CN115851719A

CN115851719A - Method for detecting pathogenic microorganisms based on CRISPR technology

Info

Publication number: CN115851719A
Application number: CN202211148497.2A
Authority: CN
Inventors: 王丽梅; 梁亚峰
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2021-06-11
Filing date: 2021-12-17
Publication date: 2023-03-28
Also published as: CN114164214B; CN116334081A; CN114164214A

Abstract

The invention provides a method for detecting bovine viral diarrhea virus or viral diarrhea/mucosal disease based on CRISPR technology, which comprises the steps of detecting by using a gRNA, a Cas protein and a single-stranded nucleic acid detector; by screening and optimizing the gRNA, the detection efficiency is improved, and the method has a wide application prospect.

Description

Method for detecting pathogenic microorganisms based on CRISPR technology

Technical Field

The invention relates to the field of nucleic acid detection, in particular to a method, a system and a kit for detecting bovine herpes virus I or bovine viral diarrhea virus or brucella on the basis of a CRISPR (clustered regularly interspaced short palindromic repeats) technology.

Background

Infectious rhinotracheitis (also known as necrotic rhinitis and erythrorhinopathy) is a contact infectious disease of cattle caused by Bovine herpes virus type I (Bovine herpes virus type 1), which shows symptoms such as inflammation of upper respiratory tract and tracheal mucosa, dyspnea, nasal fluid flowing and the like, and BHV-1 can also cause various diseases such as genital tract infection, conjunctivitis, meningoencephalitis, abortion, mastitis and the like. The disease is classified as B-type infectious disease by OIE, and is also classified as two types of animal infectious diseases by China. The current test methods for diagnosing bovine herpes virus type I at home and abroad include: virus separation, inclusion body examination, immunofluorescence test, serum neutralization test, indirect hemagglutination test or enzyme-linked immunosorbent assay, etc. In recent years, nucleic acid probe technology and Polymerase Chain Reaction (PCR) technology for detecting viral DNA have also been established. In international trade, diagnostic methods are specified as virus neutralization assays, enzyme-linked immunosorbent assays and pathogen isolation assays (limited to semen).

Viral Diarrhea/Mucosal Disease (Viral Diarrhea/Mucosal Disease) is an infectious Disease caused by Bovine Viral Diarrhea Virus (Bovine Viral Diarrhea/Mucosal Disease Virus) and is characterized by Mucosal inflammation, erosion, necrosis and Diarrhea. Domestic and wild ruminants and pigs are natural hosts of the disease, and natural disease cases are only found in cattle, sheep and yaks, and have no obvious interspecific differences. Cattle of various ages have susceptibility, but young cattle of 6-18 months of age have higher susceptibility and are more likely to suffer from diseases after infection. Sheep and goats may also have subclinical infection, and antibodies are produced after infection. There are many methods for detecting bovine viral diarrhea virus, including serum neutralization assays, immunohistochemical methods, ELISA, and fluorescent PCR techniques. There are also reports of using CRISPR-Cas13a to detect bovine viral diarrhea virus (e.g., chinese patent application CN 111979357A), but the detection takes longer time, and its detection is RNA, and the application scenario is limited.

Brucellosis (Brucellosis), also known as Brucellosis, thalassemia, equine fever, and wavy heat, is a systemic infectious disease of zoonosis. The disease mainly damages the reproductive system and joints of people and livestock, and causes great harm to the development of animal husbandry and human health. The pathogenic bacterium of brucellosis is Brucella (Brucella). The animal diagnosis standard of brucellosis is as follows: (1) and (3) isolating the Brucella. (2) Positive test tube agglutination test or positive complement fixation test in serological formal test. (3) In the preliminary screening test, one or more positive persons with epidemiological history and clinical symptoms are found. The livestock with one of the above items is determined to be diseased livestock. Currently, there is a method for detecting brucella by Cas12a, such as chinese patent application CN112322764A, but the detection time is long and the detection sensitivity is low.

The invention provides a novel method for detecting bovine herpes virus I, bovine viral diarrhea virus or brucella, which is based on CRISPR technology, in particular based on trans activity of V-type Cas enzyme and has the advantages of rapidness, convenience, high specificity and high detection sensitivity.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting bovine herpes virus type I, bovine viral diarrhea virus or brucella on the basis of CRISPR technology.

In one aspect, the invention provides a gRNA for detecting bovine herpes virus type I, the gRNA comprising a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid, which is a nucleic acid derived from bovine herpes virus type I.

In the present invention, the region that binds to the CRISPR/CAS effector protein, also known as the direct repeat, backbone region or spacer sequence, interacts with the CAS protein, thereby binding to the CAS protein.

In one embodiment, the gRNA comprises, in order from 5 'to 3', a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid contains 20-30 bases and hybridizes to the sequence shown in SEQ ID No.1 or the reverse complement thereof and comprises the sequence shown in any one of SEQ ID nos. 5-8; preferably, the targeting sequence comprises a sequence as shown in any one of SEQ ID Nos. 5, 6, 7 and 8.

In preferred embodiments, the targeting sequence that hybridizes to the target nucleic acid contains 20-30 bases, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises the sequence set forth in any one of SEQ ID nos. 5 to 8 and further comprises 1 to 10 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9 bases) at the 3' end of the sequence set forth in any one of SEQ ID nos. 5 to 8, and the targeting sequence that hybridizes to the target nucleic acid hybridizes to the sequence set forth in SEQ ID No.1 or the reverse complement thereof; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID nos. 5, 6, 7, 8.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid lacks 1-5 bases (e.g., 1, 2, 3, 4, 5 bases) in succession from the 3' end of the sequence shown in any of SEQ ID Nos. 5-8 as compared to the sequence shown in any of SEQ ID Nos. 5-8.

The hybridization with the sequence shown in SEQ ID No.1 or the reverse complementary sequence thereof means that the guide sequence and a continuous section of the reverse complementary sequence of SEQ ID No.1 or SEQ ID No.1 can be continuously complementarily paired. For example, if the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, then 30 bases of the targeting sequence need to be complementarily paired with consecutive 30 bases of SEQ ID No.1 or its complementary sequence.

In a more preferred embodiment, the targeting sequence that hybridizes to the target nucleic acid is as set forth in any one of SEQ ID Nos. 5-8.

In one embodiment, the Cas protein is selected from a type V Cas protein, e.g., cas12, cas14 family proteins, or mutants thereof.

In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j.

Preferably, the sequence of the region binding to the Cas protein is shown as SEQ ID No. 21.

In another aspect, the invention provides a composition for detecting/diagnosing bovine herpes virus type I, the composition comprising the gRNA, a Cas protein, and a single-stranded nucleic acid detector.

In another aspect, the invention provides a method of detecting/diagnosing bovine herpesvirus I or infectious rhinotracheitis, comprising contacting a test nucleic acid with a type V Cas protein, a gRNA as described above, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single stranded nucleic acid detector, thereby detecting bovine herpes virus type I or infectious rhinotracheitis.

Further, the method further comprises the step of obtaining a test nucleic acid from a test sample; preferably, the nucleic acid to be detected is obtained from a sample to be detected by amplification.

In the present invention, the nucleic acid to be detected may be a double-stranded nucleic acid or a single-stranded nucleic acid.

The amplification of the invention is selected from one or more of PCR, nucleic Acid Sequencing Based Amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase Dependent Amplification (HDA), or Nicking Enzyme Amplification Reaction (NEAR), multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR), or derivative amplification method (RAM).

In the present invention, the sample may be a sample from a ruminant animal, e.g., cattle, sheep; in other embodiments, the sample may also be from other animals, e.g., pigs, horses, donkeys.

In one embodiment, the sample may be a nasal swab, purulent nasal fluid, a genital tract swab, semen, respiratory mucosa, a portion of tonsil, lung, bronchial lymph node, animal fetus, liver, lung, kidney, and placental cotyledon.

In other embodiments, the sample may also be derived from an environmental sample of the farm, such as air, water, soil, farm equipment, and the like.

In another aspect, the present invention also provides a system, composition or kit for detecting or diagnosing whether a test animal is infected with infectious rhinotracheitis, the system, composition or kit including a type V Cas protein, the gRNA described above, and a single-stranded nucleic acid detector. Further, the system, composition or kit further comprises an amplification primer.

In another aspect, the invention also provides the use of the composition for detecting or diagnosing whether the animal to be tested is infected with the infectious rhinotracheitis in diagnosing or detecting the infectious rhinotracheitis, or the use in preparing a reagent or a kit for diagnosing or detecting the infectious rhinotracheitis.

In another aspect, the invention also provides a system, composition or kit for detecting/diagnosing bovine herpes virus type I, comprising a type V Cas protein, the above-described gRNA (guide RNA), and a single-stranded nucleic acid detector.

In another aspect, the invention also provides the use of the above system, composition or kit for the detection/diagnosis of bovine herpes virus type I.

In another aspect, the invention also provides the use of the composition in the preparation of a reagent or a kit for detecting/diagnosing bovine herpes virus type I.

Further, the V-type Cas protein is selected from Cas12, a Cas14 family protein, or a mutant thereof.

In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any of Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j.

In one embodiment, the Cas12a is selected from one or any several of FnCas12a, assas 12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a or Lb4Cas12 a.

In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the group consisting of:

(1) SEQ ID NO: 4;

(2) Converting SEQ ID NO:4 or an active fragment thereof by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues, and has basically the same function;

(3) And SEQ ID NO:4, and having trans activity, of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%.

In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions, or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In another aspect, the present invention provides a gRNA for detecting bovine viral diarrhea virus, the gRNA comprising a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid, which is a nucleic acid derived from bovine viral diarrhea virus.

In the present invention, the region binding to the CRISPR/CAS effector protein, also known as direct repeat, backbone region or spacer sequence, interacts with the CAS protein, thereby binding to the CAS protein.

In one embodiment, the guide sequence which hybridizes to the target nucleic acid comprises 20 to 30 bases and hybridizes to the sequence shown in SEQ ID No.2 or the reverse complement thereof and comprises the sequence shown in any one of SEQ ID nos. 9 to 10; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID Nos. 9 and 10.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises the sequence set forth in any one of SEQ ID nos. 9 to 10 and further comprises 1 to 10 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9 bases) at the 3' end of the sequence set forth in any one of SEQ ID nos. 9 to 10, and the targeting sequence that hybridizes to the target nucleic acid hybridizes to the sequence set forth in SEQ ID No.2 or the reverse complement thereof; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID Nos. 9 and 10.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid lacks 1-5 bases (e.g., 1, 2, 3, 4, 5 bases) in succession from the 3' end of the sequence shown in any of SEQ ID Nos. 9-10 as compared to the sequence shown in any of SEQ ID Nos. 9-10.

The hybridization with the sequence shown in SEQ ID No.2 or the reverse complementary sequence thereof means that the guide sequence and a continuous section of the reverse complementary sequence of SEQ ID No.2 or SEQ ID No.2 can be continuously complementarily paired. For example, if the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, then 30 bases of the targeting sequence need to be complementarily paired with consecutive 30 bases of SEQ ID No.2 or its complementary sequence.

In a more preferred embodiment, the targeting sequence that hybridizes to the target nucleic acid is as set forth in any one of SEQ ID Nos. 9-10.

In one embodiment, the Cas protein is selected from a V-type Cas protein, e.g., cas12, cas14 family proteins, or mutants thereof.

Preferably, the sequence of the region that binds to Cas protein is shown in SEQ ID No. 21.

In another aspect, the present invention provides a composition for detecting/diagnosing bovine viral diarrhea virus, the composition including the above gRNA, further including a Cas protein and a single-stranded nucleic acid detector.

In another aspect, the invention provides a method for detecting/diagnosing bovine viral diarrhea virus or viral diarrhea/mucosal disease, comprising contacting a test nucleic acid with a type V Cas protein, the gRNA described above, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single stranded nucleic acid detector, thereby detecting the bovine viral diarrhea virus or viral diarrhea/mucosal disease.

Further, the method further comprises the step of obtaining a test nucleic acid from a test sample; preferably, the nucleic acid to be tested is obtained from the sample to be tested by amplification.

In one embodiment, the sample may be a secretion, fecal matter, blood or spleen sample.

In another aspect, the present invention also provides a system, composition or kit for detecting or diagnosing whether a test animal is infected with viral diarrhea/mucosal disease, the system, composition or kit comprising a type V Cas protein, the above gRNA, and a single-stranded nucleic acid detector. Further, the system, composition or kit further comprises an amplification primer.

In another aspect, the invention also provides the use of the composition for detecting or diagnosing whether the animal to be detected is infected with the viral diarrhea/mucosal disease in diagnosis or detection of the viral diarrhea/mucosal disease, or in the preparation of a reagent or a kit for diagnosing or detecting the viral diarrhea/mucosal disease.

In another aspect, the present invention also provides a system, composition or kit for detecting/diagnosing bovine viral diarrhea virus, the system, composition or kit comprising a type V Cas protein, the above-described gRNA (guide RNA), and a single-stranded nucleic acid detector.

In another aspect, the invention also provides the application of the system, the composition or the kit in detecting/diagnosing the bovine viral diarrhea virus.

In another aspect, the invention also provides the application of the composition in preparing a reagent or a kit for detecting/diagnosing the bovine viral diarrhea virus.

(1) SEQ ID NO: 4;

(2) Converting SEQ ID NO:4 or an active fragment thereof, and has substantially the same function, or a derivative protein formed by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues;

In another aspect, the invention provides a gRNA for detecting brucella, the gRNA including a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid, which is a nucleic acid derived from brucella.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid contains 20-30 bases and hybridizes to the sequence shown in SEQ ID No.3 or the reverse complement thereof and comprises the sequence shown in any one of SEQ ID nos. 11-20; preferably, the targeting sequence comprises a sequence as shown in any one of SEQ ID nos. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises the sequence set forth in any one of SEQ ID nos. 11 to 20 and further comprises 1 to 10 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9 bases) at the 3' end of the sequence set forth in any one of SEQ ID nos. 11 to 20, and the targeting sequence that hybridizes to the target nucleic acid hybridizes to the sequence set forth in SEQ ID No.3 or the reverse complement thereof; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID nos. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid lacks 1-5 bases (e.g., 1, 2, 3, 4, 5 bases) in succession from the 3' end of the sequence shown in any of SEQ ID Nos. 11-20 as compared to the sequence shown in any of SEQ ID Nos. 11-20.

The hybridization with the sequence shown in SEQ ID No.3 or the reverse complementary sequence thereof means that the guide sequence and a continuous section of the reverse complementary sequence of SEQ ID No.3 or SEQ ID No.3 can be continuously complementarily paired. For example, if the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, then 30 bases of the targeting sequence need to be complementarily paired with consecutive 30 bases of SEQ ID No.3 or its complement.

In a more preferred embodiment, the targeting sequence for hybridization to the target nucleic acid is as set forth in any one of SEQ ID Nos. 11-20.

In another aspect, the present invention provides a composition for detecting/diagnosing brucella, which includes the above gRNA, and further includes a Cas protein and a single-stranded nucleic acid detector.

In another aspect, the invention provides a method for detecting/diagnosing brucellosis or brucellosis, comprising contacting a nucleic acid to be detected with a V-type Cas protein, the gRNA, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting brucellosis or brucellosis.

Further, the method further comprises the step of obtaining a nucleic acid to be tested from a sample to be tested; preferably, the nucleic acid to be detected is obtained from a sample to be detected by amplification.

The amplification of the invention is selected from one or more of PCR, nucleic acid sequencing-based amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), nicking Enzyme Amplification Reaction (NEAR), multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR) and derivative amplification method (RAM).

In the present invention, the sample may be a sample from an animal, for example, cattle, sheep; in other embodiments, the sample may also be from other animals, e.g., pigs, horses, donkeys.

In one embodiment, the sample may be a flow product, secretion, excretion (feces, urine), milk, meat, viscera, skin, hair, blood, or bone marrow sample.

In another aspect, the present invention also provides a system, composition or kit for detecting or diagnosing whether a test animal is infected with brucellosis, the system, composition or kit including a V-type Cas protein, the gRNA described above, and a single-stranded nucleic acid detector. Further, the system, composition or kit further comprises an amplification primer.

On the other hand, the invention also provides the application of the composition for detecting or diagnosing whether the animal to be detected is infected with the brucellosis in the diagnosis or detection of the brucellosis, or in the preparation of a reagent or a kit for diagnosing or detecting the brucellosis.

In another aspect, the present invention also provides a system, composition or kit for detecting/diagnosing brucella, the system, composition or kit comprising a V-type Cas protein, the above-described gRNA (guide RNA), and a single-stranded nucleic acid detector.

On the other hand, the invention also provides application of the system, the composition or the kit in detecting/diagnosing brucellosis or brucellosis.

On the other hand, the invention also provides application of the composition in preparing a reagent or a kit for detecting/diagnosing brucellosis or brucellosis.

Preferably, the brucella is a bovine brucella.

Further, the V-type Cas protein is selected from Cas12, cas14 family proteins, or mutants thereof.

In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the group consisting of seq id no:

(1) The amino acid sequence of SEQ ID NO: 4;

(3) And SEQ ID NO:4, and having trans activity, has a sequence identity of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%.

In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In the present invention, the single-stranded nucleic acid detector includes a single-stranded DNA, a single-stranded RNA, or a single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector comprises a mixture of any two or three of single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrids, e.g., a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrids, and a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single stranded nucleic acid detector further comprises modifications to the bases.

In a preferred embodiment, the single stranded nucleic acid detector is a single stranded oligonucleotide detector.

The single-stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein, upon recognition or hybridization to the target nucleic acid, can stimulate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and thereby generating a detectable signal.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In a preferred embodiment, the detectable signal is achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different reporter groups, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be shown; for example, a single-stranded nucleic acid detector having a fluorophore and a quencher disposed at opposite ends thereof, when cleaved, can exhibit a detectable fluorescent signal.

In one embodiment, the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the detectable signal may also be achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different marker molecules, and a reaction signal is detected in a colloidal gold detection mode.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal prior to cleavage by the Cas protein and produces a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single-stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, and the like, to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatomic nucleotide linkages. In other embodiments, the single stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetics are Peptide Nucleic Acids (PNAs), another class of nucleic acid mimetics is based on linked morpholino units having a heterocyclic base attached to a morpholino ring (morpholino nucleic acids), and other nucleic acid mimetics further include cyclohexenyl nucleic acids (CENAs), further including ribose or deoxyribose chains.

In one embodiment, the Cas protein and gRNA are used in a molar ratio of (0.8-1.2): 1.

in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50nM.

In one embodiment, the gRNA is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50nM.

In one embodiment, the test nucleic acid is used in a final concentration of 5-100nM, preferably 10-50nM.

In one embodiment, the single stranded nucleic acid detector is used in a final concentration of 100-1000nM, preferably, 150-800nM, preferably, 200-500nM, preferably, 200-300nM.

In one embodiment, the single stranded nucleic acid detector has 2 to 300 nucleotides, preferably, 3 to 200 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, more preferably, 5 to 15 nucleotides.

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence comprising 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to produce maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, as taught by, for example, smith Waterman,1981, adv.appl.Math.2. The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.

As used herein, the "CRISPR" refers to Clustered, regularly interspaced short palindromic repeats (Clustered regular interspersed short palindromic repeats) derived from the immune system of a microorganism.

As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with very high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin and avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to proteins (such as antibodies) by covalent bonds, and avidin molecules bonded with enzyme react with biotin molecules bonded with specific antibodies, so that not only is the multistage amplification effect achieved, but also the color is developed due to the catalytic action of the enzyme when the enzyme meets corresponding substrates, and the purpose of detecting unknown antigen (or antibody) molecules is achieved.

Cas protein

As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein, which upon binding to a signature sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein, preferably single-stranded DNA (ssDNA), single-stranded DNA-RNA hybrids, single-stranded RNA). When the Cas protein is combined with the characteristic sequence, the protein can induce trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence.

The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of the gRNA.

The Cas protein provided by the invention comprises CRISPR/CAS effector proteins of V type and VI type, and comprises protein families of Cas12, cas13, cas14 and the like. Preferably, e.g., a Cas12 protein, e.g., cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j; preferably, the Cas protein is Cas12a, cas12b, cas12i, cas12j. The Cas13 protein family includes Cas13a, cas13b, and the like.

In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs, and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, can be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satt's, legionella, treponema, proteus, eubacterium, streptococcus, lactobacillus, mycoplasma, bacteroides, flavivivola, flavobacterium, azospirillum, sphaerochaeta, gluconacetobacter, neisseria, rogomyces, parvibaculum, staphylococcus, nitrifractor, mycoplasma, campylobacter, and Muspirillum.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be of the type of plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, streptomyces, agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.

gRNA

As used herein, the "gRNA" is also referred to as guide RNA or guide RNA and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, or consist of, a direct repeat and a guide sequence (also referred to as a spacer (spacer) in the context of endogenous CRISPR systems). grnas may include crRNA and tracrRNA or only crRNA depending on Cas protein on which they depend in different CRISPR systems. The crRNA and tracrRNA may be artificially engineered to fuse to form a single guide RNA (sgRNA). In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence (the signature sequence described in the present invention) to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, clustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), bowtie, geneius, biopython, and SeqMan.

The gRNA of the present invention may be natural or artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2 to 200 nucleotides, preferably, 2 to 150 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, and more preferably, 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single stranded nucleic acid detector is used in a detection method or system to report the presence or absence of a target nucleic acid in a sample. The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid can be detected; alternatively, if the detectable difference is not detectable, it is a reflection that the target nucleic acid is not detectable.

In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to one end and a second molecule (e.g., biotin) attached to the other end. The reaction system containing the single-stranded nucleic acid detector is used in combination with a flow strip to detect the target nucleic acid (preferably, in a colloidal gold detection manner). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group on each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids with a flow strip as defined herein, e.g. a (side) flow assay or a (side) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector may be replaced with each other, or the positions of the molecules may be changed, and the modified form is also included in the present invention as long as the reporting principle is the same as or similar to that of the present invention.

The detection method of the present invention can be used for quantitative detection of a target nucleic acid. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.

Sequence information

The partial sequence information related to the present invention is provided as follows:

serial number	Description of the preferred embodiment
		SEQ ID NO：1	BHV1 amplification products
SEQ ID NO：2	BVDV amplification product
		SEQ ID NO：3	Brucella amplification product
SEQ ID NO：4	Cas12i
		SEQ ID NO：5	Targeting region of gRNA-1
SEQ ID NO：6	Targeting region of gRNA-2
		SEQ ID NO：7	Targeting region for gRNA-3
SEQ ID NO：8	Targeting region for gRNA-4
		SEQ ID NO：9	Targeting region of gRNA-5
SEQ ID NO：10	Targeting regions for gRNA-6
		SEQ ID NO：11	Targeting region for gRNA-7
SEQ ID NO：12	Targeting region for gRNA-8
		SEQ ID NO：13	Targeting region of gRNA-9
SEQ ID NO：14	Targeting region for gRNA-10
		SEQ ID NO：15	Targeting region of gRNA-11
SEQ ID NO：16	Targeting region for gRNA-12
		SEQ ID NO：17	Targeting region for gRNA-13
SEQ ID NO：18	Targeting region for gRNA-14
		SEQ ID NO：19	Targeting region for gRNA-15
SEQ ID NO：20	Targeting region for gRNA-16
		SEQ ID NO：21	DR region of gRNA

Drawings

FIG. 1 is a graph showing the results of detection of ssDNA (SEQ ID No. 1) by different gRNAs (gRNA-1, gRNA-2, gRNA-3, and gRNA-4); wherein, line 1 is an experimental group; the time for the fluorescent signal to reach the peak value (reach the plateau phase) when the gRNA-1, the gRNA-2, the gRNA-3 and the gRNA-4 react with the ssDNA (SEQ ID No. 1) target nucleic acid is respectively about 8min, 15min, 35min and 10 min.

FIG. 2 is a graph showing the results of detection of dsDNA (SEQ ID No. 1) target nucleic acids by different gRNAs (gRNA-1, gRNA-4). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when gRNA-1 and gRNA-4 react with the target nucleic acid of dsDNA (SEQ ID No. 1) is about 15min and 23min respectively.

FIG. 3 is a graph showing the results of ssDNA (SEQ ID No. 2) detection using different gRNAs (gRNA-5 and gRNA-6); wherein line 1 is the experimental group; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-5 and the gRNA-6 react with the ssDNA (SEQ ID No. 2) target nucleic acid is about 6min and 5min respectively.

FIG. 4 is a graph showing the results of detection of dsDNA (SEQ ID No. 2) target nucleic acid by different gRNAs (gRNA-5, gRNA-6). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-5 and the gRNA-6 react with the target nucleic acid of the dsDNA (SEQ ID No. 2) is about 20min and 10min respectively.

FIG. 5 is a graph showing the results of detection of ssDNA (SEQ ID No. 3) by using different gRNAs (gRNA-7, gRNA-8, gRNA-9, gRNA-10, gRNA-11, gRNA-12, gRNA-13, gRNA-14, gRNA-15, and gRNA-16); wherein, line 1 is an experimental group; the time for the fluorescence signal to reach the peak value (reach the plateau phase) when the gRNA-7, the gRNA-8, the gRNA-9, the gRNA-11, the gRNA-12, the gRNA-13, the gRNA-14, the gRNA-15, the gRNA-16 and the ssDNA (SEQ ID No. 3) target nucleic acid are reacted is respectively about 20min, 30min, 12min, 15min, 24min, 20min and 18 min.

FIG. 6 is a graph showing the results of detection of dsDNA (SEQ ID No. 3) target nucleic acid by different gRNAs (gRNA-9 and gRNA-11). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) is about 6min when the gRNA-9 and the gRNA-11 react with a dsDNA (SEQ ID No. 3) target nucleic acid.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modifications or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

The technical scheme of the invention is based on the following principle, combines PCR amplification with CRISPR technology, and has the characteristics of rapidness, sensitivity, specificity and high efficiency. Under the premise that specific nucleic acid of target pathogenic bacteria exists in a sample, a specific primer is combined with a target sequence, the target sequence is enriched through PCR amplification, cas enzyme (Cas protein) is combined with an amplification product under the guidance of gRNA, the trans-cleavage (trans) activity of the Cas protein is activated, a Reporter (one end of the Reporter is connected with a fluorescent group, and the other end of the Reporter is connected with a quenching group) in a cleavage system can release fluorescence after being cleaved by the Cas protein, so that a detection result is presented. In other embodiments, both ends of the single-stranded nucleic acid detector (Reporter) may be provided with a label capable of being detected by colloidal gold.

Example 1 amplification of bovine herpesvirus type I specific nucleic acids and design of gRNAs

In this embodiment, design of primers and amplification of target nucleic acid are performed for specific nucleic acid of Bovine herpes virus type I (BHV 1) Bovine herpesvirus type 1.

Based on the genomic sequence of BHV1, amplification primers were designed as follows:

BHV1-gB-F1:cacctttgtggacctaaacct；

BHV1-gB-R1:gtagtcgagcagacccgtgtc；

the amplified target sequences were as follows:

cacctttgtggacctaaacctcacggttctggaggaccgcgagttcttgccgctagaagtgtacacgcgcgccgagctcgccgacacgggtctgctcgactac(SEQ ID No.1)。

for the target sequence, 4 grnas are designed in the segment or the complementary sequence thereof, and in the present embodiment, a gRNA capable of binding Cas12i is designed based on Cas12i (SEQ ID No. 4), and the first 3 bases of the 5' end of each gRNA are TTN (PAM sequence).

The sequences of the designed grnas were as follows:

example 2 use of gRNA for nucleic acid detection of bovine herpes virus type I

In order to verify the detection efficiency of different grnas designed in example 1 when applied to Cas12i protein, the present embodiment verified the activity of different grnas.

Firstly, a single-stranded target sequence (ssDNA, SEQ ID No. 1) or a reverse complementary sequence thereof is used as a target nucleic acid, and the ssDNA is the ssDNA targeted by the corresponding gRNA.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

the following reaction system is adopted: cas12i final concentration is 25nM, gRNA final concentration is 25nM, target nucleic acid final concentration is 25nM, single stranded nucleic acid detector final concentration is 200nM. Incubation at 37 ℃ and reading FAM fluorescence/1 min. The control group had no target nucleic acid added.

FIG. 1 shows the results of reaction with a target nucleic acid of ssDNA (SEQ ID No. 1) using gRNA-1, gRNA-2, gRNA-3, and gRNA-4. Compared with a control group, the gRNA-1, the gRNA-2, the gRNA-3 and the gRNA-4 can quickly report fluorescence, and the peak value of a fluorescence signal is shown within 35min, so that the sensitivity of the fluorescent signal is better when the fluorescent signal is used for detecting the bovine herpes virus type I specific nucleic acid; particularly, gRNA-1 and gRNA-4 can reach the peak of the fluorescence signal within 10 min. In FIG. 1, 1 is an experimental group.

Aiming at gRNA-1 and gRNA-4 with better effect of detecting single-stranded target sequences, the efficiency of the method in detecting double-stranded target sequences (dsDNA) is further verified.

Double-stranded target sequences (dsDNA, SEQ ID No. 1) were used as double-stranded target nucleic acids.

The double-stranded target nucleic acid is obtained by adopting a PCR reaction, wherein a PCR amplification system comprises the following components:

wherein, the template adopts a plasmid containing a target nucleic acid fragment, the addition amount of the PCR reaction template is 50 copies, the PCR amplification is carried out for 45 cycles, and finally 2 mul of PCR amplification product is taken as a double-stranded target nucleic acid for detection.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

the following detection system was used: cas12i final concentration of 50nM, gRNA final concentration of 50nM, target nucleic acid (double-stranded DNA amplified by PCR described above) 2. Mu.l, single-stranded nucleic acid detector final concentration of 200nM. Incubation at 37 ℃ and reading FAM fluorescence/20 s. The control group had no target nucleic acid added.

FIG. 2 shows the results of gRNA-1 and gRNA-4 when reacted with a target nucleic acid of dsDNA (SEQ ID No. 1); compared with a control group, the gRNA-1 and the gRNA-4 can both show obvious fluorescent signals in a shorter time, which reflects that the gRNA-1 and the gRNA-4 have better sensitivity for detecting dsDNA (SEQ ID No. 1); particularly, gRNA-1 can reach the peak value of a fluorescence signal within about 15 min. In FIG. 2, 1 is an experimental group and 2 is a control group.

Example 3 amplification of bovine viral diarrhea Virus-specific nucleic acids and design of gRNA

In this embodiment, the design of primers and the amplification of target nucleic acids are performed for specific nucleic acids of Bovine Viral Diarrhea Virus (BVDV) Bovine Viral Diarrhea/Mucosal Disease Virus.

Based on the genomic sequence of BVDV, amplification primers were designed as follows:

BVDV-5UTR-F1:ccgcgaMggccgaaaaga；

BVDV-5UTR-R1:tgacgactNccctgtactcag；

the target sequences obtained by amplification were as follows:

ccgcgaaggccgaaaagaggctagccatgcccttagtaggactagcatagcgaggggggtagcaacagtggtgagttcgttggatggcttaagccctgagtacagggtagtcgtca(SEQ ID No.2)。

for the target sequence, 2 grnas are designed in the segment or the complementary sequence thereof, and in the present embodiment, a gRNA capable of binding Cas12i is designed based on Cas12i (SEQ ID No. 4), and the first 3 bases of the 5' end of each gRNA are TTN (PAM sequence).

The sequences of the designed grnas were as follows:

example 4 application of gRNA in nucleic acid detection of bovine viral diarrhea Virus

To verify the detection efficiency of the different grnas designed in example 3 when applied to Cas12i protein, this embodiment verified the activity of the different grnas.

Firstly, a single-stranded target sequence (ssDNA, SEQ ID No. 2) or a reverse complementary sequence thereof is used as a target nucleic acid, and the ssDNA is ssDNA targeted by the corresponding gRNA.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

the following reaction system is adopted: cas12i final concentration was 25nM, gRNA final concentration was 25nM, target nucleic acid final concentration was 25nM, single stranded nucleic acid detector final concentration was 200nM. Incubation at 37 ℃ and reading FAM fluorescence/1 min. The control group had no target nucleic acid added.

FIG. 3 shows the results of using gRNA-5 and gRNA-6 when reacting with a target nucleic acid of ssDNA (SEQ ID No. 2). Compared with a control group, the gRNA-5 and the gRNA-6 can both report fluorescence rapidly, and the peak value of a fluorescence signal is within 6min, so that the better sensitivity of the fluorescent signal in the detection of bovine viral diarrhea virus specific nucleic acid is reflected. In FIG. 3, 1 is an experimental group.

The efficiency of double-stranded target sequences (dsDNA) in detection was further verified for gRNA-5 and gRNA-6.

As the double-stranded target nucleic acid, a double-stranded target sequence (dsDNA, SEQ ID No. 2) was used.

The double-stranded target nucleic acid is obtained by adopting a PCR reaction, wherein a PCR amplification system comprises the following steps:

wherein, the template adopts a plasmid containing a target nucleic acid fragment, the addition amount of the PCR reaction template is 20 copies, the PCR amplification is carried out for 45 cycles, and finally 2 mul of PCR amplification product is taken as a double-stranded target nucleic acid for detection.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

FIG. 4 shows the results of gRNA-5 and gRNA-6 when reacted with a target nucleic acid of dsDNA (SEQ ID No. 2); compared with a control group, the gRNA-5 and the gRNA-6 can both show obvious fluorescent signals in a shorter time, which reflects that the gRNA-5 and the gRNA-6 have better sensitivity for detecting dsDNA (SEQ ID No. 2); particularly, gRNA-6 can reach the peak value of a fluorescence signal within about 10 min. In fig. 4, 1 is an experimental group and 2 is a control group.

Example 5 amplification of Brucella-specific nucleic acids and design of gRNA

In this embodiment, the design of primers and the amplification of target nucleic acid are performed for specific nucleic acid of Brucella.

Based on the genome sequence of Brucella, amplification primers were designed as follows:

Brucella-IS711-F1:accattgaagtctggcgagca；

Brucella-IS711-R1:gaccgcattcatgggtttcg；

the target sequences obtained by amplification were as follows:

accattgaagtctggcgagcatgagcggctggggccgtttcggcttaatctgaccttccgaaaggcgttctagggcgtgtctgcatttaacgtaaccagatcatagcgcatgcgagatggacgaaacccatgaatgcggtc(SEQ ID No.3)。

for the target sequence, 10 grnas are designed in the segment or the complementary sequence thereof, and in the present embodiment, a gRNA capable of binding Cas12i is designed based on Cas12i (SEQ ID No. 4), and the first 3 bases of the 5' end of each gRNA are TTN (PAM sequence).

The sequences of the designed grnas were as follows:

example 6 application of gRNA to nucleic acid detection of Brucella

In order to verify the detection efficiency of different grnas designed in example 5 when applied to Cas12i protein, the activity of different grnas was verified in this embodiment.

Firstly, a single-stranded target sequence (ssDNA, SEQ ID No. 3) or a reverse complementary sequence thereof is used as a target nucleic acid, and the ssDNA is the ssDNA targeted by the corresponding gRNA.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

FIG. 5 shows the results of a reaction with a target nucleic acid of ssDNA (SEQ ID No. 3) using gRNA-7, gRNA-8, gRNA-9, gRNA-10, gRNA-11, gRNA-12, gRNA-13, gRNA-14, gRNA-15, and gRNA-16. Compared with a control group, the gRNA-7, the gRNA-8, the gRNA-9, the gRNA-11, the gRNA-12, the gRNA-13, the gRNA-14, the gRNA-15 and the gRNA-16 can quickly report fluorescence, and the peak value of a fluorescence signal can be displayed within 30min, so that the high sensitivity of the fluorescent signal in the specific nucleic acid detection of the Brucella melitensis is reflected; particularly, gRNA-9 and gRNA-11 can reach the peak value of a fluorescence signal within 15 min; in contrast, gRNA-10 has a weak fluorescence signal and low detection sensitivity. In FIG. 5, 1 is an experimental group.

Aiming at gRNA-9 and gRNA-11 with better effect of detecting single-stranded target sequences, the efficiency of the method in detecting double-stranded target sequences (dsDNA) is further verified.

As the double-stranded target nucleic acid, a double-stranded target sequence (dsDNA, SEQ ID No. 3) was used.

wherein, the template adopts a plasmid containing a target nucleic acid fragment, the addition amount of the PCR reaction template is 40 copies, the PCR amplification is carried out for 45 cycles, and finally 2 mul of PCR amplification product is taken as a double-stranded target nucleic acid for detection.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

FIG. 6 shows the results of gRNA-9 and gRNA-11 when reacted with a target nucleic acid of dsDNA (SEQ ID No. 3); compared with a control group, the gRNA-9 and the gRNA-11 can reach the peak value of a fluorescence signal within about 6min, and the sensitivity of detecting dsDNA (SEQ ID No. 3) is better. In fig. 6, 1 is an experimental group and 2 is a control group.

The guide sequence of a gRNA (gRNA-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16) in the present application has a length of 20 to 21bp, i.e., a region thereof hybridizing with a target nucleic acid is 20 to 21bp; in practice, one skilled in the art can also add or subtract any base to the 3' end of the guide sequence (and certainly ensure that it hybridizes to the target nucleic acid); the 5' end of the leader sequence is adjacent to the PAM sequence and is not suitable for readjustment; however, these length changes do not substantially affect the activity of gRNA, as long as the 3' end is ensured to have a 15bp-30bp hybridizing region with the target sequence, i.e., the function of binding Cas enzyme to the target sequence is achieved. For example, guide sequences for gRNA-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 can be reduced by 1-5 bases (e.g., 1, 2, 3, 4, or 5 bases) or increased by 1-10 bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases) at the 3' end while ensuring their pairing with the target sequence, which does not substantially affect the efficiency of the gRNA and Cas protein in detecting the target nucleic acid.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

Claims

1. A gRNA for detecting bovine viral diarrhea virus, the gRNA comprising a region that binds to a type V Cas protein and a guide sequence that hybridizes to a target nucleic acid, the target nucleic acid being a nucleic acid derived from bovine viral diarrhea virus; wherein the targeting sequence that hybridizes to the target nucleic acid is selected from any one or a combination of:

(1) The guide sequence hybridized with the target nucleic acid contains 20-30 bases and is hybridized with the sequence shown in SEQ ID No.2 or the reverse complementary sequence thereof, and the guide sequence comprises the sequence shown in any one of SEQ ID Nos. 9-10;

(2) The guide sequence hybridized with the target nucleic acid comprises a sequence shown in any one of SEQ ID No.9-10, and also comprises 1-10 bases at the 3' end of the sequence shown in any one of SEQ ID No.9-10, and the guide sequence hybridized with the target nucleic acid is hybridized with a sequence shown in SEQ ID No.2 or the reverse complementary sequence thereof;

(3) Compared with the sequence shown in any one of SEQ ID No.9-10, the guide sequence hybridized with the target nucleic acid continuously deletes 1-5 bases from the 3' end of the sequence shown in any one of SEQ ID No. 9-10;

(4) The guide sequence hybridized with the target nucleic acid is shown as any one of SEQ ID No. 9-10.

2. A method of detecting bovine viral diarrhea virus, the method comprising contacting a test nucleic acid with a type V Cas protein, a gRNA of claim 1, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single stranded nucleic acid detector, thereby detecting the bovine viral diarrhea virus.

3. The method of claim 2, further comprising the step of obtaining the test nucleic acid from the test sample.

4. The method of claim 3, wherein the sample is a sample from an animal.

5. The method of claim 2, wherein the detectable signal is achieved by any one of: a vision-based detection, a sensor-based detection, a color detection, a gold nanoparticle-based detection, a fluorescence polarization, a fluorescence signal, a colloidal phase transition, an electrochemical detection, or a semiconductor-based detection.

6. A system, composition or kit for detecting or diagnosing whether a test animal is infected with viral diarrhea/mucosal disease, the system, composition or kit comprising a type V Cas protein, a gRNA of claim 1, and a single-stranded nucleic acid detector.

7. A system, composition or kit for detecting/diagnosing bovine viral diarrhea virus or viral diarrhea/mucosal disease, the system, composition or kit comprising the gRNA of claim 1, the system, composition or kit further comprising a type V Cas protein and a single-stranded nucleic acid detector.

8. Use of the composition of claim 7 for diagnosing or detecting viral diarrhea/mucosal disease or for preparing a reagent or kit for diagnosing or detecting viral diarrhea/mucosal disease.

9. Use of the composition of claim 7 in the detection or diagnosis of bovine viral diarrhea virus, or in the preparation of a reagent or kit for the detection or diagnosis of bovine viral diarrhea virus.

10. Use according to claim 8 or 9, characterized in that the test sample to be tested for detection or diagnosis is of animal origin.