild type, cslng #1 and Cslng #2 knockout plants had decreased and increased seed length and width, respectively, relative to wild type (figure 5). The results show that the CsLNG gene regulates the shape of the fruit and the shape of the seed.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims (10)

1. Application of CsLNG protein or a coding gene thereof, or an inhibitor thereof, or biological materials containing the coding gene or the inhibitor thereof in regulation and control of cucumber fruit shape.
2. 2. Use according to claim 1, characterized in that the length of the cucumber fruit is reduced and the width of the cucumber fruit is increased by editing the gene encoding the CsLNG protein.
3. 3. The use of any one of claims 1-2, wherein the CsLNG protein has any one of the following amino acid sequences:

   1) An amino acid sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

   2) The amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.
4. 4. The use according to any one of claims 1 to 2, wherein the gene encoding the CsLNG protein has any one of the following nucleotide sequences:

   (1) A nucleotide sequence shown as SEQ ID NO. 1; or the like, or, alternatively,

   (2) The coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or, (3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.1 under strict conditions.
5. And 5, the application of the CsLNG protein, or the coding gene thereof, or the inhibitor thereof, or the biological material containing the coding gene or the inhibitor thereof in breeding the cucumbers with the spherical fruits.
6. 6. The sgRNA is used for knocking out a gene with a nucleotide sequence shown as SEQ ID No.1, and is characterized in that a target sequence aimed by the sgRNA is shown as SEQ ID No.5 or SEQ ID No. 6.
7. 7. The sgRNA of claim 6, wherein the nucleotide sequence of the sgRNA includes a sequence shown as SEQ ID No.7 or a sequence shown as SEQ ID No. 8.
8. 8. Use of the sgRNA of any one of claims 6 to 7, to reduce cucumber fruit length, increase cucumber fruit stem, increase cucumber fruit shape index.
9. 9. The method for constructing the transgenic cucumis metuliferus is characterized by inhibiting the expression of CsLNG protein in the cucumis metuliferus.
10. 10. The method of claim 9, comprising:

    (1) Adopting primers of SEQ ID NO.9-12 to amplify to obtain an sgRNA sequence of the knocked-out cucumber CsLNG gene;

    (2) Constructing a CRISPR/Cas9 vector by using the obtained sgRNA sequence to obtain a recombinant plasmid PKSE402G-CRISPR/Cas9-CsLNG; transforming agrobacterium tumefaciens competent EHA105 by using a recombinant plasmid PKSE402G-CRISPR/Cas9-CsLNG to obtain recombinant agrobacterium tumefaciens EHA10;

    (3) Transforming cucumber by using recombinant agrobacterium EHA105 to obtain T0 generation positive transgenic cucumber plants, and harvesting seeds;

    (4) And (4) planting the seeds obtained in the step (3), carrying out genotype identification, identifying the plant with the CsLNG gene fragment deletion as a mutant plant, and harvesting the spherical fruits of the mutant plant.

Images