CN115851633A

CN115851633A - Aflatoxin oxidase with improved resistance to pepsin

Info

Publication number: CN115851633A
Application number: CN202211120063.1A
Authority: CN
Inventors: 姚冬生; 钱丹; 郭孟颖; 刘大岭; 谢春芳; 刘桂祯; 黄炯威; 劳伟明; 莫世艺
Original assignee: Guangdong Fang Can Animal Health Care Co ltd; Jinan University
Current assignee: Guangdong Fang Can Animal Health Care Co ltd; Jinan University
Priority date: 2022-09-15
Filing date: 2022-09-15
Publication date: 2023-03-28

Abstract

The invention discloses an aflatoxin oxidase (AFO) with improved resistance to pepsin and application thereof. The invention modifies key amino acid residues in the molecules of the wild aflatoxin oxidase by a protein engineering technology, and obtains the mutant aflatoxin oxidase with improved pepsin resistance by screening. The invention is used for treating yellowMutant aflatoxin oxidase (AFO) of aflatoxin (AFB 1) ^G355I/G475V ) The half-life of resistance to pepsin was 2.72 times that of wild-type AFO. Mutant AFO compared to wild type ^G355I/G475V The activity is kept above 40 percent at the temperature of 10-40 ℃; the optimum reaction pH was 7.5.

Description

Aflatoxin oxidase with improved resistance to pepsin

Technical Field

The invention relates to an aflatoxin oxidase, in particular to an aflatoxin oxidase with improved resistance to pepsin.

Background

The first internationally reported by this group of subjects in 1999 that an active substance having an aflatoxin detoxification function was purified from an edible fungus, pseudoshoesenna molitor (Armillariatalabensens), and named aflatoxin detoxification enzyme (ADTZ). Further research shows that the enzyme is an oxidoreductase and can perform oxidation reaction with structural analogs such as aflatoxin (AFB 1), so that the enzyme is named aflatoxin Oxidase (AFO). The results of the study show that AFO is able to convert AFB1 into a non-toxic product. The method has high efficiency, low toxicity, high specificity, and no environmental pollution.

Because aflatoxin has strong toxicity and good thermal stability, aflatoxin cannot be completely removed by using common physical and chemical methods, and the nutritional value of raw materials can be damaged. So the most effective method for removing aflatoxin at present is a biological enzymolysis method.

To date, research on aflatoxin detoxification enzymes has focused primarily on cloning and heterologous expression of aflatoxin detoxification genes; obtaining strains producing aflatoxin detoxification enzymes with different characteristics by a gene recombination method; the research on the degradation mechanism, the preparation and the application of the aflatoxin detoxification enzyme preparation, and the like. Searching Chinese patent library, finding out more than ten patents related to aflatoxin detoxification enzyme, and finding out or screening aflatoxin detoxification enzyme with different characteristics from different microorganism sources and coding genes thereof are as follows: CN1712526A and the like; two patents are available for obtaining mutants with different characteristics by using methods such as gene recombination and the like, and both patents are applied by the subject group, wherein the patent CN104130984A invents aflatoxin oxidase acting on the variegated aspergillon by modifying key amino acid residues at a substrate binding site of a wild-type aflatoxin oxidase; in the patent CN104611305A, a mutant with improved trypsin resistance is invented by modifying key amino acid residues at the outer layer part of the three-dimensional structure of the wild type aflatoxin detoxification enzyme; patents relating to the application of aflatoxin detoxication enzymes include CN107727722A, CN102175736A, CN101216450A, CN104152419A, CN103947847A, CN1719243A and the like. The main research on the jade aflatoxin detoxification enzyme related to the Chinese theory of science library includes revealing enzymology property, catalytic reaction mechanism, cloning and heterologous expression of enzyme gene, directional modification of enzyme, application of detoxification enzyme preparation in feed industry and the like. However, studies and patents on aflatoxin detoxification enzymes with improved pepsin resistance have not been reported so far. The resistance of the aflatoxin degrading enzyme to pepsin is prolonged in the feed additive application, the use efficiency of the enzyme can be improved, and the aflatoxin degrading enzyme has important application value.

Disclosure of Invention

The primary object of the present invention is to provide an aflatoxin oxidase enzyme having improved resistance to pepsin.

The aflatoxin oxidase with improved resistance to pepsin is a mutant aflatoxin oxidase screened by random mutation of the aflatoxin oxidase derived from edible fungi pseudoshoesenia pseudomicheli (Armillariella tabescens) with the amino acid sequence of SEQ ID NO.1, and has two amino acid substitutions, wherein the amino acid substitution is the substitution of 355 th position and 475 th position.

The invention carries out error-prone PCR on the gene (called AFO gene) of the aflatoxin oxidase. The GENBANK accession number of the gene sequence of aflatoxin oxidase obtained from the edible fungus pseudomellea tabescens is AY941095.1. The amino acid sequence of the mature protein of the enzyme is AAX53114.1 (SEQ ID NO. 1).

The mutant aflatoxin oxidase is obtained by mutation screening of the aflatoxin oxidase, and experiments show that the degradation function of the obtained mutant AFO on AFB1 is not affected, the half-life period of the obtained mutant AFO resistance to pepsin is 2.72 times that of wild type AFO, and the mutant AFO is named as AFO ^G355I/G475V 。

According to a further feature of the aflatoxin oxidase of the present invention, the amino acid substitution at position 355 is a substitution of glycine with isoleucine, and the amino acid substitution at position 475 is a substitution of glycine with valine; the amino acid sequence of the mutant aflatoxin oxidase is SEQ ID NO.2.

The mutant aflatoxin oxidase (AFO) of the invention ^G355I/G475V ) Simulated artificial gastric fluid (pH 1.2, pepsin at a concentration of 0.012mg/mL at 37 ℃), using W _AFO :W _Pepsin =50:1, and after 100min, residual mutant AFO in the solution ^G355I/G475V Specific residue of wild type AFO ^wt Has a half-life of about 87min, which is 26.35% more than that of wild-type AFO ^wt Its half-life is about 32min. Demonstration of mutant AFO ^G355I/G475V Resistance to pepsin compared to wild-type AFO ^wt It is improved. Mutant AFO ^G355I/G475V Also has some changes compared with the wild type aflatoxin oxidase. Compared with the wild type, the mutant has the optimum reaction temperature of 20 ℃ and still has more than 40 percent of activity at 10-40 ℃; the optimum reaction pH was 7.5. The pH stability of the mutant was the same as the wild type.

Further, the present invention provides a DNA molecule encoding the aflatoxin oxidase having improved resistance to pepsin of the present invention.

The nucleotide sequence of the mutant DNA molecule is SEQ ID NO.3.

Another object of the present invention is to provide a vector containing the DNA molecule of the present invention.

It is a further object of the invention to provide a host cell comprising a DNA molecule according to the invention, or comprising a vector according to the invention.

Both the above vectors and host cells can be prepared by techniques well known in the art.

The invention also provides a production method of the aflatoxin oxidase with improved resistance to pepsin, which comprises the following steps: culturing the host cell under the condition suitable for expressing the aflatoxin oxidase, and separating the aflatoxin oxidase from a culture medium.

When the DNA molecule of the present invention is inserted into the vector, or transferred into the host cell, in the proper orientation and correct reading frame, the DNA molecule can be expressed in any eukaryotic or prokaryotic expression system. Many host-vector systems can be used to express a protein coding sequence. Host-vector systems include, but are not limited to: bacteria transformed with a bacteriophage, plasmid or cosmid; microorganisms containing yeast vectors, such as yeast; mammalian cell systems infected with viruses; insect cell systems infected with viruses; plant cell systems infected with bacteria. Preferred vectors of the invention include viral vectors, plasmids, cosmids or oligonucleotides.

Preferred hosts of the invention are eukaryotic systems such as Pichia pastoris; the preferred protein expression method of the invention is pichia pastoris secretory expression.

The invention also provides application of the aflatoxin oxidase with improved resistance to pepsin, in particular application of the aflatoxin oxidase with improved resistance to pepsin in preparation of food additives or feed additives.

Drawings

FIG. 1 is an SDS-PAGE protein electrophoresis chart, in which black arrows indicate Marker 75Kd bands, and black boxes indicate the target protein, which has a size of about 75 Kd. Wherein, lane 1 is the wild aflatoxin oxidase protein culture supernatant; lane 2 is the ammonium sulfate precipitated protein from the culture supernatant of wild-type aflatoxin oxidase protein.

FIG. 2 is a wild type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V Residual protein result graphs of the protein before and after artificial gastric juice treatment; lanes 1-8 show the amount of AFO protein remaining after pepsin digestion for 0, 10, 20, 30, 40, 60, 80, 100min, respectively.

FIG. 3 is a wild-type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V Grey scale scan data results for proteins. The artificial gastric juice contains pepsin.

FIG. 4 is a wild type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V The optimum reaction temperature of (2).

FIG. 5 is a wild type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V Temperature stability of (3).

FIG. 6 is a wild type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V Optimum reaction pH of (1).

FIG. 7 is a wild type AFO according to the present invention ^wt And mutant AFO ^G355I/G475V The pH stability of (1).

Detailed Description

The terms used herein, unless otherwise specified, are intended to have the meanings commonly understood by those skilled in the art. The following provides definitions of some specific terms used in the present invention.

“AFO ^wt "indicates the wild-type aflatoxin oxidase, the gene of which is in italics" AFO ^wt "means.

“AFO ^Mut "indicates the error-prone PCR-derived gene fragment.

“pPIC3.5K-AFO ^Mut” Shows that the gene fragment obtained by error-prone PCR is connected with a vector pPIC3.5K.

“AFO ^G355I/G475V "means a selected mutant aflatoxin oxidase, the gene of which is in italics" AFO ^G355I ^/G475V "means.

Example 1: synthesis of Aflatoxin oxidase gene

The invention adopts the gene of wild aflatoxin oxidase (GenBank registration number is AY 941095.1) from Armillarialacetabescens, and is synthesized by Shanghai Czejust gene company (other commercial companies with whole gene synthesis can also complete the synthesis).

Example 2: verifying whether aflatoxin oxidase gene (AFO) is correctly obtained

1. And (3) extracting the fully-gene-synthesized pPIC3.5K plasmid containing the AFO target gene, and verifying single enzyme digestion and double enzyme digestion. The digestion conditions are shown in Table 1 below.

Table 1:

/>

2. the cleavage products were verified by electrophoresis on a 1% agarose gel.

The result shows that the recombinant plasmid is digested by Not I and Sac I to obtain two bands, namely pPIC3.5K vector of about 9000bp and target gene fragment of about 2000 bp. The recombinant plasmid is subjected to SalI single enzyme digestion to obtain a band of about 11000 bp. The sizes of the double-enzyme digestion product fragments and the single-enzyme digestion product fragments are expected, and the cloning vector contains the target gene, so that the next step of experiment can be carried out.

Example 3: error prone PCR

1. Error-prone PCR is to introduce base mismatch while amplifying target gene, resulting in random mutation of target gene.

According to the invention, pPIC3.5K-AFO is ^wt Gene sequence, error-prone PCR primers designed using Primier 6.0 software and DNA MANA compound (I) is provided.

Upstream primer (5 '-3'): CGAGCTCGATGAGATTTCCTTCAATTTTTACTGCAG

Downstream primer (5 '-3'): TTGCGGCCGCAATTAATGATGATGATGATGAC

After the design of the primers, the primers are synthesized by Shanghai Czeri bioengineering GmbH. And designing an error-prone PCR reaction system and a reaction program after the synthesis is finished.

Table 2:

table 3:

the PCR product was verified by electrophoresis on a 1% agarose gel.

The results show that: after error-prone PCR, the target gene fragment of about 2000bp can be obtained by amplification. The amplification result is expected, and the next experiment can be carried out.

PCR product recovery

After electrophoresis of the PCR product, observing a target strip on an ultraviolet projector, and cutting and recovering the gel. Using NEB DNA colloidal-back kit, the DNA fragment obtained by recovery is AFO ^Mut And storing at 4 ℃.

Example 4: construction of Pichia pastoris secretion expression vector pPIC3.5K-AFO ^Mut

1. Double enzyme digestion of AFO ^Mut And expression vector pPIC3.5K

Table 4:

double digestion of AFO according to the above system ^Mut And pPIC3.5K-AFO. After the enzyme digestion is finished, verifying the enzyme digestion product by 1 percent agarose gel electrophoresis to respectively obtain a carrier fragment which is about 9000bp and meets the expectationThe target gene fragment of about 2000bp is cut and recovered, and then the next experiment is carried out.

2. AFO after double digestion ^Mut Linked to the expression vector pPIC3.5K

The attachment system is shown in Table 5 below.

Table 5:

the ligation product was directly subjected to the next experiment after overnight ligation.

3. Transformation of E.coli DH5 alpha competent cells and validation

The overnight ligated product was transformed into E.coli competent cells DH 5. Alpha. By the following procedure:

taking out 1 tube of 100 μ L competent cells from a refrigerator at-80 deg.C, placing on ice, thawing slowly, and packaging into 2 × 50 μ L cells; adding the ligation product into the competent cells, gently blowing and beating the competent cells by using a pipettor, and uniformly mixing the competent cells and the liquid, and standing the mixture on ice for 30min; then, the mixture is heated and shocked for 90s by a metal bath at 42 ℃, and then the mixture is quickly placed on ice and cooled for 2-3min; adding the product after heat shock into LB liquid culture medium of warm bath, shaking gently and mixing uniformly, and placing in a shaking table at 37 ℃ for shake culture for 1h; centrifuging, discarding part of supernatant, resuspending the rest, and plating the bacterial suspension (plate containing aminobenzyl resistance); after the plate is placed for half an hour with the front side facing upwards, the bacterial liquid is absorbed, and the plate is inversely cultured overnight at 37 ℃.

After the transformed E.coli was cultured overnight, a single colony grew on the plate, and all the single colonies on the plate were washed off with LB liquid medium, transferred to LB liquid medium, and cultured overnight at 37 ℃ and 200 rpm. Plasmid extraction was performed on overnight-cultured broth, as described above. At this time, pPIC3.5K-AFO containing mutant gene was obtained ^Mut A plasmid.

The obtained pPIC3.5K-AFO ^Mut The plasmid was verified by digestion according to the double digestion system "example 2, step 1". After the enzyme digestion is finished, verifying the enzyme digestion product by 1 percent agarose gel electrophoresis to respectively obtain a carrier fragment which is about 9000bp and is in line with the expectation and 2 bpAbout 000bp of target gene fragment. Indicating that the secretion expression vector pPIC3.5K-AFO ^Mut The construction is successful, and the next experiment can be carried out.

4. Pichia electrotransformation GS115

In order to improve the integration efficiency of the single copy expression cassette on the Pichia pastoris chromosome, pPIC3.5K-AFO was integrated by using the restriction enzyme Sal I ^Mut Carrying out single enzyme digestion linearization, and then obtaining a stable recon carrying a target gene in a homologous recombination mode. The recipient bacterium of the experiment is Pichia pastoris GS115, after electrotransformation, an MD flat plate is used for preliminary screening, then the single clone on the MD flat plate is selected to be cultured in 2mL YPG liquid culture medium for 14-16 h, and then Pichia pastoris genome is extracted for PCR verification and further screening of positive clone recombinants.

And obtaining the positive clone recon with successful electrotransformation through MD plate screening and PCR verification. The library capacity of the mutant AFO library constructed by error-prone PCR was about 2.0X10 ⁴ 。

5. Primary screening verification of positive clone recombinants

Inoculating the positive clone recombinant successfully transformed into the YPD culture medium into a 96-deep-well plate filled with 1ml of the YPD culture medium, and culturing for 4 days at 30 ℃ and 200 rpm; after the culture is finished, centrifugation is carried out at 12000g and 4 ℃, AFO engineering yeast supernatant is collected, and an experiment is designed, and degradation of AFB1 is detected by HPLC (high performance liquid chromatography) so as to carry out preliminary screening.

Experimental groups: 200 μ L supernatant +300 μ L PBS Buffer + AFB1 (AFB 1 final concentration of 20 ng/ml)

Control group: 200 μ L supernatant +300 μ L PBS Buffer +500uL methanol + AFB1 (AFB 1 final concentration of 20 ng/ml)

Reacting the experimental group with the control group at 30 ℃, and sampling for 6h, 12h and 24h respectively for detection; the experimental group stopped the reaction with equal volume of methanol, shaken well, and then stood for 30min. Subsequently, the mixture was centrifuged at 13000rpm for 10min, and the supernatant was subjected to HPLC analysis. The temperature value was set at 35 ℃, the ultraviolet absorbance 365nm, the FLD excitation wavelength 365nm, and the FLD emission wavelength 425nm.

The degradation rate calculation formula is as follows:

and sending the positive monoclonal recombinant with the degradation rate of more than 70 percent after 24 hours of reaction to Shanghai bioengineering company Limited for sequencing. Screening a mutant AFO library, sequencing a positive monoclonal recombinant into double-point mutation, wherein the mutation sites are 355 th site and 475 th site, and naming the double-point mutation as AFO ^G355I/G475V 。

Example 5: wild type AFO ^wt And mutant AFO ^G355I/G475V SDS-PAGE electrophoretic detection of recombinant proteins

The SDS-PAGE electrophoretic detection of this example comprises the following steps:

(1) Preparing 10% of 10mL separation gel, uniformly mixing, pouring the gel into a glass plate by using a micropipette until the gel is stopped at a position 2-3 cm away from the upper edge of the short glass plate, sealing the gel surface by using distilled water, slightly lifting one end of a gel maker, putting down the gel to flatten the gel surface, polymerizing for 40min, discarding the distilled water, and absorbing the redundant water by using filter paper.

(2) Preparing 4mL of 5% concentrated glue, uniformly filling the concentrated glue on the separation glue, inserting a comb with a corresponding specification while avoiding generating bubbles, and polymerizing for 30min to be solidified by the glue.

(3) Filling the electrophoresis tank with electrophoresis liquid, transferring the gel into the electrophoresis tank, and carefully removing the comb.

(4) The samples are sequentially spotted, the spotting amount is not too large, and 15 mu L of samples per well are suitable.

(5) The 90V running gel is firstly set when electrophoresis is started, the voltage of the indicator is changed to 120V from the indicator to the concentrated gel part to continue electrophoresis, and the electrophoresis can be stopped when a target strip runs to the middle position (the target strip corresponds to a corresponding strip of Maker and can be known in advance).

(6) Carefully stripping off the gel, and after the gel is stained by Coomassie brilliant blue R-250 for 30min, decolorizing the decolorized solution until the background is lighter and the protein band is clear.

(7) The gel was imaged and the results observed. The results of SDS-PAGE protein electrophoresis are shown in FIGS. 1 and 2.

FIG. 1 is the SDS-PAGE protein electrophoresis image, the black arrow points to the Marker 75Kd band, the black square frame is the target protein, the size is about 75 Kd. Wherein, lane 1 is the wild aflatoxin oxidase protein culture supernatant; lane 2 is the ammonium sulfate precipitated protein from the culture supernatant of wild-type aflatoxin oxidase protein. The result shows that the target gene is successfully expressed in pichia pastoris GS115, and the target protein can be expanded, cultured, separated and purified so as to carry out the next experiment.

Example 6: electrophoretic detection of wild-type AFO ^wt And mutant AFO ^G355I/G475V Pepsin resistance detection of recombinant proteins

Subjecting wild AFO ^wt And mutant AFO ^G355I/G475V Digestion with Artificial gastric juice (pH 1.2, pepsin concentration 0.012mg/mL at 37 deg.C) (wild-type AFO) ^wt Proteins and mutant AFO ^G355I/G475V The addition amount of the protein is the same, and the contents of the artificial gastric juice and the enzyme protein are 1:50 proportion) at 0, 10, 20, 30, 40, 50, 60, 80, 100min respectively, taking out 20 μ l, adding 7 μ l protein electrophoresis buffer solution to stop digestion, boiling for 5min, performing SDS-PAGE electrophoresis to detect digestion effect of pepsin, performing gray scanning on SDS-PAGE electrophoresis protein band to detect residual protein amount, and calculating wild type AFO ^wt And mutant AFO ^G355I/G475V The enzyme half-life of the protein before and after pepsin treatment.

The results are shown in FIGS. 2 and 3: the mutant aflatoxin oxidase (AFO) provided by the invention ^G355I/G475V ) After digestion with simulated artificial gastric juice (pH 1.2, pepsin at a concentration of 0.012mg/mL at 37 ℃) for 100 minutes, the mutant AFO remained in the solution ^G355I/G475V Specific residue of wild type AFO ^wt Has a half-life of about 87min, which is 26.35% more than that of wild-type AFO ^wt The half-life period is about 32min ^{K254Q/G355I/G475V} The half-life of (A) is prolonged by 2.72 times compared with the wild type. Thus showing the mutant AFO ^G355I/G475V Resistance to pepsin compared to wild-type AFO ^wt It is improved.

Example 8: wild type AFO ^wt And mutant AFO ^G355I/G475V Enzymatic Properties of recombinant proteinsAnalysis of

1. Enzyme activity assay

AFO at room temperature under reaction conditions of pH =7.4 ^wt And AFO ^G355I/G475V AFB1 is used as a hydrolysis substrate to react, and the decrease of the substrate is expressed by detecting the change of the peak area of the AFB1 through HPLC, so that the enzyme activity of AFO is characterized. The reaction system is shown in Table 6.

Table 6:

components of the System	Volume (ul)
		Substrate AFB1 (1 ug/mL)	2.5
AFO(2mg/mL)	25
		Low salt buffer (PBS and NaCl)	222.5
Total volume	250

The reaction is carried out for 30min at room temperature, 250 mu L of methanol is added, and the mixture is shaken and mixed evenly to stop the reaction. After the reaction was terminated, the reaction system was centrifuged at 13000rpm for 10min in a centrifuge, and 20. Mu.L of the supernatant was subjected to HPLC. The temperature value was set at 35 ℃, the ultraviolet absorbance 365nm, the FLD excitation wavelength 365nm, and the FLD emission wavelength 425nm.

AFB1 enzyme activity unit definition: one unit (U) is defined as the amount of enzyme required to degrade 1pmol AFB1 per minute at room temperature, pH = 7.4. The calculation formula of the enzyme activity (U/mg) is as follows:

XD-enzyme activity in U/mg

C0-AFB 1 concentration in ng/ml of sample control group

C-AFB 1 concentration in ng/ml of sample reaction group

Volume of A-reaction System in ul

T-reaction time in min

m-protein content of the sample in mg

Molar mass of M-AFB1, M =312.3g/mol

2. Optimum reaction temperature and temperature stability analysis

Optimum reaction temperature: AFO obtained after purification ^wt And AFO ^G355I/G475V The enzyme activity of the protein was measured at different temperatures (10 ℃,20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃) according to the method of "step 1 of example 8", and the relative enzyme activities at the other five temperatures were calculated with the highest enzyme activity being 100%.

Temperature stability: AFO obtained after purification ^wt And AFO ^G355I/G475V After incubating the protein at different temperatures (10 ℃,20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃) for 30min, the enzyme activity was determined according to the method of "example 8, step 1", and the relative enzyme activities at the other five temperatures were calculated with the highest enzyme activity being 100%.

As shown in FIG. 4, wild-type AFO ^wt The optimum reaction temperature of (2) was 30 ℃ and the mutant AFO ^G355I/G475V The optimum reaction temperature of (2) is 20 ℃; as shown in FIG. 5, wild-type AFO ^wt The mutant AFO can keep more than 80 percent of enzyme activity at 10-40 DEG C ^G355I ^/G475V Can keep relative stability at 10-40 ℃.

3. Analysis of optimum reaction pH and pH stability

Optimum reaction pH: AFO obtained after purification ^wt And AFO ^G355I/G475V Proteins were in low salt buffers (PBS and NaCl) at different pH (5, 6, 6.5, 7, 7.5, 8)The enzyme activity was measured according to the method of "step 1 of example 8", and the relative enzyme activities at the other four pHs were calculated with the highest enzyme activity as 100%.

Analysis of pH stability: AFO obtained after purification ^wt And AFO ^G355I/G475V After incubation of the protein in low salt buffer (PBS and Nacl) at different pH (5, 6, 6.5, 7, 7.5, 8) for 30min at 30 ℃, the enzyme activity was determined according to the method of "example 8 step 1", and the relative enzyme activities at the other four pH were calculated with the highest enzyme activity being 100%.

As shown in FIG. 6, wild-type AFO ^wt The optimum reaction pH of (1) is 7, mutant AFO ^G355I/G475V The optimum reaction pH of (3) is 7.5, the activity is inhibited in an acidic environment, and the enzyme activity is increased along with the increase of the pH. As shown in FIG. 7, wild-type AFO ^wt And mutant AFO ^G355I/G475V All showed good stability in the range of pH 7.0-8.0.

The combination of the two experiments shows that the mutant AFO ^G355I/G475V Compared with the wild type aflatoxin oxidase, the other enzymological properties of the aflatoxin oxidase are changed.

Claims

1. An aflatoxin oxidase having improved resistance to pepsin, characterized in that: the mutant aflatoxin oxidase is screened by aflatoxin oxidase derived from edible fungi pseudomichelia compacta (Armillarialacetalcosens) with an amino acid sequence of SEQ ID NO.1 through random mutation, and has two amino acid substitutions, wherein the amino acid substitutions are 355 th substitution and 475 th substitution.

2. The aflatoxin oxidase enzyme of claim 1 which has increased resistance to pepsin, which is characterized by: said amino acid substitution at position 355 is a substitution of glycine with isoleucine and said amino acid substitution at position 475 is a substitution of glycine with valine; the amino acid sequence of the mutant aflatoxin oxidase is SEQ ID NO.2.

3. A DNA molecule characterized by: which encodes the aflatoxin oxidase enzyme of claim 2 having increased resistance to pepsin.

4. The DNA molecule of claim 3, wherein: the nucleotide sequence is SEQ ID NO.3.

5. A carrier, characterized by: comprising the DNA molecule of claim 3 or 4.

6. A host cell, characterized in that: comprising the DNA molecule of claim 3 or 4, or comprising the vector of claim 5.

7. A method of producing an aflatoxin oxidase enzyme having increased resistance to pepsin in accordance with claim 1, which comprises: culturing the host cell of claim 6 under conditions suitable for expression of the aflatoxin oxidase and isolating the aflatoxin oxidase from the culture medium.

8. Use of an aflatoxin oxidase having increased resistance to pepsin as claimed in claim 1 in the preparation of a food or feed additive.