CN115838820A - SNP molecular marker for identifying fructus aurantii germplasm resources and application thereof - Google Patents

Abstract

The invention discloses a set of SNP molecular markers for identifying the germplasm resources of fructus aurantii, which consists of 4 SNP markers, wherein the physical positions of the SNP markers are determined based on a shaddock reference genome sequence, and the genome version number of the shaddock reference genome sequence in NCBI is as follows: ASM200692v1. Also discloses a Primer combination and a kit for amplifying the SNP molecular marker, which comprise a specific Primer X, a Primer Y and a universal Primer C. Also discloses application of the compounds and a method for identifying or assisting in identifying the varieties of the bitter oranges. The invention utilizes the molecular marker designed based on the KASP reaction principle and the single base difference of the bitter orange material, can carry out high-flux SNP analysis and detection and rapid identification of germplasm resources on 4 parts of bitter orange materials, has high result accuracy and good stability, and can obviously improve the identification efficiency of the germplasm resources of the bitter orange.

Description

SNP molecular marker for identifying fructus aurantii germplasm resources and application thereof

Technical Field

The invention relates to the technical field of plant germplasm resource identification, relates to the germplasm resource identification of fructus aurantii, and particularly relates to a set of SNP molecular markers for the germplasm resource identification of fructus aurantii and application thereof.

Background

Fructus Aurantii is dried immature fruit of Citrus aurantium L of Citrus of Rutaceae, and has effects of regulating qi-flowing, relieving epigastric distention, activating stagnancy, relieving flatulence, eliminating phlegm, etc. The bitter orange is continuously selected to generate a plurality of cultivated varieties in the long-term artificial cultivation process, and the traditional medicinal material variety identification mainly depends on appearance morphological characteristics and is very easily influenced by environmental factors, so that the medicinal material market often has the phenomena of mixed good and bad varieties, disordered varieties and uneven quality. Therefore, an economic, efficient and accurate germplasm resource identification method is found, and the method has important significance for improving the management efficiency and the protection capability of the germplasm resources of the fructus aurantii and the quality of medicinal materials.

With the development of molecular biology, the appearance of molecular marker technology provides a new means for germplasm resource identification. The molecular marker technology has the advantages of short detection period, no environmental influence, capability of performing high-throughput test analysis and the like, and is widely applied to the aspects of variety authenticity identification, seed purity identification and the like. The international plant new variety protection alliance (UPOV) issued a guide for DNA molecular marker selection and database construction (BMT guide for short) in 2010, indicating that SSR and SNP markers are particularly suitable methods for variety identification. The SSR marker has the advantages of high polymorphism, codominance, simple experimental procedure, good result repeatability and the like, and is widely applied to crop variety identification. However, the method for identifying the variety by using the SSR marker has the defects of limited SSR marker quantity, few detection sites, certain mutation rate of the SSR sites, sensitivity to mutation reaction and the like, and the problems can be overcome by using a fingerprint library constructed by using the SNP marker. Compared with the traditional SSR marker, the SNP marker has the characteristics of large quantity, wide distribution, high stability and easy realization of rapid high-throughput typing. Common SNP detection methods include DNA chip-based techniques, sequencing, and competitive allele-specific PCR. The DNA chip technology is the most common method for detecting SNP, but the chip development and detection cost of the method is higher.

The KASP (competitive Allele Specific PCR) technique, which is based on the Specific matching of the terminal bases of primers to type SNPs, has high stability and accuracy. The kit is suitable for rapid detection of multiple samples and few sites, has the characteristics of high efficiency, flexibility, accuracy and low cost, and researchers at home and abroad have utilized the KASP technology to respectively construct core marker systems of crops such as wheat, corn, rice, cotton, cabbage, cucumber and the like, thereby providing convenience for germplasm resource identification, germplasm resource protection and the like of corresponding crops. The method can greatly improve the identification efficiency by developing the SNP marker based on the KASP technology to identify the germplasm resources.

Disclosure of Invention

One of the purposes of the invention is to provide a set of SNP molecular markers for identifying the germplasm resources of fructus aurantii, and based on the core SNP markers, high-throughput SNP typing detection on the germplasm resources of fructus aurantii can be realized.

The invention relates to a set of SNP molecular markers for identifying bitter orange germplasm resources, which is developed based on KASP technology and consists of 4 SNP markers, wherein the specific information of the SNP markers is as follows:

mark number	Chromosome	Physical location of SNP	Allelic form
				Ci900011	chr01	22550627	[T/A]
Ci900021	chr02	39351254	[C/T]
				Ci900025	chr06	8158400	[A/T]
Ci900018	chr08	5774144	[A/G]

The physical location of the SNP marker is determined based on a grapefruit reference genomic sequence, the genomic version number of the grapefruit reference genomic sequence in NCBI: NCBI Genome assembly ASM200692v1.

The fructus Aurantii germplasm resources are green-coated fructus Aurantii, fructus Citri Junoris, and bitter citrus immature flower.

The orange is grafted by taking green-coated bitter oranges as rootstocks, and the common orange is grafted by taking green-coated bitter oranges as rootstocks; preferably, the green-coating bitter orange, the fragrant orange, the common orange and the bitter orange substitute flower are all bitter orange germplasm resource materials in the Jiangxi area.

It is still another object of the present invention to provide a set of Primer combinations for amplifying SNP molecular markers according to any one of the above, comprising specific Primer X, primer Y and universal Primer C; wherein the content of the first and second substances,

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900011 are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900021 are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900025 are respectively shown as SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO. 13;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900018 are shown as SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, respectively.

Still another object of the present invention is to provide a kit for identifying or assisting in identifying fructus aurantii germplasm resources, wherein the kit comprises the primer combination.

In the technical scheme of the kit, the 5' ends of specific primers Primer X and Primer Y in each group of primers are respectively provided with a fluorescent label A sequence and a fluorescent label B sequence, and the nucleotide sequences of the fluorescent label A sequence and the fluorescent label B sequence are different from each other and are different from the bitter orange genome sequence;

preferably, the sequence of the fluorescent label A is a FAM fluorescent label sequence, and the sequence of the fluorescent label B is a HEX fluorescent label sequence.

Still another object of the present invention is to provide an application of the SNP molecular marker described above or the primer combination described above or the kit described above in identification or assisted identification of fructus aurantii germplasm resources, or in genotyping of fructus aurantii germplasm resources.

The invention finally aims to provide a method for identifying or assisting in identifying the germplasm resources of fructus aurantii, which is used for carrying out SNP typing detection on a to-be-detected fructus aurantii sample and comprises the following steps:

(1) Extracting the genome DNA of the bitter orange sample to be detected;

(2) And (2) carrying out SNP polymorphism detection on the genomic DNA extracted in the step (1) by adopting the primer combination or the kit, and judging whether the sample of the bitter orange to be detected is one of the 4 bitter orange germplasm resources according to a genotype detection result.

In the above technical scheme, in the step (2), each group of primers in the primer combination is adopted to perform KASP amplification on genomic DNA of a sample of fructus aurantii to be detected, a fluorescence detector detects a PCR product, a genotype of a variety of fructus aurantii to be detected at an SNP molecular marker site corresponding to each group of primers is determined, and a detection result is compared with the genotypes of the 4 fructus aurantii germplasm resources, so as to determine whether the sample of fructus aurantii to be detected is one of the 4 fructus aurantii germplasm resources.

The reaction system of the KASP amplified PCR is 0.8 mu l: 20ng-50ng of sample DNA, 0.0013. Mu.l of each of two specific primers with concentration of 100. Mu.M, 0.0033. Mu.l of universal primer with concentration of 100. Mu.M, 2 XKASP Master Mix 0.3945. Mu.l and 0.3996. Mu.l of ultrapure water;

the reaction conditions of the PCR are as follows: pre-denaturation at 94 ℃ for 15min; the first step of amplification reaction, denaturation at 94 ℃ for 20s, annealing at 65-57 ℃ and extension for 60s for 10 cycles, wherein the annealing and extension temperature in each cycle is reduced by 0.8 ℃; the second amplification reaction, denaturation at 94 ℃ for 20s, annealing at 57 ℃ and extension for 60s, for 30 cycles.

The invention has the beneficial effects that:

by utilizing the molecular marker designed based on the KASP reaction principle and the single base difference of the bitter orange material, the high-throughput SNP analysis and detection and the rapid identification of germplasm resources can be carried out on 4 parts of bitter orange materials, the result accuracy is high, the stability is good, and the identification efficiency of the germplasm resources of the bitter orange can be obviously improved.

Drawings

FIG. 1 is a flow chart of an experiment according to an embodiment of the present invention.

FIG. 2 is a graph of the typing of marker Ci900011 in 4 material samples, where the red dots are homozygous TT genotypes; the blue dots are homozygous AA genotypes; the purple dots are heterozygous genotype TA.

FIG. 3 is a plot of the typing of marker Ci900021 in 4 material lots, with the red dots indicating the homozygous CC genotype; the blue dots are homozygous TT genotypes; purple dots are heterozygous genotype CT.

FIG. 4 is a plot of the genotype of marker Ci900025 in 4 material lots, with the red dots indicating the homozygous AA genotype; the blue dots are homozygous TT genotypes; purple dots are heterozygous genotype ATs.

FIG. 5 is a plot of the genotype of marker Ci900018 in 4 material samples, where the red dots are homozygous AA genotypes; the blue dots are homozygous GG genotypes; the purple dots are heterozygous genotypes AG.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to be limiting.

The reagents used in the following examples, unless otherwise specified, are all conventional in the art and are commercially available. The experimental conditions not specifically described are those conventional in the art, and may be referred to in the Molecular cloning handbook (Sambrook J & Russell DW, molecular cloning: a laboratory Manual, 2001), or according to the manufacturer's instructions.

The experimental flow of the embodiment of the invention is shown in figure 1.

Experimental Material

Table 1 shows the germplasm resources of 4 copies of fructus aurantii used for SNP site screening and the sources thereof. The common odor orange and the fragrant orange are special products in Xingan county in Jiangxi province, are called Jiang Zhike, and are geographical sign protection products in China.

TABLE 1 Experimental materials

/>

* Note: the orange and orange grafting seedling is a grafted seedling directly purchased from an orange base.

Example 1 core SNP marker screening and amplification primer design

And (3) performing genome sequencing on 4 Jiangxi province fructus aurantii germplasm resources of the table 1 to obtain resequencing data. Because the bitter orange has no reference Genome at present, the original plant of the bitter orange is sour orange, and the pomelo and the broad-peel orange are the original parents according to the present report, the variation search and the SNP site screening are carried out by referring to the reference Genome of the pomelo (Citrus maxima) (the Genome version number is NCBI Genome assembly ASM200692v 1), and the core SNP site confirmation is carried out based on the genotype results of 4 parts of bitter orange germplasm resources.

Screening and determination of core SNP sites: and (3) comparing the 4 parts of fructus aurantii germplasm resource data which are subjected to resequencing with a grapefruit reference genome sequence to obtain SNP loci. SNP sites are screened according to the following screening criteria: (1) the average sequencing depth is greater than 10X; (2) no deletion of the locus; (3) minimum Allele Frequency (MAF) between 0.1-0.5; (4) the heterozygosity rate is less than the average heterozygosity rate; (5) a single copy site; screening 9 SNP sites with better polymorphism and evenly distributed on a chromosome, and converting the SNP sites into KASP markers. Carrying out genotyping on 4 parts of fructus aurantii germplasm resources by using a KASP platform, and carrying out screening analysis on each locus to remove the loci which do not meet the requirements; finally, 4 core SNP sites with high polymorphic information content and ideal typing effect are obtained by screening, the related information is shown in Table 2, the average heterozygosity rate is 0.188, the average Minimum Allele Frequency (MAF) is 0.219, and the average Polymorphic Information Content (PIC) is 0.242.

The core SNP markers developed by the invention are distributed on No.1, no. 2, no.6 and No.8 chromosomes of a genome, and one SNP marker is respectively arranged on each of the four chromosomes to total 4 SNP markers.

Table 2 core SNP marker for identifying 4 Jiangxi fructus aurantii germplasm resources

Mark number	Chromosome	Physical location of SNP	Allelic form
				Ci900011	chr01	22550627	[T/A]
Ci900021	chr02	39351254	[C/T]
				Ci900025	chr06	8158400	[A/T]
Ci900018	chr08	5774144	[A/G]

The 4 SNP sites screened out are converted into KASP markers. 100bp flanking sequences (the sequence information is shown in a table 3) before and after 4 core SNP sites are extracted, a BatchPrimer3 (http:// probes. Pw. Usda. Gov/BatchPrimer3 /) primer design website is used for carrying out primer design on the flanking sequences, and SNP sites at other positions in the sequences are replaced by degenerate bases. Each labeled amplification Primer consisted of 3 primers, including two allele-specific primers Primer X and Primer Y and one universal Primer C, with the Primer sequences shown in Table 4. The 5' ends of 2 specific primers were ligated to sequence tags suitable for KASP Master mix of LGC, UK, specifically, FAM and HEX fluorescent linker sequences of KASP reaction reagent of LGC, UK, and the primers were synthesized by Invitrogen. In the Primer synthesis, the 5 'end of all gene-specific primers Primer X is connected with FAM fluorescent linker sequence (GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 17), and the 5' end of Primer Y is connected with HEX fluorescent linker sequence (GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 18).

If only FAM fluorescence is detected in the sample, the genotype of the sample is homozygous Allele X (AlleX); if only HEX fluorescence is detected, the genotype of the sample is homozygous Allele Y (Alley _ Y); if FAM and HEX fluorescence is detected simultaneously, the genotype of the sample is heterozygous (with both alleles X and Y).

TABLE 3.4 sequence information of core SNP markers

/>

TABLE 4 primer sequences for amplifying SNP markers

Example 2 KASP primer validation of SNP molecular markers

Genotyping was performed on 4 bitter orange germplasm resources shown in table 1 using KASP platform.

1. Extraction of genomic DNA from test Material

Extracting genome DNA from leaves of fructus Aurantii by simplified CTAB method.

(1) Taking about 30mg leaves to 1.3ml 96-well plate, placing in a freeze dryer, and vacuumizing for 12h or more;

(2) after the vacuum pumping is finished, adding two steel balls into each hole by using a ball separator, covering a silica gel film, grinding for 1min in a high-flux grinder, instantly separating in a deep-hole plate centrifuge after grinding, and centrifuging the ground tissues to the bottom of the hole;

(3) adding 700 μ l CTAB extract into each well with a pipetting workstation TECAN, shaking, mixing, placing in a 65 deg.C water bath kettle, warm-bathing for 1-1.5h, and taking 1.3ml 96-well plate out of the vortex oscillator every 20min, and oscillating for several times;

(4) taking out a 1.3ml 96-pore plate after the warm bath is finished, placing the plate in a deep-pore plate refrigerated centrifuge, and centrifuging for 10min at 4000 rpm;

(5) transferring 380 mu l of supernatant per well to a new 1.3ml 96-well plate by using a pipetting workstation TECAN, adding equal volume of chloroform, standing for 2min after reversing and mixing uniformly, placing in a deep-well plate refrigerated centrifuge, and centrifuging at 4000rpm for 10min;

(6) after centrifugation, using a liquid transfer workstation TECAN to extract 250 mu l of supernatant into a 0.8ml 96-hole plate which is added with 250 mu l of isopropanol in advance, oscillating and mixing uniformly in a vortex, and putting the plate into a refrigerator at the temperature of 20 ℃ below zero for precipitation for 1h or more;

(7) taking out 0.8ml 96-hole plate, placing in a deep-hole plate refrigerated centrifuge, centrifuging at 4000rpm for 15min;

(8) discarding the supernatant, adding 250 μ l 70% ethanol into each well with a pipetting workstation TECAN, oscillating several times on a vortex oscillator at 5000rpm, and centrifuging for 15min;

(9) discarding the supernatant, and drying in a 65 ℃ oven for 30 min;

add 200. Mu.l sterilized ultrapure water to each well of the red well, and dissolve overnight at room temperature for use.

2. Genotyping Using the KASP technique

The KASP assay of 4 bitter orange materials of table 1 was verified with 4 markers (Ci 900011, ci900021, ci900025 and Ci 900018). The DNA extracted in the above steps is used as a template, each group of primer mixed solution and PCR premixed solution in the SNP primer combination in the experimental group 1 are added, and a Douglas Arraytape genotyping platform is adopted to automatically assemble a PCR amplification system, wherein the PCR amplification system is shown in the following table 5. Reagents and consumables for the Douglas Arraytape genotyping platform used in the present invention were purchased from LGC, inc. in the United kingdom.

TABLE 5 KASP detection reaction System

	Final concentration	The actual amount of the composition
			100μM Primer C	0.42μM	0.0033μl
100μM Primer X	0.17μM	0.0013μl
			100μM Primer Y	0.17μM	0.0013μl
2×KASP Master Mix	1×	0.3945μl
			Ultra-pure water		0.3996μl
DNA (Dry)		20ng-50ng
			Total volume		0.8μl

PCR amplification is completed in a water bath thermal cycler, and the Touchdown PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 15min; the first step of amplification reaction, denaturation at 94 ℃ for 20s, annealing at 65-57 ℃ and extension for 60s for 10 cycles, wherein the annealing and extension temperature in each cycle is reduced by 0.8 ℃; the second amplification reaction, denaturation at 94 ℃ for 20s, annealing at 57 ℃ and extension for 60s, was performed for 30 cycles. And after the reaction is finished, the fluorescence data of the KASP reaction product is read by utilizing an Arraytape scanning system, and the result of the fluorescence scanning is automatically converted into a graph. And judging the genotype of the SNP marker locus corresponding to the primer combination of the fructus aurantii germplasm resource to be detected according to the color of the fluorescent signal. In SNP molecular marker genotyping assays, the genotype of a sample is divided into 3 clusters, namely the X cluster (red), the Y cluster (blue), and the heterozygous genotype cluster (purple).

The typing results are shown in table 6, the typing graphs are shown in fig. 2-fig. 5, and the results show that the combination of the four marking typing results of Ci900011, ci900021, ci900025 and Ci900018 can realize the differentiation of the germplasm resources of 4 Jiangxi fructus aurantii.

TABLE 6.4 results of marker typing

Example 3

In order to test the specificity and practicability of the 4 SNP markers of the invention, 9 portions of samples of bitter orange to be tested containing 4 germplasm resources of Table 1 were subjected to KASP reaction typing according to the detection method of example 2.

The genotype detection results are shown in table 7, wherein the genotypes of green-coated fructus aurantii (south city of the west), orange (orange grafted in camphor tree city of the west), fructus aurantii (orange grafted in camphor tree city of the west), and citrus aurantium (citrus aurantium grafted in camphor tree city of the west) (Pei Meizhen citrus aurantium in ten thousand counties of the west) are different from those of other fructus aurantii samples, and the genotypes of 4 germplasm resources also have specificity. The result shows that the 4 SNP markers are accurate in typing, and can be used for rapid high-throughput identification of 4 germplasm resources of green-coated fructus aurantii (south city of Jiangxi), fragrant oranges (grafted fragrant oranges in camphor tree city of Jiangxi), and surrogates (Pei Meizhen surrogates in Wannian county of Jiangxi).

TABLE 7.9 typing results of 4 markers for Citrus aurantium fruit material

* Note: the grafted seedling is a seedling which is directly purchased from a bitter orange base and is grafted.

The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

/>

/>

/>

/>

Claims (10)

1. A set of SNP molecular markers for identifying fructus aurantii germplasm resources is characterized in that: the kit consists of 4 SNP markers, and the specific information of the SNP markers is as follows:

mark number Chromosome Physical location of SNP Allelic form Ci900011 chr01 22550627 [T/A] Ci900021 chr02 39351254 [C/T] Ci900025 chr06 8158400 [A/T] Ci900018 chr08 5774144 [A/G]

The physical location of the SNP marker is determined based on a grapefruit reference genomic sequence, the genomic version number of the grapefruit reference genomic sequence in NCBI: NCBI Genome assembly ASM200692v1.

2. The SNP molecular marker for identifying germplasm resources of fructus aurantii according to claim 1, wherein: the fructus Aurantii germplasm resources are green-coated fructus Aurantii, fructus Citri Junoris, and bitter Citrus aurantium.

3. The SNP molecular marker for identifying germplasm resources of fructus aurantii according to claim 2, wherein: the orange is a fragrant orange grafted by taking green-coated bitter orange as a stock, and the common orange is a common orange grafted by taking green-coated bitter orange as a stock; preferably, the green-coating bitter orange, the fragrant orange, the common orange and the bitter orange substitute flower are all bitter orange germplasm resource materials in the Jiangxi area.

4. Primer combination for amplifying a SNP molecular marker according to any one of claims 1 to 3, characterised in that: comprises specific primers X, primer Y and a universal Primer C; wherein the content of the first and second substances,

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900011 are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900021 are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900025 are respectively shown as SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO. 13;

the nucleotide sequences of Primer X, primer Y and Primer C in the Primer group for amplifying the SNP marker Ci900018 are shown as SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, respectively.

5. A kit for identifying or assisting in identifying a germplasm resource of fructus aurantii, wherein the kit comprises the primer combination of claim 4.

6. The kit according to claim 4, wherein 5' ends of specific primers Primer X and Primer Y in each set of primers carry a fluorescent tag A sequence and a fluorescent tag B sequence, respectively, the nucleotide sequences of the fluorescent tag A sequence and the fluorescent tag B sequence are different from each other and are different from the bitter orange genome sequence;

preferably, the sequence of the fluorescent label A is a FAM fluorescent label sequence, and the sequence of the fluorescent label B is a HEX fluorescent label sequence.

7. Use of a SNP molecular marker as claimed in any one of claims 1 to 3 or a primer combination as claimed in claim 4 or a kit as claimed in claim 5 or 6 in identifying or assisting in identifying or genotyping a germplasm resource of citrus aurantium.

8. A method for identifying or assisting in identifying a germplasm resource of a fruit of trifoliate orange, characterized by: carrying out SNP typing detection on a sample of fructus aurantii to be detected, comprising the following steps:

(1) Extracting the genome DNA of the bitter orange sample to be detected;

(2) Carrying out SNP polymorphism detection on the genomic DNA extracted in the step (1) by adopting the primer combination as claimed in claim 3 or the kit as claimed in claim 5 or 6, and judging whether the sample of the bitter orange to be detected is one of the 4 parts of bitter orange germplasm resources as claimed in claim 2 or 3 according to the genotype detection result.

9. The method of claim 8, wherein: in the step (2), each group of primers in the primer combination of claim 3 is adopted to perform KASP amplification on the genomic DNA of the sample of fructus Aurantii to be detected, a fluorescence detector is used for detecting PCR products, the genotype of the variety of fructus Aurantii to be detected at the SNP molecular marker site corresponding to each group of primers is determined, and the detection result is compared with the genotype of the germplasm resources of 4 parts of fructus Aurantii described in claim 2 or 3, so as to judge whether the sample of fructus Aurantii to be detected is one of the germplasm resources of 4 parts of fructus Aurantii described in claim 2 or 3.

10. The method of claim 9, wherein:

the reaction system of the KASP amplified PCR is 0.8 mu l: 20ng-50ng of sample DNA, 0.0013. Mu.l of each of two specific primers with concentration of 100. Mu.M, 0.0033. Mu.l of universal primer with concentration of 100. Mu.M, 2 XKASP Master Mix 0.3945. Mu.l and 0.3996. Mu.l of ultrapure water;

the reaction conditions of the PCR are as follows: pre-denaturation at 94 ℃ for 15min; the first step of amplification reaction, denaturation at 94 ℃ for 20s, annealing at 65-57 ℃ and extension for 60s for 10 cycles, wherein the annealing and extension temperature in each cycle is reduced by 0.8 ℃; the second amplification reaction, denaturation at 94 ℃ for 20s, annealing at 57 ℃ and extension for 60s, for 30 cycles.

Images