CN115820846A - Thyroid cancer related gene mutation and methylation detection composition and application thereof - Google Patents

Abstract

The invention provides a thyroid cancer related gene mutation and methylation detection composition and application thereof. Through research, BRAF ^V600E The combination of mutation and RASSF1A methylation detection has high clinical guiding significance in the diagnosis of thyroid cancer, and provides reference basis for the diagnosis of thyroid cancer.

Description

Thyroid cancer related gene mutation and methylation detection composition and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a thyroid cancer related gene mutation and methylation detection composition and application thereof.

Background

Thyroid cancer is the fastest growing tumor worldwide. The incidence of thyroid nodules is high, and the most clinically problematic issue is how to distinguish between benign and malignant nodules. Common procedures include thyrosonography, fine needle puncture (FNA) and intraoperative cryosectioning. Intraoperative cryosectioning has long been an important means to determine the benign and malignant nature of thyroid nodules on the basis of ultrasound, but the malignant lesions in surgically excised thyroid nodules account for only 14%. Along with the popularization of FNA in recent years, the proportion of malignant lesions cut by operation is increased to more than 50%. In the FNA specimen, benign nodules account for 72%, malignancy accounts for 5%, and 17% of lesions cannot be determined to be benign or malignant, while 34% of postoperative paraffin proves to be malignant, which is not negligible. Therefore, it is attempted to search for further evidence by molecular means to improve the diagnostic rate of thyroid cancer. The main pathological types of thyroid cancer include papillary carcinoma, follicular carcinoma, poorly differentiated carcinoma, undifferentiated/anaplastic carcinoma and medullary carcinoma, the first three of which belong to differentiated thyroid carcinoma, in which papillary carcinoma and follicular carcinoma are also called well-differentiated carcinoma. More than 90% of thyroid cancer belongs to high-differentiation cancer, has an inert clinical expression, can be cured by surgical excision, has good prognosis even if regional lymph node metastasis exists, and belongs to a low-recurrence risk factor. Some subtypes of high-differentiation cancer (including high cell type, columnar cell type, diffuse sclerosis type, spike subtype and extensive infiltration type of follicular cancer) present clinical invasive processes and have high recurrence rate, are called high-differentiation cancer invasive subtypes, have worse prognosis than common high-differentiation cancer, but are better than low-differentiation cancer, and belong to moderate recurrence risk factors. Undifferentiated carcinoma is rare and is the thyroid carcinoma with the highest malignancy, the median survival period is less than 6 months, even if the carcinoma appears focally, the prognosis is poor, and the T4 stage is directly classified by TNM stages. The clinical and biological behavior of poorly differentiated cancers is intermediate between that of highly differentiated and undifferentiated cancers. In the aspects of identification of different biological behaviors of thyroid and prognosis judgment, the traditional morphological and pathological indexes have limited action.

The molecular pathogenesis of thyroid cancer comprises multiple aspects such as abnormal activation of signal transduction pathways, gene mutation, gene amplification, gene translocation, epigenetic (methylation) change and the like, and is a multi-gene involved and multi-step cancerization process. The gene mutation and the methylation epigenetic change are two important risk factors of the occurrence of the thyroid cancer, and have important influence on the occurrence, the development and the prognosis of the thyroid cancer.

The method has important values for thyroid cancer preoperative evaluation, recurrence risk stratification, clinical diagnosis and pathological diagnosis. The Chinese Society of Clinical Oncology (CSCO) expert Committee for thyroid cancer (hereinafter referred to as expert group) emphasized that genetic testing is in the CSCO differentiation type thyroid cancer diagnosis and treatment guideline (2021 edition)The important components of pathological diagnosis have indispensable meanings. Before the operation, molecular marker detection is carried out on the FNA sample, so that the diagnosis rate of thyroid cancer can be improved, and a reference basis is provided for the formulation of an operation scheme. Papillary carcinoma (PTC) and follicular carcinoma (FTC) derived from thyroid follicular epithelial cells are the most common primary thyroid cancer subtypes, accounting for approximately 85% -90% and 5-10%, respectively. BRAF ^V600E Mutations are common in papillary thyroid carcinomas with a mutation rate of around 40%, but less than 10% in follicular carcinomas. The RAS gene-encoded 3 subtype mutations of KRAS, NRAS, and HRAS can all occur in thyroid cancer, with an overall mutation rate of RAS of 5.3%, but 10.5-56.9% in thyroid follicular cancer, which is significantly higher than that in papillary cancer. KRAS, NRAS, HRAS, have mutation frequencies of 0.3%, 3.4% and 1.9% in benign or normal populations and cannot be used as an independent diagnostic indicator for thyroid cancer. There are more than 10 RET/PTC rearrangements, the most common being RET/PTC1 and RET/PTC3. The incidence of RET/PTC rearrangements in emanating PTC is 15% -20%, and RET/PTC rearrangements are one of the markers of PTC diagnosis. It is noted, however, that RET/PTC rearrangements may also occur in benign lesions, such as Hashimoto's thyroiditis. TERT promoter mutations in thyroid cancer are at a frequency of between 4.2-25.5% in papillary carcinomas and slightly higher at 5.9-36.4% in follicular carcinomas. Medullary Thyroid Carcinoma (MTC) is a highly malignant tumor, accounting for approximately 5% of all thyroid cancers. It is mainly sporadic, and only 20-30% of them are hereditary. RET proto-oncogene mutation has been used as a susceptibility gene of genotype MTC, and related gene screening can provide a diagnostic basis for preventive thyroidectomy. However, in sporadic MTC, genetic mutations and molecular changes have not been fully established. Genes such as BRAF, RAS, RET, PAX8, PPARG, TERT promoter, TP53 and the like are all involved in the occurrence and development of thyroid cancer. This means that only multigenic mutations are present to determine or suggest high aggressiveness for thyroid cancer, and medium to large combinatorial multigenic testing is necessary to cover a higher proportion of thyroid cancer diagnoses. At present, the scientific research reagent comprises mutation and rearrangement of a plurality of genes and is applied to diagnosis of thyroid cancer, but the cost of detection is based on the heavy burden of the expense of patients, and the reagent is very unfavorable to the condition thatIs widely applied in a large scale.

With the continuous understanding of DNA methylation, the idea of using DNA methylation as an early diagnostic marker of thyroid cancer has also emerged. Domestic and foreign researches show that thyroid tumors are related to PTEN, TIMP3, DAPK, p53, p16, RAR beta 2 and other gene methylation, but the research results are not comprehensive and have contradictory places.

On one hand, more efficient thyroid cancer diagnosis indexes such as methylation indexes are urgently needed in clinic, the sensitivity is high, the cancer specificity is good, meanwhile, the detection method is simple, convenient and feasible, the detection result is visual and clear, on the other hand, the detection cost of a plurality of indexes is high, the economic burden of vast patients is increased, and the efficient and simple small combined detection is urgently needed in clinic, so that the diagnosis and treatment mode which can be accepted by the vast patients is provided.

Disclosure of Invention

In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a combined detection composition for thyroid cancer-related gene mutation and methylation and the use thereof, which is used for solving the problem of the lack of effective and simple means for thyroid cancer detection in the prior art.

An aspect of the present invention provides a BRAF ^V600E Application of RASSF1A double-gene combination in preparation of thyroid cancer diagnostic reagent for detecting BRAF ^V600E Gene mutation and methylation degree of RASSF1A gene.

Further, the sample detected by the diagnostic reagent is a thyroid cell or tissue sample of a living body.

Further, when the detection result of the detection reagent is BRAF ^V600E Positive gene mutation or positive RASSF1A gene methylation indicates thyroid cancer.

Further, when the detection reagent detects BRAF ^V600E Gene mutation and RASSF1A methylation are double positive, which indicates that the cancer is highly invasive thyroid cancer.

In another aspect of the invention, a thyroid cancer diagnostic kit is provided, which comprises RASSF1A methylation detection reagent and BRAF ^V600E A gene mutation detection reagent. What is needed isThe kit comprises at least two parts, namely, the kit is used for detecting BRAF ^V600E A reagent for gene mutation and a reagent for detecting methylation of RASSF 1A. The object of reagent detection is generally thyroid tissue and lymph node tissue after organism puncture or operation. The two detection reagents can be packaged independently.

Further, the RASSF1A methylation detection reagent at least comprises RASSF1A gene detection primers and probes, and both ends of each probe are respectively connected with a fluorescence reporter/quencher group.

Further, the nucleotide sequences of the RASSF1A gene detection primer are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of the probe is shown as SEQ ID No.7.

Further, the BRAF ^V600E The gene mutation detection reagent at least comprises BRAF ^V600E The kit comprises gene detection primers and probes, wherein two ends of each probe are respectively connected with a fluorescence reporter/quencher group, and the probes for detecting RASSF1A gene and the probes for detecting BRAF ^V600E The fluorescent reporter/quencher groups attached to the probes for gene mutations are different.

Further, the BRAF ^V600E The gene mutation detection primer nucleotide is shown as SEQ ID No.3 and SEQ ID No.4, and the probe nucleotide is shown as SEQ ID No.8.

Further, the kit also comprises primer nucleotides shown as SEQ ID No.5 and SEQ ID No.6 for detecting external standard control, and a probe, wherein the nucleotide sequence of the probe is shown as SEQ ID No. 9.

Further, the kit further comprises one or more of the following reagents: RASSF1A positive quality control substance, BRAF ^V600E Positive quality control material, bisulfite, PCR reaction liquid, and enzyme mixture.

Furthermore, the diagnostic reagent also comprises a detection primer and a probe of the internal reference gene.

Furthermore, the nucleotide sequences of the detection primer of the reference gene are shown as SEQ ID No.10 and SEQ ID No.11, and the nucleotide sequence of the probe is shown as SEQ ID No.12.

Further, the detection reagents in the two detection reagents in the kit are positive, and under the condition that the pathological detection is positive, the kit prompts highly aggressive thyroid cancer.

Further, the kit has a cutoff value of Δ CT =8.0 for BRAFV600E mutation when used for detecting a sample; the cutoff value of RASSF1A is Δ CT =6.0.

As described above, the thyroid cancer-associated gene mutation and methylation detection composition and the use thereof according to the present invention have the following advantageous effects:

the invention detects BRAF in a sample by ^V600E The mutation detection and the methylation level detection of RASSF1A promoter region achieve the auxiliary diagnosis of thyroid cancer, and BRAF is used for the auxiliary diagnosis of thyroid cancer ^V600E And RASSF1A double positive highly prompts strong invasive thyroid cancer, and provides guidance for later treatment schemes and curative effect evaluation. The method is rapid, simple, convenient and effective, and has better sensitivity and specificity.

Drawings

FIG. 1 shows the quantitative analysis of BRAF in benign and malignant thyroid tissue samples ^V600E And (5) detecting the mutation.

FIG. 2 shows the results of quantitative analysis of RASSF1A methylation detection in benign and malignant thyroid tissue samples.

Detailed Description

The molecular pathogenesis of thyroid cancer comprises multiple aspects such as abnormal activation of signal transduction pathways, gene mutation, gene amplification, gene translocation, epigenetic (methylation) change and the like, and is a multi-gene involved and multi-step cancerization process. The gene mutation and the methylation epigenetic change are two important risk factors of the occurrence of the thyroid cancer, and have important influence on the occurrence, the development and the prognosis of the thyroid cancer. The invention improves the diagnosis of thyroid cancer by jointly detecting the gene mutation and the methylation change of the thyroid cancer.

The method has important value in thyroid cancer preoperative evaluation, recurrence risk stratification, clinical diagnosis and treatment and pathological gene diagnosis. BRAF is an oncogene, encodes a silk/threonine kinase, is an important transduction factor of RAS/RAF/MEK/ERK/MAPK pathway, and participates in regulating and controlling various biological events in cells, such as cell growth, differentiation, apoptosis and the like. The V600E mutation can makeThe BRAF protein is abnormally activated, and researches show that BRAF gene mutation with different proportions exists in various human malignant tumors, such as malignant melanoma, colorectal cancer, lung cancer, thyroid cancer, liver cancer, pancreatic cancer and the like. Among the numerous mutant gene assays, BRAF ^V600E The diagnostic sensitivity for detecting the thyroid cancer is the highest and is only 20-40%, and the expression of the thyroid cancer in the inert thyroid cancer and the invasive thyroid cancer is not obviously different.

In recent years, basic and clinical studies of DNA methylation have received much attention. DNA methylation is the regulation of gene expression and shut-down, maintenance of chromosomal integrity and regulation of DNA recombination and transcriptional activity of certain specific genomic regions, with no changes in DNA sequence, and is closely associated with human development and tumorigenesis. The DNA methylation is used as a novel molecular marker, and has the following advantages: firstly, in the process of tumor formation, the occurrence frequency of promoter hypermethylation is very high, even higher than that of gene mutation, and important genes related to tumor formation are not lacked; secondly, methylation is an important event in the early stages of tumorigenesis; and thirdly, DNA methylation exists stably, and can be detected through a PCR amplification effect. Therefore, methylation detection has potential application value in early diagnosis of tumors. RASSF1A is a Ras related region family 1A gene, is named after having the same structural region with Ras, and is a very important negative regulatory factor in a Ras signal channel. RASSF1A is a tumor suppressor gene, which plays an important role in the process of tumorigenesis and development, and its target genes are involved in gene transcription, cytoskeleton, signal transduction, cell cycle, cell adhesion and apoptosis.

Thus, the present invention relates to a combined detection kit which will detect BRAF simultaneously ^V600E Mutations and RASSF1A methylation.

The detection methods of gene mutation commonly used in clinic mainly include first-generation sequencing, fluorescent quantitative PCR (RT-PCR) method and second-generation sequencing (NGS). The RT-PCR method has the advantages of simple and convenient operation, short detection time, relatively high sensitivity and the like. Thus, this method is commonly used in BRAF ^V600E Detection of gene mutation, RAS gene mutation, RET gene rearrangement, etc.

Reagents used in the above-described methods for detecting DNA methylation are well known in the art. Furthermore, in detection methods involving DNA amplification, the reagents that detect DNA methylation include primers. The primer sequences are methylation specific or non-specific. Preferably, the sequence of the primer comprises a non-methylation specific blocking sequence (Blocker). Blocking sequences may enhance the specificity of methylation detection.

Illustratively, when using fluorescent quantitative PCR, the reagent for detecting DNA methylation may further comprise a probe. The 5 'end of the sequence of the probe is marked with a fluorescent reporter group, and the 3' end is marked with a quenching group. In general, the reaction solution for PCR contains Taq DNA polymerase, PCR buffer (buffer), dNTPs, and Mg2+. Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase. Illustratively, mg ²⁺ The final concentration is 1.0-10.0mM; the concentration of each primer is 200-700nM; the concentration of each probe is 100-400nM; the PCR reaction condition is pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 15s, annealing extension at 60 ℃ for 1min, and 45 cycles.

Methods for calculating methylation levels are known in the art. Exemplarily, in an embodiment for detecting methylation by PCR, the methylation level =2- Δ Ct test sample/2- Δ Ct positive standard × 100, wherein Δ Ct = Ct target gene-Ct reference gene. Alternatively, in embodiments where methylation is detected by sequencing, the methylation level = the number of methylated bases/total bases.

As used herein, a "DNA" or "DNA molecule" is a deoxyribonucleic acid. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded.

As used herein, "uracil" or "U" is a component of RNA. An "RNA" or "RNA molecule" is a ribonucleic acid. RNA is a long chain molecule formed by the condensation of ribonucleotides via phosphodiester bonds. RNA has 4 main bases, namely adenine (A), guanine (G), cytosine (C) and uracil (U). In base pairing of RNA, U replaces the position of T in DNA, i.e. a is hydrogen-bonded to U and G is hydrogen-bonded to C.

In a specific embodimentIn embodiments, the methylation detection method comprises: (1) sample preparation: comprises DNA extraction and quality inspection; (2) DNA transformation: carrying out bisulfite conversion on the DNA obtained in the step (1), and converting unmethylated cytosine (cytosine, C) into uracil (uracil, U); methylated cytosine is not altered after conversion; (3) preparing a reaction mixture: comprises PCR reaction solution, primer mixture and probe mixture; (4) PCR mixture preparation: adding the template DNA transformed by the bisulfite in the step (2) and a positive standard, a negative control or a non-template control (NTC) into the step (3); (5) PCR reaction: and carrying out PCR reaction and collecting fluorescence. The PCR reaction solution comprises: taq DNA polymerase, PCR buffer (buffer), dNTPs, mg ²⁺ (ii) a The Taq DNA polymerase is hot start Taq DNA polymerase; mg (Mg) ²⁺ The final concentration is 1.0-10.0mM. The primer mixture is a mixture of gene primers to be amplified, wherein the final concentration of each primer is 200-700nM. The probe mixture is a mixture of gene probes to be amplified, wherein each probe has a final concentration of 100-400nM.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention. It is to be understood that the processing equipment or apparatus not specifically identified in the following examples is conventional in the art. Furthermore, it is to be understood that one or more method steps mentioned in the present invention does not exclude that other method steps may also be present before or after the combined steps or that other method steps may also be inserted between these explicitly mentioned steps, unless otherwise indicated; it is also to be understood that a combined connection between one or more devices/apparatus as referred to in the present application does not exclude that further devices/apparatus may be present before or after the combined device/apparatus or that further devices/apparatus may be interposed between two devices/apparatus explicitly referred to, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the various method steps is merely a convenient tool for identifying the various method steps, and is not intended to limit the order in which the method steps are arranged or the scope of the invention in which the invention may be practiced, and changes or modifications in the relative relationship may be made without substantially changing the technical content.

Method

1. Pre-stage sample processing

1. Pretreatment of a paraffin section sample of a tissue:

1.1 taking 2-3 paraffin slices, placing the slices in a centrifuge tube, adding 1mL of dimethylbenzene, tightly covering a tube cover, and carrying out vortex oscillation for 10s.

1.2 Centrifuge at 12000rpm for 2min, carefully aspirate the supernatant, and take care not to aspirate the pellet.

1.3 Add 1mL of absolute ethanol, vortex, shake and mix. Centrifuge at 12000rpm for 2min, carefully aspirate the supernatant, and take care not to aspirate the pellet.

1.4 open the tube lid and incubate at room temperature or 37 ℃ for 10min until no ethanol remains.

1.5 adding 180. Mu.L lysis buffer 1, resuspending the precipitate, adding 20. Mu.L proteinase K, vortexing, shaking and mixing

1.6 Incubate at 56 ℃ for 1 hour until the sample is completely dissolved.

1.7 Incubate at 90 ℃ for 1 hour. The solution on the tube wall was collected to the bottom of the tube by brief centrifugation.

1.8 Add 200. Mu.L lysis buffer 2 and vortex to mix thoroughly. Add 200. Mu.L of absolute ethanol, vortex and shake thoroughly and mix. The solution on the tube wall was collected to the bottom of the tube by brief centrifugation.

1.9 transfer all the solution from 1.8 to the adsorption column, centrifuge at 12000rpm for 1min, pour off the waste liquid in the collection tube, and replace the adsorption column in the collection tube again.

2. Pretreatment of fresh cell and tissue samples:

2.1 transfer the samples to a 15mL centrifuge tube (samples of different sample types were taken at slightly different volumes, with 10mL alveolar lavage fluid and ascites fluid, and 5mL pleural fluid), centrifuge at 2000rpm for 5min, discard the supernatant, and resuspend the cell pellet with residual fluid (100-200. Mu.L).

2.2 transfer the above liquid to a 1.5mLEP tube, centrifuge at 2000rpm for 5min and discard the supernatant.

2.3 Add 200. Mu.L lysis buffer 1 and shake until the sample is thoroughly suspended.

2.4 Add 20. Mu.L proteinase K and 200. Mu.L lysis buffer 2 to the sample in turn, vortex and mix well.

2.5 Incubating in 56 deg.C metal bath for 10min, and mixing uniformly every 2-3 min.

2.6 short-term centrifugation, adding 200 mu L of absolute ethyl alcohol, vortexing, shaking, fully mixing, and short-term centrifugation.

2.7 transfer the liquid from the EP tube to the adsorption column in the collection tube, taking care that the tip does not touch the filter membrane, in order to avoid breaking it. 2. Washing and eluting the adsorption column and quantifying the nucleic acid sample

Centrifuging at 1.12000 rpm for 1min, pouring out waste liquid in the collecting tube, and replacing the adsorption column in the collecting tube again.

2. Add 500. Mu.L of rinsing buffer 1 to the adsorption column, centrifuge at 12000rpm for 1min, and discard the tube.

3. Add 500. Mu.L of washing buffer 2 to the adsorption column at 12000rpm for 1min and discard the tube.

4. And repeating the step 3 once to improve the DNA purity.

5.12000 rpm centrifugation for 2min (this step is to remove residual ethanol, which inhibits PCR amplification, this step is not omitted), prepare a new 1.5ml EP tube, place the adsorption column into the EP tube, throw away the collection tube, and leave the adsorption column open at room temperature and stand for 5min.

6. Suspending 50 μ L of elution buffer solution in the middle of the filter membrane of the adsorption column, and standing at room temperature for 5min. The DNA solution was collected by centrifugation at 12000rpm for 1min.

7. A new EP tube is taken to prepare a reagent (an Osten/Qubit kit) for detecting the DNA concentration, the corresponding reagent (199 mu L Buffer +1 mu L dye per person) is prepared according to the number of samples, and vortex shaking is carried out.

8. 199 mu L and 1 mu L of prepared reagent DNA are taken and placed in a 0.5ml matching tube carried by the kit, and the solution is slightly shaken, slightly flicked and protected from light for 3min.

9. DNA concentrations were measured using a Qubit or Oster Fluo-100 fluorometer and should be greater than 10 ng/. Mu.L. (if the DNA concentration is <10 ng/. Mu.L, re-extraction is recommended). If the detected DNA concentration is beyond the detection range (higher than 100 ng/. Mu.L), taking 2. Mu.L of DNA stock solution and 8. Mu.L of eluent, carrying out vortex oscillation, carrying out instantaneous centrifugation, and detecting the concentration again.

10. Transfer 10 μ L of the sample to a new 1.5mLEP tube for subsequent BRAF V600E detection.

11. The remaining DNA samples were diluted to 10 ng/. Mu.L with each eluent and the samples were normalized. (subsequent sulfite modification step required 10 ng/. Mu.L of DNA, 20. Mu.L)

3. Bisulfite modified DNA

1. Processing the number of DNA samples according to the requirement, and preparing a PCR reaction tube; adding 130 mu L of CT conversion reagent into each PCR reaction tube, then adding 20 mu L of DNA samples in sequence, marking, slightly shaking and centrifuging for a short time;

2. placing the PCR reaction tube on a reaction plate of a PCR instrument, covering a heat cover, and setting a reaction program according to the following steps

98℃，8min

64℃，3.5h

4℃，forever

3. According to the number of DNA samples to be processed, a purification column and a collection tube (kit-of-part) are prepared, the sample number is marked on the purification column, and the purification column is placed in the collection tube.

4. 600. Mu.L of binding buffer was taken and added to the purification column.

5. The product of the step 2 reaction was transferred to a purification column (containing 600. Mu.L of binding buffer), capped, inverted several times (more than 10 times), and the samples were mixed. The tube was then centrifuged at 12,000rpm for 30 seconds to empty the tube.

6. Add 100. Mu.L of the washing solution to the purification column and centrifuge at 12,000rpm for 30s.

7. Add 200. Mu.L of the desulfonated solution to the purification column, incubate at room temperature for 20min (at which time the PCR kit can be removed from-20 ℃ and thawed at room temperature), and centrifuge at 12,000rpm for 30s.

8. Add 200. Mu.L of the washing solution to the purification column, centrifuge at 12,000rpm for 30s, add 200. Mu.L of the washing solution, centrifuge at 12,000rpm for 30s, pour the waste solution, and centrifuge at 12,000rpm for 1min.

9. The column was placed in a new 1.5ml EP tube (labeled), 20. Mu.L of the eluent was added directly to the column matrix (which had to be applied) and centrifuged at 12,000rpm for 30s to elute the DNA.

4. RASSF1A PCR amplification

1. And taking out the DNA of the sample to be detected after the sulfite modification.

2. And (3) unfreezing the kit at room temperature for 30min, taking out the PCR reaction solution and the DNA polymerase from the kit, shaking and uniformly mixing the PCR reaction solution for 20s (fully shaking), and then carrying out short-time centrifugation together with the enzyme.

Remarking: the enzyme should be kept at low temperature, and should be prepared immediately before use without shaking.

3. Preparing a PCR reaction solution: according to the number of detected samples (number of samples + control of yin and yang), preparing a PCR mixed solution according to the following reagent proportion, wherein the PCR reaction solution comprises DNA polymerase =15:0.3 (one part). Adding the components into a new EP tube according to the proportion, reversing and uniformly mixing, and performing instantaneous centrifugation.

4. The PCR reaction tubes are sequentially arranged on a PCR tube frame, prepared PCR reaction liquid is added into the PCR reaction tubes according to 15 mu L per hole, 5 mu L of DNA sample is added, the reaction tube covers are carefully covered, and marks are made (marked on handles at two ends of the tube covers).

5. And (4) performing instantaneous centrifugation to remove air bubbles in the reaction system, and putting the PCR reaction tube into the instrument.

6. And opening an instrument setting window, and setting a PCR amplification and signal collection program.

a) The first stage is as follows: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 5 cycles of 95 ℃ for 15 seconds, 60 ℃ for 30 seconds;

c) And a third stage: 40 cycles of 95 ℃ for 15 seconds and 57 ℃ for 30 seconds;

signal collection: the FAM, VIC (or HEX) and CY5 signals were collected at 57 deg.C in the third stage.

7. And saving the file and operating the program.

5. BRAF V600E mutation amplification

1. 10. Mu.L of the pre-stored DNA of the sample to be tested was taken out.

2. Placing the PCR reaction tubes on a PCR tube frame in sequence (each sample needs to be provided with two PCR reaction tubes, one is used for BRAF mutation detection, and the other is used for external label detection), and slightly uncovering the tube covers of the PCR reaction tubes.

3. And taking out the BRAF PCR reaction solution which is fully thawed from the kit, reversing and uniformly mixing, and adding 12.5 mu L of premixed solution into a corresponding PCR reaction tube.

4. And taking out the fully thawed external standard PCR reaction solution from the kit, reversing and uniformly mixing, and adding 12.5 mu L of premixed solution into a corresponding PCR reaction tube.

5. The following reagents were added separately and mixed to a new sterile EP tube: taking 5 mu L of DNA sample, 1 mu L of DNA polymerase and 19 mu L of purified water, inverting and mixing evenly, respectively taking 12.5 mu L of DNA sample, adding the DNA sample into a BRAF mutation detection tube and an external standard detection tube, and then carefully covering a tube cover of a reaction tube. Note that: the DNA polymerase and the reaction solution containing the DNA polymerase are not shaken and mixed uniformly.

6. And (5) adding the negative and positive quality control products provided by the kit into the negative control reaction tube and the positive control reaction tube respectively according to the method of the step 5, and covering and sealing the reaction tubes in time.

7. Marking (when using ABI7500 detection system, no marking is needed on the reaction tube cover to avoid affecting the fluorescent detection), and placing the PCR reaction tube into the instrument after instantaneous centrifugation.

8. And opening an instrument setting window, and setting a PCR amplification and signal collection program according to the right picture.

a) The first stage is as follows: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 10 cycles of 95 ℃ for 15 seconds, 60 ℃ for 30 seconds;

c) And a third stage: 35 cycles of 95 ℃ for 15 seconds, 57 ℃ for 30 seconds; (ii) a

Signal collection: the FAM and HEX/VIC signals were collected at 57 deg.C in the third stage.

9. And saving the file and operating the program.

Example 1 screening of methylation diagnostic index for thyroid cancer

And (3) screening methylation indexes which are high in methylation expression in thyroid cancer tissues and should not be or are low in expression in benign lesions. The specific screening method is as follows:

paraffin tissue samples of 50 cases of thyroid cancer and 30 benign thyroid lesion samples were provided by the sixth national hospital of Shanghai, and 7 kinds of gene methylation tests were performed, and the test results are shown in Table 1:

TABLE 1 detection results of 8 genes in thyroid cancer tissue and benign diseased tissue

The results show that:

1、BRAF ^V600E the mutation was detected in 20 thyroid cancer tissue samples, the diagnostic sensitivity in thyroid cancer tissue samples was 40%, and the gene mutation was not detected in benign lesions;

2. RASSF1A methylation has higher clinical value in thyroid cancer detection, the diagnosis sensitivity in a thyroid cancer tissue sample is 60 percent, and only 1 case of benign lesions detects the gene methylation;

3. BRAF was detected in 45 thyroid cancer tissue samples ^V600E And/or RASSF1A methylation, the two complement each other, and the diagnosis sensitivity of the combined detection of thyroid cancer is 90%;

4. SHOX2 detected thyroid cancer tissues with 20 positive cases and all were SHOX2 positive, but also with 9 positive cases in benign lesions. Indicating that the SHOX2 index has poor thyroid cancer detection specificity. The p16 shows 70% and 80% positive rate in both cancer tissues and benign lesions, which indicates that the methylation of the p16 is positive in both benign and malignant thyroid lesions, and the index specificity of the p16 is poor. Other indexes have low diagnosis sensitivity in malignant thyroid lesions and have no diagnosis value.

Example 2 thyroid cancer BRAF ^V600E Construction and use of mutation and RASSF1A methylation combined detection kit

Through experiments, the selection BRAF is finally determined ^V600E Mutation and RASSF1A methylation for onychomycosisThe related diagnosis of adenocarcinoma is used.

1. The kit comprises the following components:

RASSF1A reagent moiety

a) RASSF1A PCR reaction solution:

forward primer for RASSF1A (SEQ ID No. 1): CGGGGTTCGTTTTGTGGTTTC;

reverse primer for RASSF1A (SEQ ID No. 2): CCGATTAAATCCGTACTTCG;

a probe nucleotide sequence (SEQ ID No. 7) for RASSF1A, TCGCGTTTGTTAGCGTTTAAAGT;

the reference gene beta-actin forward primer (SEQ ID No. 10) is AAGATAGTGTTGTGGGTGTAGGT

The reference gene beta-actin reverse primer (SEQ ID No. 11) is TACTTAATAACACACACTCCAAACCG

The reference gene beta-actin probe (SEQ ID No. 12) ACACCTCAACCTATCAC

b) And RASSF1A positive quality control product;

c) RASSF1A negative control;

d) A DNA polymerase;

e) DNA modifying agents (bisulfite);

2.BRAF ^V600E reagent moieties

a)BRAF ^V600E PCR reaction solution:

for BRAF ^V600E The forward primer of (SEQ ID No. 3): gaagacctccacagtaaaaatagtga;

for BRAF ^V600E The reverse primer of (SEQ ID No. 4): ACAACTGTTCAAACTGATGGGACC;

for BRAF ^V600E The probe nucleotide sequence of (SEQ ID No. 8) TAGCTACAGAGAATC; (for detecting Point mutation Probe)

The reference gene beta-actin forward primer (SEQ ID No. 10) is AAGATAGTGTTGTGGGTGTAGGT

The reference gene beta-actin reverse primer (SEQ ID No. 11) is TACTTAATAACACACACTCCAAACCG

The reference gene beta-actin probe (SEQ ID No. 12) is ACACCAACCTCATAACCTACTTACAC b, and external standard PCR reaction liquid:

for BRAF ^V600E The forward primer of the external standard gene of (SEQ ID No. 5): tgccttgcaagagagtactca;

for BRAF ^V600E The reverse primer of the external standard gene (SEQ ID No. 6): TACCGAGTGGGGTGCTGAT;

for BRAF ^V600E The external standard control probe nucleotide sequence (SEQ ID No. 9) of (1) CTAGCTACAGTGAAATC;

the forward primer (SEQ ID No. 10) of the reference gene beta-actin is AAGATAGTGTTGTGGGGTAGGT

The reference gene beta-actin reverse primer (SEQ ID No. 11) is TACTTAATAACACACACTCCAAACCG

The reference gene beta-actin probe (SEQ ID No. 12) is ACACCAACCTCATAACCTACTTACAC

c)、BRAF ^V600E Positive quality control products;

d) And negative quality control products;

e) A DNA polymerase;

2. method for using kit

See, in particular, the methods section above. Wherein RASSF1A PCR conditions are as follows:

a) The first stage is as follows: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 5 cycles of 95 ℃ for 15 seconds, 60 ℃ for 30 seconds;

c) And a third stage: 40 cycles of 95 ℃ for 15 seconds and 57 ℃ for 30 seconds;

signal collection: the FAM and CY5 signals were collected at 57 ℃ in the third stage. Wherein FAM is a fluorescent signal of a probe for detecting RASSF1A, and CY5 is a fluorescent signal of a probe for detecting internal reference.

BRAF V600E PCR conditions:

a) The first stage is as follows: 95 ℃,10 minutes, 1 cycle;

b) And a second stage: 10 cycles of 95 ℃ for 15 seconds, 60 ℃ for 30 seconds;

c) And a third stage: 35 cycles of 95 ℃ for 15 seconds, 57 ℃ for 30 seconds; (ii) a

Signal collection: collecting FAM and HEX/VIC signals at 57 deg.C; the mutation signal is indicated by the FAM signal and the internal control signal is indicated by the HEX/VIC signal.

3. Determination of detection index result

BRAF ^V600E The detection result is judged as follows: the positive judgment is based on the difference between the Ct value of the BRAF reaction tube and the Ct value of the external standard control tube, namely delta Ct: delta Ct = [ Ct of BRAF reaction tube ] - [ external standard Ct ]; smaller Δ Ct indicates BRAF in the sample ^V600E The higher the proportion of mutant cells.

The RASSF1A methylation detection result is judged as follows: the positive judgment is based on the difference between the Ct value of RASSF1A in the reaction tube and the Ct value of the internal reference control, namely delta Ct: Δ Ct = [ RASSF1A Ct ] - [ internal reference Ct ]. A smaller Δ Ct indicates a higher proportion of cells with RASS1A hypermethylation in the sample.

Example 3 diagnostic cutoff value, sensitivity and specificity of thyroid cancer mutation and methylation diagnostic kit

1. Establishing cutoff values judged by each index by using thyroid tissue samples

71 samples of thyroid cancer tissues (46 cases of papillary thyroid cancer, 10 cases of follicular type, 10 cases of medullary carcinoma, 5 cases of hypodifferentiation) and 66 samples of benign lesions (39 cases of hashimoto thyroiditis, 24 cases of thyroid hyperplasia and 3 cases of nodular goiter) were collected from the sixth national hospital of Shanghai. All samples were subjected to BRAF ^V600E Mutation detection and RASSF1A methylation detection. The results are shown in FIGS. 1-2.

The experimental results show that:

quantitative analysis of BRAF in benign and malignant thyroid tissue samples as in FIG. 1 ^V600E The mutation detection result, positive judgment is based on the difference between the Ct value of the BRAFV600E reaction tube and the Ct value of the external standard control tube, namely delta Ct: Δ Ct = [ Ct of BRAF reaction tube ] - [ external standard Ct ]. The Δ Ct for the BRAFV600E detection signal in malignant thyroid cancer tissue (left) and benign thyroid tissue (right) were plotted as scatter plots, respectively, and set as Δ Ct =20 if the BRAFV600E detection signal in the sample did not jump.

BRAF is detectable in a portion of both benign and malignant thyroid tissue samples ^V600E Mutation of signal, but by calculating Δ CT, benign and malignant thyroid tissueBRAF in samples ^V600E There was a significant difference in the intensity of the mutant signal.

BRAF ^V600E The cutoff value was set at Δ CT =8.0, the specificity was 97%, and the positive rate of malignant thyroid cancer was 39%;

as shown in fig. 2, RASSF1A methylation detection results were quantitatively analyzed in benign and malignant thyroid tissue samples. The positive judgment is based on the difference between the Ct value of RASSF1A in the reaction tube and the Ct value of the internal reference control, namely delta Ct: Δ Ct = [ RASSF1A Ct ] - [ internal reference Ct ]. Δ Ct of RASSF1A methylation detection signal in malignant thyroid cancer tissue (left) and benign thyroid tissue (right) were plotted as scattergrams, respectively, and set to Δ Ct =20 if RASSF1A methylation detection signal in the sample did not jump.

RASSF1A methylation signal can be detected in a portion of both benign and malignant thyroid tissue samples, but by calculating Δ CT, there is a significant difference in the intensity of RASSF1A methylation signal in benign and malignant thyroid tissue samples.

RASSF1A cutoff value was set at Δ CT =7.0, specificity was 85%, and positive rate of malignant thyroid cancer was 72%;

RASSF1A cutoff value was set at Δ CT =6.0, specificity was 95%, and positive rate of malignant thyroid cancer was 59%.

2. Sensitivity and specificity of combined detection of BRAF mutation and RASSF1A

A setting BRAFV ^600E The cutoff value was 8.0, and the RASSF1A methylation cutoff value was 7.0

TABLE 2 detection of BRAF mutation and RASSF1A methylation in thyroid tissue samples

B setting BRAFV ^600E A cutoff value of 8.0, a RASSF1A methylation cutoff value of 6.0

TABLE 3

The experimental results show that:

when the RASSF1A cutoff value is set at Δ CT =7.0 and the specific cutoff value is set at Δ CT =6.0, the detection sensitivity is improved from 59% to 72%, but the specificity is reduced from 95% to 85%.

From the rates of BRAF mutation and RASSF1A methylation double positives, when RASSF1A cutoff value is set at Δ CT =7.0, the rate of common positives for both indices is 30%, and when RASSF1A cutoff value is set at Δ CT =6.0, the rate of common positives for both indices is 18%. From the result that any one of the two indexes is positive, the RASSF1A cutoff value delta CT is improved from 6.0 to 7.0, the overall positive is only increased by 1, the sensitivity is improved from 80% to 82%, but the specificity is reduced from 94% to 83%.

Therefore, when BRAF mutation and RASSF1A methylation are jointly detected, the RASSF1A cutoff value is more suitably set to be 6.0, and the detection specificity is ensured without great loss.

BRAF ^V600E The combination of mutation (delta CT = 8.0) and RASSF1A methylation (delta CT = 6.0) is applied to the diagnosis of thyroid cancer, and the diagnosis sensitivity of either positive index to the thyroid cancer is determined from BRAF ^V600E The individual 39% was increased to 80% and the specificity of the assay was slightly decreased from 97% to 94%. BRAF ^V600E The number of common positive cases of mutation and RASSF1A methylation was 13, accounting for 18.3% of thyroid cancer.

3. Diagnostic sensitivity of combined detection of BRAF mutation and RASSF1A in different pathological types of thyroid cancer

TABLE 4 BRAF ^V600E Diagnostic sensitivity of combined detection of mutations and RASSF1A in different pathological types of thyroid cancer

The experimental results show that:

BRAF ^V600E mutation and RASSF1A methylation are combined compared with BRAF alone ^V600E Mutation detection can improve the PTC diagnostic sensitivity from 47.8% to 86.9%; diagnosis of FTCThe sensitivity is improved from 10% to 70%; increasing the sensitivity of MTC diagnosis from 30% to 60%; the diagnostic sensitivity of the highly malignant undifferentiated carcinoma is improved from 40% to 80%.

The experimental conclusion is that:

is applied to thyroid tissue BRAF ^V600E The cutoff value of the mutation is Δ CT =8.0; the cutoff value of RASSF1A is Δ CT =6.0.BRAF ^V600E The mutation and RASSF1A methylation complement each other, and the diagnosis sensitivity of the combined diagnosis of thyroid cancer is 80%, and the specificity is 94%. The diagnosis sensitivity of the combination of the two indexes on PTC is 86.9 percent, the diagnosis sensitivity on FTC is 70 percent, the diagnosis sensitivity on MTC is 60 percent, and the diagnosis sensitivity on high-grade malignant undifferentiated carcinoma is 80 percent compared with BRAF ^V600E The single detection is greatly improved.

Example 4 Combined detection of mutations and methylation to improve diagnostic sensitivity of fine thyroid needle puncture

50 thyroid cancer operation samples and paired fine needle biopsy samples are collected from the sixth national hospital of Shanghai city, the morphopathological detection results are collected, and BRAF mutation and RASSF1A methylation detection are carried out on the samples. The results of the measurements are reported in table 5.

TABLE 5 thyroid cancer surgical specimens and their paired small biopsy samples for mutation and methylation detection

The experimental results show that:

1.BRAF ^V600E the diagnostic sensitivity of the mutation and RASSF1A in thyroid cancer surgical specimens was 28% and 64%, respectively, and the diagnostic sensitivity of the combination was 86%.

2. The thyroid fine needle punctures the sample, if only relying on the diagnosis of the morpho-pathology, the diagnosis sensitivity is only 44%. BRAF alone ^V600E The diagnostic sensitivity is 26%, and the combined cell morphology can improve the diagnostic sensitivity of the thyroid cancer to 58%.

3. The sensitivity of RASSF1A alone for diagnosing the sample is 62%, the sensitivity of diagnosing thyroid cancer can be improved to 82% by combining BRAF detection, and the sensitivity of combining cytology can reach 84%.

4.BRAF ^V600E The mutation and RASSF1A methylation assays showed 93% and 97% concordance in fine needle thyroid puncture and thyroid surgery samples.

And (4) experimental conclusion:

BRAF ^V600E the mutation and RASSF1A methylation detection has high consistency in thyroid fine needle puncture and thyroid surgery samples, and the mutation and methylation detection is used as a supplement of morphological pathology, so that the diagnostic sensitivity of the thyroid fine needle puncture can be improved from 44% to 84%.

Example 5BRAF ^V600E Mutation and RASSF1A methylation together suggest highly aggressive thyroid cancer

Clinical pathological diagnosis determines that highly aggressive thyroid cancer is mainly characterized by morphological judgment, and highly differentiates certain subtypes of cancer, including the high cell type of papillary carcinoma, the columnar cell type, the diffuse sclerosis type, the spike subtype, and the widely invasive type of follicular carcinoma. Thyroid cancer molecular marker detection (e.g., BRAF) ^V600E Mutations, RAS mutations, RET/PTC rearrangements, etc.) are believed to contribute to an improved diagnosis of thyroid nodules that cannot be identified as benign or malignant by FNA. The research shows that the BRAF/RAS and TERT promoter double mutation has synergistic effect and is more invasive than thyroid cancer with single gene BRAF or RAS or TERT mutation. Thyroid specimen was subjected to 8 gene assay (BRAF) ^V600E RAS (K/N/H), TP53, TERT, CDKN2b, PIK3CA, RET, CHEK 2), and can also assist in diagnosing highly aggressive thyroid cancer if more than two mutations occur.

The results of case morphology diagnosis and 8 gene mutation detection of 13 samples positive in the combined test in example 3 are shown in Table 6:

TABLE 6 BRAF and RASSF1A combined detection positive molecule and morphopathological comprehensive diagnosis result

* Criteria for comprehensive diagnosis of molecular and morphological pathologies: the diagnosis of thyroid cancer is defined as a highly invasive, molecular and morphological pathological syndrome, wherein the thyroid cancer is morphologically characterized by a high cell type, columnar cell type, diffuse sclerosis type, spike subtype, and extensive infiltration type of follicular cancer, or positive by more than 2 genetic mutations. Both medullary and undifferentiated carcinomas are highly aggressive thyroid carcinomas.

The experimental result shows that 13 cases of BRAF ^V600E With RASSF1A combined positive pathology, 9 cases (69.2%) with morphologic single diagnosis of highly aggressive type, 9 cases (69.2%) with more than 2 mutations detected in 8 gene mutations. Finally, the cases of highly invasive thyroid cancer are judged to be 11 cases in total according to the molecular and morphological pathological comprehensive diagnosis standard of 8 genes, and the BRAF is explained ^V600E And RASSF1A methylation double positive suggests that the positive predictive value of the highly invasive thyroid cancer is 84.6% (11/13), and the detection cost is greatly reduced.

And (4) experimental conclusion: BRAF ^V600E A combination of positive pathology with RASSF1A may highly suggest highly aggressive thyroid cancer.

Claims (12)

1. The BRAFV600E and RASSF1A double-gene combination is used for preparing a thyroid cancer diagnostic reagent, and the reagent is used for detecting BRAFV600E gene mutation and methylation degree of RASSF1A gene.
2. 2. The use according to claim 1, wherein the thyroid cancer is highly aggressive thyroid cancer.
3. 3. A thyroid cancer diagnostic kit is characterized by comprising an RASSF1A methylation detection reagent and a BRAFV600E gene mutation detection reagent.
4. 4. The kit of claim 3, wherein the thyroid cancer is a highly aggressive thyroid cancer.
5. 5. The kit of claim 3, wherein: the RASSF1A methylation detection reagent at least comprises RASSF1A gene detection primers and probes, and both ends of each probe are respectively connected with a fluorescence reporter/quencher.
6. 6. The kit of claim 5, wherein: the RASSF1A gene detection primer nucleotide sequence is shown as SEQ ID No.1 and SEQ ID No.2, and the probe nucleotide sequence is shown as SEQ ID No.7.
7. 7. The kit of claim 3, wherein: the BRAFV600E gene mutation detection reagent at least comprises BRAFV600E gene detection primers and probes, two ends of each probe are respectively connected with a fluorescent reporter/quencher, and the probes for detecting RASSF1A gene are different from the fluorescent reporter/quencher connected with the probes for detecting BRAFV600E gene mutation.
8. 8. The kit of claim 7, wherein: the BRAFV600E gene mutation detection primer nucleotide is shown as SEQ ID No.3 and SEQ ID No.4, and the probe nucleotide is shown as SEQ ID No.8.
9. 9. The kit of claim 7, wherein: the kit also comprises primer nucleotides shown as SEQ ID No.5 and SEQ ID No.6 and a probe for detecting external standard control, wherein the nucleotide sequence of the probe is shown as SEQ ID No. 9.
10. 10. The kit of claim 3, wherein: the kit further comprises one or more of the following reagents: RASSF1A positive quality control product, BRAFV600E positive quality control product, bisulfite, PCR reaction solution, and enzyme mixture solution.
11. 11. The kit of claim 3, wherein: the diagnostic reagent also comprises a detection primer and a probe of the reference gene.
12. 12. The kit of claim 11, wherein: the nucleotide sequences of detection primers of the reference gene are shown as SEQ ID No.10 and SEQ ID No.11, and the nucleotide sequence of a probe is shown as SEQ ID No.12.

Images