CN115902037B - Analysis method for dimethyl sulfide functional activity produced by freshwater cable bacteria - Google Patents

Abstract

The invention discloses an analysis method for the functional activity of dimethyl sulfide produced by freshwater cable bacteria. The present invention selects environmental samples and rebuilds a complex microbial community without cable bacteria in the sample, and obtains the experimental group samples in which cable bacteria exist and the control group samples in which cable bacteria do not exist by manually controlling the addition or non-addition of cable bacteria , can be used to measure the amount of dimethyl sulfide released by cable bacteria. The invention provides for the first time a method for detecting the dimethyl sulfide gene produced by Candidatus Electronema in a sample by fluorescent quantitative PCR, which greatly reduces the detection cost compared with the current metagenomic sequencing method. The invention measures the dimethyl sulfide-producing functional activity of the cable bacteria of the freshwater genus through an analysis method combining product quantification and functional gene quantification.

Description

A method for analyzing the functional activity of dimethyl sulfide produced by freshwater cable bacteria

technical field

The invention belongs to the technical field of molecular biology, and in particular relates to an analysis method for the functional activity of dimethyl sulfide produced by freshwater cable bacteria.

Background technique

More and more research evidences show that a long linear electroactive microorganism, Candidatus Electronema, widely exists in freshwater sediments, which plays an important regulatory role in the sulfur cycle and has obvious advantages in environmental restoration. However, the current research on the environmental effects of cable bacteria is mainly focused on its electricity production, sulfur oxidation and sulfate radicals, and its evaluation is also limited to sediments and mud-water interfaces. There are few studies on the role of sulfur cycle.

Dimethyl sulfide (DMS) is the main form of sulfur transferred from sediments to the atmosphere. Studies have shown that DMS in the atmosphere can eventually be transformed into cloud condensation nuclei to promote cloud formation, thereby mitigating the greenhouse effect. However, since cable bacteria cannot be purely cultured at present, it is impossible to measure and verify their functional products under pure culture conditions. In addition, due to the complex and diverse composition of microbial species in natural environment samples, the relative abundance of cable bacteria in the actual environmental microbial community is low. A deep sequencing depth is required, which is costly, time-consuming and difficult to quantify accurately. It can be seen that the quantitative analysis of cable bacteria-driven DMS release activity still has great difficulties and challenges.

Contents of the invention

The first object of the present invention is to provide a method for measuring the amount of dimethyl sulfide released by Candidatus Electronema, a freshwater cable bacterium.

The measuring method of freshwater genus cable bacteria Candidatus Electronema dimethyl sulfide release of the present invention comprises the following steps:

A. Sieve the collected environmental samples to remove large organisms and impurities, and then precipitate the homogenized sediment;

B. Take part of the sediment and put it in a container, and place it in a water tank for continuous aeration culture to obtain a cable bacterial inoculum that can be used for subsequent experiments;

C. Sterilize part of the precipitate, and rebuild a complex microbial community without cable bacteria as a microbially reconstituted sample;

D. Add the cable bacterial inoculum obtained in step B to the partially reconstructed sample obtained in step C to obtain the cable bacteria experimental group, and use the reconstructed sample without adding the cable bacterial inoculum as a control group;

E, the experimental group and the control group are aerated and cultivated in the water tank respectively;

F. Place the experimental group and the control group in the gas collection device respectively, and sequentially collect gas;

G, by gas chromatographic analysis, compare the dimethyl sulfide production rate and release amount of the experimental group and the control group.

Preferably, the environmental samples in step A are environmental samples where cable bacteria may exist, including paddy fields, rivers, lakes, reservoirs, culture ponds, mangrove sediments, biofilms, and the like.

Preferably, the re-construction of a complex microbial community without cable bacteria in the step C can be adding a microbial sample that does not contain cable bacteria such as cow dung, pig manure, chicken manure, etc. to the sediment, or it can be artificially constructed microbial communities free of cable bacteria.

Preferably, the cable bacterial inoculum in step D is added to the partially reconstituted sample obtained in step C, and the inoculum amount can be adjusted as required. For example, the inoculum amount of cable bacteria is greater than 1/1000 of the sample weight, more preferably 1.5/1000.

Preferably, the culture time of step E is determined according to the growth of cable bacteria. Preferably, the cable bacteria are grown to the time of stationary phase.

The second object of the present invention is to provide a kind of detection primer of Candidatus Electronema producing dimethyl sulfide gene of freshwater cable bacterium, and described detection primer is as follows:

a. Upstream primer F: 5'-TTYTCBTGGTCRGRCTGGCT-3';

b. Downstream primer R: 5'-CARCAGCTTKCGYTCYTCCA-3'.

The third object of the present invention is to provide a detection kit for the dimethyl sulfide gene produced by the freshwater cable bacterium Candidatus Electronema, including Taq enzyme, positive standard and detection primers, and the detection primers are as shown above.

Preferably, a positive standard product is also included, and the positive standard product is a recombinant plasmid DNA containing the sequence shown in SEQ ID NO.1.

The fourth object of the present invention is to provide a method for detecting the dimethyl sulfide gene produced by Candidatus Electronema, a freshwater cable bacterium, comprising the following steps: extracting the total DNA of the sediment to be tested as a template, adding the above-mentioned detection primers, and quantifying by fluorescence The PCR method is used to detect and determine whether the sediment sample to be tested contains the dimethyl sulfide gene of the freshwater cable bacterium Candidatus Electronema.

In the fluorescent quantitative PCR, the substances in the amplification reaction system are composed of upstream primers, downstream primers, Taq enzyme, template DNA, and ultrapure water. The ratio can be adjusted according to the quality and concentration of the template DNA.

The reaction conditions of the fluorescent quantitative PCR are as follows: pre-denaturation at 95°C for 3-5min; denaturation at 95°C for 5-30s, annealing at 50°C-60°C for 20-40s, extension at 72°C for 20-40s, collecting fluorescence signal intensity, and repeating 30-45 cycles.

The 5th object of the present invention is to provide a kind of quantitative method that freshwater cable bacterium Candidatus Electronema produces dimethyl sulfide gene, comprises the following steps:

(1) Linking the sequence shown in SEQ ID NO.1 to the plasmid, constructing a recombinant positive plasmid and diluting it gradiently as a template, using the above-mentioned detection primers, mixing the amplification reaction system and performing fluorescent quantitative PCR;

(2) After the reaction finishes, draw a standard curve according to the Cq value of the template concentration and the PCR reaction;

(3) Extract the total DNA of the sample to be tested, add the same detection primers as in step (1), mix the amplification reaction system and perform fluorescent quantitative PCR, and calculate the fresh water in the sample according to the standard curve drawn in step (2) after the reaction is completed. Abundance of dimethyl sulfide-producing genes in the cable bacterium Candidatus Electronema.

The source of the sample to be tested can be soil, water body, freshwater sediment, biofilm and other samples.

There are still great difficulties and challenges in the quantitative analysis of cable bacteria-driven DMS release activity. We sterilized environmental samples to obtain a medium that supports the growth of cable bacteria, and then artificially constructed a sterile medium that does not contain The complex microbial community of cable bacteria, and then by artificially controlling whether the cable bacteria are added or not, the experimental group with cable bacteria and the control group without cable bacteria are obtained, and finally the dimethyl sulfide release that can be used to detect cable bacteria is obtained. amount of experimental samples. In addition, this method designed a pair of specific detection primers, kits and quantitative methods for the abundance of dimethyl sulfide-producing genes of Candidatus Electronema, a pair of freshwater cable bacteria Candidatus Electronema, based on published publications and cable bacterial genome information obtained by the research group. The detection primer, kit and quantitative method of the present invention have the characteristics of high accuracy, strong sensitivity, good repeatability, high specificity, etc., and the linear range of quantitative detection can reach 10 ¹ -10 ⁸ copies/μL. This method provides for the first time a method for detecting the dimethyl sulfide gene of the freshwater cable bacterium Candidatus Electronema in the sample by fluorescent quantitative PCR, which greatly reduces the detection cost compared with the current metagenomic sequencing method. The invention measures the dimethyl sulfide-producing functional activity of the cable bacteria of the freshwater genus through an analysis method combining product quantification and functional gene quantification. Related inventions and technologies will provide important technical support for the correct measurement and evaluation of the ecological functions of uncultivated microorganisms.

The beneficial effects of the present invention are as follows:

By using the method for measuring the dimethyl sulfide release of the freshwater cable bacterium Candidatus Electronema in the present invention, the dimethyl sulfide release rate released by the sample can be measured under the condition that the cable bacteria exist.

Utilizing the detection primers of the present invention according to the detection method of the present invention can quantitatively detect the gene abundance of dimethyl sulfide produced by Candidatus Electronema in the sample, making up for the inability to quickly detect the dimethyl sulfide production of Candidatus Electronema by fluorescent quantitative PCR. A technical gap in methyl sulfide gene abundance. The detection primer, detection kit and method of the present invention have the characteristics of high accuracy, strong sensitivity, good repeatability and high specificity, and the linear fraction of quantitative detection can reach 10 ¹ -10 ⁸ copies/μL.

Description of drawings

Figure 1 shows the results of the release rate of dimethyl sulfide in the experimental group in which cable bacteria existed and in the control group in which cable bacteria did not exist.

Fig. 2 is the analysis result of fluorescent quantitative PCR melting curve.

Figure 3 is the fluorescence quantitative PCR amplification kinetic curve; among them, 1 is 1.11E+08 copies/μL, 2 is 9.27E+06 copies/μL, 3 is 7.72E+05 copies/μL, and 4 is 6.44E+04 copies/μL, 5 is 5.36E+03 copies/μL, 6 is 4.47E+02 copies/μL, 7 is 3.72E+01 copies/μL; 8 is blank water control.

Figure 4 is a fluorescent quantitative PCR standard curve; where, 1 is 1.11E+08 copies/μL, 2 is 9.27E+06 copies/μL, 3 is 7.72E+05 copies/μL, 4 is 6.44E+04 copies/μL μL, 5 is 5.36E+03 copies/μL, 6 is 4.47E+02 copies/μL, 7 is 3.72E+01 copies/μL; E=100% is the detection primer amplification efficiency, ^R2 value=0.995 is linear correlation coefficient.

Fig. 5 shows the detection results of the dimethyl sulfide-producing gene of Candidatus Electronema in four environmental samples detected by fluorescent quantitative PCR samples.

Detailed ways

The following examples are to further illustrate the present invention, rather than limit the present invention.

Example 1

The measuring method of freshwater genus cable bacterium Candidatus Electronema dimethyl sulfide release comprises the steps carried out in sequence as follows:

(1) Collect sediment environmental samples from the river section of Wenta Park, Shunde District, Foshan City, Guangdong Province, sieve to remove large organisms and impurities, and then sediment the homogenized sediment to obtain sediment after precipitation.

(2) Take part of the precipitated sediment and put it in a small beaker, and place it in a water tank for continuous aerated culture to obtain enriched cable bacteria as the inoculum for subsequent experiments.

(3) During the bacterial culture of the cable, the part of the deposited sediment in step (1) is sterilized. A complex microbial community free of cable bacteria was reconstituted by adding 1% chicken manure (chicken manure to sediment volume ratio). This was used as the microbially reconstituted sediment for subsequent experiments.

NOTE: Sterilization requires verification that the cable bacteria in the sample will not re-grow.

(4) The cable bacteria inoculum obtained in step (2) was added to the partially reconstituted sediment obtained in step (3) at a weight ratio of 1.5 per thousand as the cable bacteria experimental group. The remaining part of the microbial reconstruction sediment obtained in step (3) was used as a control group.

(5) The experimental group and the control group were cultured in the water tank at the same time under the condition of room temperature of 20°C-25°C with aeration.

(6) The experimental group and the control group were respectively placed in the gas collection device, and the gas was collected at the 0th, 4th, 8th, 12th, 16th, 32nd, and 48th hours after being put into the device.

(7) Through gas chromatographic analysis, compare the DMS production rate between the experimental group and the control group.

According to the results shown in Figure 1, the present invention can detect that the presence of the freshwater cable bacteria Candidatus Electronema in the sample significantly promotes the release rate of dimethyl sulfide in the sample. At 48 hours, the amount of dimethyl sulfide released in the experimental group was 10 times that of the control group.

Example 2

The design of fluorescent quantitative PCR primers, method establishment, product verification and preparation of positive plasmid standard products include the following steps in sequence:

Step 1: Download the published dimethyl sulfide gene sequence of Candidatus Electronema from the NCBI website, the sequence of the dimethyl sulfide gene from Candidatus Electrothrix from the saltwater genus Candidatus Electrothrix and the homologous sequences with close evolutionary relationship.

Step 2: Annotate and extract dimethyl sulfide-producing gene sequences based on the genomes of multiple freshwater cable bacteria Candidatus Electronema obtained by our research group.

Step 3: Use sequence comparison software to design specific primers for the dimethyl sulfide-producing gene sequence of Candidatus Electronema, which is expected to include the known and obtained dimethyl sulfide-producing genes of Candidatus Electronema The base sulfide gene sequence, the nucleotide sequences of the designed upstream primer and downstream primer are as follows:

a. Upstream primer F: 5'-TTYTCBTGGTCRGRCTGGCT-3';

b. Downstream primer R: 5'-CARCAGCTTKCGYTCYTCCA-3'.

The above primer sequences were searched in NCBI, but no identical sequences were found, indicating that the primers had strong specificity.

Step 4: Use a conventional DNA extraction kit to extract the environmental samples after enrichment and cultivation of cable bacteria, and use the obtained DNA as a template for PCR reaction.

Note: When the selected environmental samples contain more PCR inhibitors, the extracted DNA needs to be diluted before performing PCR reaction.

Step 5: Prepare the PCR reaction system.

Note: When the DNA content in the sample is low, the material ratio in the amplification reaction system is: 10 μmol/L upstream primer F: 10 μmol/L downstream primer R: Taq enzyme: template DNA: ultrapure water volume ratio = 1 :1:10:2:6.

Step 6: Perform PCR reaction. The reaction conditions in this example are pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 5 s, and collecting fluorescence signal intensity, repeating 43 cycles.

Step 7: After the reaction, the PCR amplification product is recovered and sent to a sequencing company for sequencing. The sequencing results of this example show that the PCR amplification product is the target sequence. The amplified sequence is shown in SEQ ID NO.1.

Step 8: The above-mentioned PCR amplification products were spliced using the pEASY-T1Simple Cloning Kit of Beijing Quanshijin Co., Ltd., and the positive clones were expanded and cultured to confirm that the extracted plasmid DNA contained a positive insert (the nucleotide sequence of which is as shown in SEQ ID NO. 1) positive plasmid.

SEQ ID NO.1

CACAGCTTGCTGATTTCTGCCCCGGTCAATGACTGGCTACAGCAGCAAAGCGGCTTTGTGCGCGGCATATATCGGCTAGCTTATTCGCTGTTCTCCATCTTTACCCTACTTCCTTTGCTTTGGTATCAATACCAACTGCCGCAAGAGGTGATATTCTCTTGGTCAGGCTGGCTGCGTATTCCCCAGGCAGCCTTATTGCTTTACGCCTTGATCAT GCTGCTGGGCGGGATGCAGGTGTATGACCTAGGCTATTTGGTTGGTATCCGCCAATGGCAGAGCTGGCAGCACAAGACCGAGCTTCCAGTCTTACCTTTCACCTGCCAAGGGGTACTGCGCTATGTCCGGCATCCTTGGTACAGTGCTGGACTGCCGATTCTCTGGACTGTCGGCCCTATCACTGATGCCAATCTGCCTGCGCGAGTGATCCTCA GCGTGTATCTTGTTATCGGCACCTTCTTGGAAGAACGCAAGCTGCTGCATGAGCTAGGCGAGATCTACCGCAGGTACTGCCAGCAAGTACCCATGCTGATTCCGTGGAAGGG

Example 3

Establishing a fluorescent quantitative PCR reaction standard curve includes the following steps in sequence:

Step 1: Dilute the positive plasmid prepared in Example 2 into 7 gradients. Including, 1 is 1.11E+08 copies/μL, 2 is 9.27E+06 copies/μL, 3 is 7.72E+05 copies/μL, 4 is 6.44E+04 copies/μL, 5 is 5.36E+03 copies/μL μL, 6 is 4.47E+02 copy/μL, 7 is 3.72E+01 copy/μL, 8 is blank water control;

Step 2: Prepare the same reaction system as in step 5 of example 2, and react under the same conditions as step 6 of example 2.

Step 3: fluorescent quantitative PCR reaction standard curve, its equation is:

y=-3.322x+39.685, E=100%, R2=0.995; x is the common logarithm of the initial plasmid concentration, and y is the Cq value.

According to the standard curve equation, it can be seen that the common logarithm of different plasmid concentration gradients is linearly correlated with the Cq value, and R2 is 0.995, which shows a good correlation, and the amplification efficiency of the primers is as high as 100%. It can be seen from the concentration of samples included in the standard curve that the quantitative detection range of the kit and method of the present invention is 10 ¹ -10 ⁸ copies/μL. The dissolution curve is shown in Figure 2, the kinetic curve is shown in Figure 3, and the standard curve is shown in Figure 4.

Example 4

Using fluorescent quantitative PCR reaction to detect the gene abundance of dimethyl sulfide produced by a kind of freshwater cable bacterium CandidatusElectronema in environmental samples, including the following steps in order:

Step 1: Extract the total DNA of the sample using a common soil DNA kit, with four replicates.

Step 2: Establish a standard curve according to the fluorescent quantitative PCR reaction system and reaction conditions introduced in Example 3, and measure the abundance of dimethyl sulfide-producing genes of Candidatus Electronema in the sample.

According to the results shown in FIG. 5 , the present invention can detect the abundance of dimethyl sulfide-producing genes of Candidatus Electronema in environmental samples. The source of the total DNA of the sample can be soil, water body, freshwater sediment, biofilm and other samples.

It should be pointed out that those skilled in the art can make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should be within the protection scope of the present invention.

Claims (6)

1. A detection primer for producing dimethyl sulfide gene by freshwater cablebacteria Candidatus Electronema, which is shown as follows:

a. upstream primer F:5 '-TTYTCCBTGGTCRGRCTGGCT-3';

b. the downstream primer R:5'-CARCAGCTTKCGYTCYTCCA-3'.

2. A kit for detecting dimethyl sulfide gene produced by freshwater cabled bacteria Candidatus Electronema, which is characterized by comprising the detection primer of claim 1.

3. The test kit of claim 2, further comprising a positive standard, wherein the positive standard is recombinant plasmid DNA comprising a sequence as set forth in SEQ ID No. 1.

4. The method for detecting the dimethyl sulfide gene produced by the freshwater cabled bacteria Candidatus Electronema is characterized by comprising the following steps of: extracting total DNA of sediment to be detected as a template, adding the detection primer of claim 1, mixing an amplification reaction system, and detecting and judging whether the sediment sample to be detected contains the dimethyl sulfide gene produced by freshwater cable bacteria Candidatus Electronema by a fluorescence quantitative PCR method.

5. The method according to claim 4, wherein the fluorescent quantitative PCR comprises the following components: an upstream primer, a downstream primer, taq enzyme, template DNA and ultrapure water; the reaction conditions are as follows: pre-denaturation at 95℃for 3-5min; denaturation at 95℃for 5-30s, annealing at 50℃to 60℃for 20-40s, extension at 72℃for 20-40s, collection of fluorescence signal intensity, and repetition of 30-45 cycles.

6. A method for quantifying dimethyl sulfide gene produced by freshwater cabled bacteria Candidatus Electronema, which is characterized by comprising the following steps:

(1) Ligating the sequence shown as SEQ ID NO.1 onto a plasmid, constructing a recombinant positive plasmid, performing gradient dilution on the recombinant positive plasmid to serve as a template, mixing an amplification reaction system by using the detection primer as set forth in claim 1, and performing fluorescent quantitative PCR;

(2) After the reaction is finished, drawing a standard curve according to the template concentration and the Cq value of the PCR reaction;

(3) Extracting total DNA of a sample to be detected, adding the detection primer which is the same as that in the step (1), mixing an amplification reaction system, performing fluorescent quantitative PCR, and calculating the abundance of the dimethyl sulfide gene produced by the freshwater cable bacteria Candidatus Electronema in the sample according to the standard curve drawn in the step (2) after the reaction is finished.