CN115820709A - Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain - Google Patents
Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain Download PDFInfo
- Publication number
- CN115820709A CN115820709A CN202211091347.2A CN202211091347A CN115820709A CN 115820709 A CN115820709 A CN 115820709A CN 202211091347 A CN202211091347 A CN 202211091347A CN 115820709 A CN115820709 A CN 115820709A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- seq
- recombinant vector
- kluyveromyces marxianus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides a vector capable of successfully replicating and expressing an exogenous gene in a Kluyveromyces marxianus strain, which comprises the following fragments connected in sequence: the gene comprises a nutritional gene A, a resistance gene, a replicon, a CYC terminator and a TEF3 promoter, wherein a sequence shown by SEQ ID NO.8 is connected between the TEF3 promoter and the nutritional gene A; wherein, the CYC terminator and the TEF3 promoter are reversely connected. The invention also provides a recombinant vector consisting of the vector and the oxidase A gene, and the Kluyveromyces marxianus recombinant strain containing the recombinant vector can stably and efficiently produce protease with an oxidation function, and has industrial popularization and application values.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a recombinant vector for expressing a foreign gene in a Kluyveromyces marxianus strain.
Background
With the continuous development of genetic engineering technology and molecular biology technology, various protein expression systems for expressing foreign genes appear at present, and the present common protein expression systems include prokaryotic expression systems, yeast expression systems, insect expression systems, mammalian cell expression systems and the like. Prokaryotic expression technology is represented by an escherichia coli expression system, has the advantages of clear genetic background, low cost, high expression quantity, simple product separation and purification and the like, and is mature at present. Therefore, the expression of proteins using eukaryotic expression systems is becoming increasingly appreciated by researchers.
The gene products of insect and mammal cell expression systems have good authenticity, but the operation is difficult, the yield is low, the cost is high, and the system is not suitable for large-scale production; therefore, eukaryotic expression systems, mainly yeast expression systems, are becoming important tools for basic research and industrial production.
At present, commonly used yeast expression systems are typified by transient expression systems, saccharomyces cerevisiae, and stable expression systems, pichia pastoris. The saccharomyces cerevisiae has low growth density, is not easy to ferment in a large scale, has weak capability of secreting molecular weight of more than 30kDa, and has long growth period. The pichia pastoris needs to be induced and expressed by methanol, dangerous factors exist in the fermentation process, and the growth period is long. Therefore, the development of a yeast expression system with short growth cycle, high protein expression level and high safety has potential industrial value.
Kluyveromyces marxianus (Kluyveromyces marxianus) belongs to Kluyveromyces of Saccharomyces, is a food safety grade yeast, has various physiological and biochemical characteristics such as fast growth, high temperature resistance and the like, and at present, by utilizing a genetic engineering technology, the expression of a plurality of exogenous proteins in the Kluyveromyces marxianus has been realized, such as alpha-galactosidase, lactose dehydrogenase, heat-resistant cellulase and the like (Guoshao, chenyongyitai, jiangang, and the like.
The oxidase has important significance for green synthesis of chemical and pharmaceutical important compounds, and at present, no report indicates that Kluyveromyces marxianus can express active oxidase. Therefore, there is potential value in developing a kluyveromyces marxianus based system for expression of active oxidase.
For a novel expression system of Kluyveromyces marxianus, the research degree on physiological characteristics and genetic characteristics is limited at present, and reports on a recombinant vector capable of being used for exogenous gene expression are few; furthermore, the types and kinds of recombinant vectors for expressing foreign genes in Kluyveromyces marxianus strains are limited, for example, the recombinant vectors disclosed in patent applications CN105063082A, CN105063081A, CN105132452A and CN105063080A are designed based on pKD1 fragments.
Therefore, the development of novel recombinant vectors capable of efficiently expressing oxidase in Kluyveromyces marxianus strains is worth further exploration.
Disclosure of Invention
The invention aims to provide a recombinant vector for expressing a foreign gene in a Kluyveromyces marxianus strain.
The invention provides a vector, which comprises the following fragments connected in sequence: a nutritional gene A, a resistance gene, a replicon, a CYC terminator and a TEF3 promoter;
the sequence of the TEF3 promoter is shown as SEQ ID NO. 2;
the sequence of the CYC terminator is shown as SEQ ID NO. 4;
the sequence of the nutrition gene A is shown as SEQ ID NO. 5;
the sequence of the replicon is shown as SEQ ID NO. 7;
a sequence shown as SEQ ID NO.8 is connected between the TEF3 promoter and the nutritional gene A;
wherein, the CYC terminator and the TEF3 promoter are reversely connected.
Further, the resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a tetracycline resistance gene or a chloramphenicol resistance gene, preferably an ampicillin resistance gene, and the sequence is shown in SEQ ID No. 6.
Furthermore, a sequence shown as SEQ ID NO.9 is connected between the nutrition gene A and the resistance gene;
and/or a sequence shown in SEQ ID NO.10 is connected between the resistance gene and the replicon;
and/or a sequence shown as SEQ ID NO.11 is connected between the replicon and the CYC terminator;
and/or a sequence shown as SEQ ID NO.12 is connected between the CYC terminator and the TEF3 promoter.
Preferably, the sequence of the recombinant vector is shown as SEQ ID NO. 13.
The invention also provides application of the vector in expression of exogenous genes in Kluyveromyces marxianus, and preferably, the exogenous genes are oxidase genes A.
The present invention also provides a recombinant vector which is the above-mentioned vector containing a target gene.
Further, the target gene is an oxidase gene A, and the recombinant vector contains the following fragments which are sequentially linked: a nutritional gene A, a resistance gene, a replicon, a CYC terminator, an oxidase gene A and a TEF3 promoter; the sequence of the oxidase gene A is shown in SEQ ID NO.3, and the oxidase gene A is reversely connected.
Further, a sequence shown in SEQ ID NO.12 is connected between the CYC terminator and the oxidase gene A;
preferably, the sequence of the recombinant vector is shown as SEQ ID NO. 1.
The invention also provides the application of the recombinant vector in the preparation of the recombinant kluyveromyces marxianus; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
The invention also provides a recombinant bacterium which is kluyveromyces marxianus containing the recombinant vector; preferably, the kluyveromyces marxianus is URA3 auxotroph kluyveromyces marxianus.
The invention also provides application of the recombinant bacterium in preparation of oxidase A protein.
The oxidase A is selected as an expression object in the invention.
Description of the invention terms: "reverse connection": each fragment sequence given in the present specification is represented in the direction of 5'→ _3' end. The term "reverse ligation" as defined in the claims means that the fragment is inserted into the vector in the opposite direction to the sequence of the fragment given in the description, i.e.in the vector as its reverse complement.
The invention has the beneficial effects that: the invention provides a recombinant vector which can successfully replicate and express exogenous genes in Kluyveromyces marxianus strains, can stably and efficiently produce oxidase A protein, and has industrial popularization and application values.
It will be apparent that various other modifications, substitutions and alterations can be made in the present invention without departing from the basic technical concept of the invention as described above, according to the common technical knowledge and common practice in the field.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1 is a map of the recombinant vector pSUS1 YTPC.
FIG. 2 is a map of recombinant vector pKSUPS 6 NPC.
FIG. 3 is a schematic diagram of the polyacrylamide gel electrophoresis results of the protein standard (left) and the polyacrylamide gel electrophoresis results of the protein expressed by the recombinant vector pSUS1YTPC and the recombinant vector pKSUPS 6NPC (right).
FIG. 4 shows the activity test of the oxidase A protein expressed by the recombinant vector pSUS1YTPC and the recombinant vector pKUPS6 NPC.
Detailed Description
The raw materials and equipment used in the invention are known products and are obtained by purchasing commercial products. The vectors of the invention are all entrusted to be synthesized by Onychoma biology company.
The URA3 auxotroph Kluyveromyces marxianus used in the embodiment of the invention is a URA3 auxotroph strain constructed by knocking out a CDs with 168bp length of URA3 gene in Kluyveromyces marxianus CBS6556 by utilizing a homologous recombination technology, and the method refers to the following documents: loBs A K, engel R, schwartz C, et al CRISPR-Cas9-enabled genetic deviations for understating ethanol and ethyl acetate biosyntheses in Kluyveromyces marxianus [ J ]. Biotechnology for Biofuels,2017,10 (1). (DOI: 10.1186/s 13068-017-0854-5).
Example 1 construction of recombinant vectors of the invention
The recombinant vector pSUS1YTPC is synthesized by whole gene, as shown in figure 1,
the sequence is as follows (SEQ ID NO. 1):
aaatatttgcttatacaatcttcctgtttttggggcttttctgattatcaaccggatacgacgcctggagctcctttcatttctgataaaagtaaggtttctctatttatcttttcacccacattatccttcgaagtacgtatacaatattagttcaacgtaaaaacaaaacttactgtaaatatgcgtaaaaaaaatctattaaattcatagcagtttcaaggaaagagaaccattatggtctggtcacgtgtgtataaattattaattttaacactatataatttattatttttttattttgaagtttagagtaattttagtagtattttatattttaaataaatatattttaaatttttacttaatattttattatttttaatacaatgtttttatttaaaacaaaattataaattaaaatgttgttccgaaagtaaaatatattttatggttttacaaaaataaattatttttaatgtattttttaattatattttgtatgtaattatatccacaggtattatgttgaatttagctgttttagtttacctgtgtggtactatgagttttgcctctcaaaagctatttttagaactctctctctcttagaaataggtggtgttgcggttgacttttaacgatatatcattttcaatttatttattttaaagtgacatagagagattccttttaatttttaatttttattttcaataattttaaaatggggacttttagattggaacaaaatgaaaatatctgttatacgtgcaactgaattttactgaccttaaaggactatctcgaacttggttcggaaatccttgaaatgattgatattttggtggattttctctgattttcaaacaagtagtattttatttaatatttattatattttttacatttttttatatttttttattgtttggaagggaaagcaacaattactttcaaaatatataaattaaactgaaatacttaataagagacaaataacattcaagaatcaaatactgggttattaatcaaaagatctctctacatgcacccaaattcactatttaaatttactataccactgacagaatatatgaacccagattaagtagccagaggctcttccactatattgagtatatagccttacatattttctgcgcataattttctggatgtaaaataaacaaaaatagttagtttgtagttatgaaaaaaggcttttggaaaatgcggaatacgtgttatttaaggttaatcaacaaaacgcatatccatagtggatagttggataaaacttcaattgatggcgaattctgattgctcatctttgacagcttatcatcgataagctagcttttcaattcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaatctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaaaaaactgtattataagtaaatgcatgtatactaaactcacaaattagagcttcaatttaattatatcagttattacccattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgatacactattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagagtgacaccacgatgcctgtagcaatgccaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcgctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagggccgcagcttgcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaattacatgatgcggccctctaggatcagcgggtttaaactcaatggtgatggtgatgatgaccggtacgcgtagaatcgagaccgaggagagggttagggataggcttaccttcgaagggccctctagattaatgatgatgatgatgatgatctcgcccgtatgggaagacctgggtacatccagcggcgactccctggaataagaaatcgagattcgtattaagggctttgcgaagctgcaccgtcggattcgggtagagtgacttgaccgttatgttgacgaatttctcgtacatcaagcagggggtggaaaagtcagaggatgttgggtcgacggtgtagctgttgatcttgccgacatttcttccgggctgcataggatgagcctgtacaactacctcgactcctgtgccacttctcgggctgggtgcgcggaagaaatcgtcaggcatacggctgaattggaaaaaactccgtgcagcatccatatctagctggccgtcgtccctgcgcccatccacaaaaagattcgcggggaaggtggtctcgccgtaagcagtaaagaacctaaagtcaacaaaggagaaattggggttggtcgcaatggagtcttgaatgcgcttgaaacggagctcccccgcgacggtaagattgtattttcctcctccaaatcggttgctgtagtcaaccaactgttcgaagagcgtctcattgaaatcgtggttgttgccaaagaatgcgtcacctcgggtcatactggcgtcgccttcgaaggtgccatgctcattgagtccaccaacggaagcggggggtggtggatcaggcccagtgagccgcgtcttgcgtccgatgctcagcaagtccgtaatgagattgccgtccacaaggtgggccgcatatgtggcgaagattgcggcttgattgtcgaaattgaatccttcctgaaccgcgtttattatttgcgccggggttgcaacgccatttctcgggaggtacccgtgagatgccagagtattgagaccagggcaaggtccacgaatatcgccaggtcgaagcggcttccatgggtgagcctcgtcgttcaccaactttgcagagctattctcgagaggaccaggaggtaatcctggctctcgggcctcgagtgttgggattatagcgtccaattcctgctggctgaggccggccaatgaggcgtagtcaggaaaagcaacgacccccactgcgtagaccaaggttgggaacaggggaaaatatttcatctttaatgttacttctcttggagttagaactatgagaatactagtaaataaactacaaatcaactaaaatacaactgaatactcaaacgaaacttgcaattaaaacttgaaaacatttctgctagaaaaaatttttcaatctccttttatattcaaaaaaaatttacattatcgaaaaagggtatcccaagcaaaaaaaatttttttgaccactctaattattcaaaattgacacgccttctcaatgtcccagtactaaacagaaggaaaaaaaatttttttttttccttctcccgccagcgaaaagaaagaagttacttattccatcaattcaaagtttttcaaccttattacccggtcccgctcagaaccagtcgcatcccgccccactcctgtggcccagcttcccacttattttcggtatttttcgtttttttttccaattatgctacattgcttatacactggggcagaagccaggtctgggtgctgtgcgcctgtttctacgtattgtatatgaaactaattatcagatcagaaaaagaagataaaagaaaggtggatggatgtcgtatttgtgcggttgtttctggggtgaatttggttctctttagaaatttctgttgatgctatgctgcttgtttttttttgttgtgtttgtttttctttcctgctgttacttctttgcttcatcggtgttactagtggatcatccccacgcgccctgtagcgccccattaagcgcggcgggtgtggtggttacgcccagcgtgacccctacacttcccaccgccctagcccccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatgggggcatccgtttacccttccgatttactgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagaccctttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttggaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcgggctattcgttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaattt
wherein, the sequences of the related main functional fragments are as follows:
sequence of the TEF3 promoter (SEQ ID NO. 2):
5’-aacaccgatgaagcaaagaagtaacagcaggaaagaaaaacaaacacaacaaaaaaaaacaagcagcatagcatcaacagaaatttctaaagagaaccaaattcaccccagaaacaaccgcacaaatacgacatccatccacctttcttttatcttctttttctgatctgataattagtttcatatacaatacgtagaaacaggcgcacagcacccagacctggcttctgccccagtgtataagcaatgtagcataattggaaaaaaaaacgaaaaataccgaaaataagtgggaagctgggccacaggagtggggcgggatgcgactggttctgagcgggaccgggtaataaggttgaaaaactttgaattgatggaataagtaacttctttcttttcgctggcgggagaaggaaaaaaaaaaattttttttccttctgtttagtactgggacattgagaaggcgtgtcaattttgaataattagagtggtcaaaaaaattttttttgcttgggataccctttttcgataatgtaaattttttttgaatataaaaggagattgaaaaattttttctagcagaaatgttttcaagttttaattgcaagtttcgtttgagtattcagttgtattttagttgatttgtagtttatttactagtattctcatagttctaactccaagagaagtaacattaaag-3’
sequence of oxidase gene A (SEQ ID NO. 3):
5’-atgaaatattttcccctgttcccaaccttggtctacgcagtgggggtcgttgcttttcctgactacgcctcattggccggcctcagccagcaggaattggacgctataatcccaacactcgaggcccgagagccaggattacctcctggtcctctcgagaatagctctgcaaagttggtgaacgacgaggctcacccatggaagccgcttcgacctggcgatattcgtggaccttgccctggtctcaatactctggcatctcacgggtacctcccgagaaatggcgttgcaaccccggcgcaaataataaacgcggttcaggaaggattcaatttcgacaatcaagccgcaatcttcgccacatatgcggcccaccttgtggacggcaatctcattacggacttgctgagcatcggacgcaagacgcggctcactgggcctgatccaccaccccccgcttccgttggtggactcaatgagcatggcaccttcgaaggcgacgccagtatgacccgaggtgacgcattctttggcaacaaccacgatttcaatgagacgctcttcgaacagttggttgactacagcaaccgatttggaggaggaaaatacaatcttaccgtcgcgggggagctccgtttcaagcgcattcaagactccattgcgaccaaccccaatttctcctttgttgactttaggttctttactgcttacggcgagaccaccttccccgcgaatctttttgtggatgggcgcagggacgacggccagctagatatggatgctgcacggagttttttccaattcagccgtatgcctgacgatttcttccgcgcacccagcccgagaagtggcacaggagtcgaggtagttgtacaggctcatcctatgcagcccggaagaaatgtcggcaagatcaacagctacaccgtcgacccaacatcctctgacttttccaccccctgcttgatgtacgagaaattcgtcaacataacggtcaagtcactctacccgaatccgacggtgcagcttcgcaaagcccttaatacgaatctcgatttcttattccagggagtcgccgctggatgtacccaggtcttcccatacgggcgagat-3’
sequence of CYC terminator (SEQ ID NO. 4):
5’-tcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgc-3’
sequence of trophic gene a (SEQ ID No. 5):
5’-ttcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaatctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaa-3’
sequence of ampicillin resistance gene (SEQ ID NO. 6):
5’-atgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgatacactattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagagtgacaccacgatgcctgtagcaatgccaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcgctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa-3’
replicon sequence (SEQ ID NO. 7):
5’-ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaa-3’
wherein, the TEF3 promoter and the nutritional gene A are connected through the following sequence (SEQ ID NO. 8):
actagtggatcatccccacgcgccctgtagcgccccattaagcgcggcgggtgtggtggttacgcccagcgtgacccctacacttcccaccgccctagcccccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatgggggcatccgtttacccttccgatttactgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagaccctttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttggaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcgggctattcgttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttaaatatttgcttatacaatcttcctgtttttggggcttttctgattatcaaccggatacgacgcctggagctcctttcatttctgataaaagtaaggtttctctatttatcttttcacccacattatccttcgaagtacgtatacaatattagttcaacgtaaaaacaaaacttactgtaaatatgcgtaaaaaaaatctattaaattcatagcagtttcaaggaaagagaaccattatggtctggtcacgtgtgtataaattattaattttaacactatataatttattatttttttattttgaagtttagagtaattttagtagtattttatattttaaataaatatattttaaatttttacttaatattttattatttttaatacaatgtttttatttaaaacaaaattataaattaaaatgttgttccgaaagtaaaatatattttatggttttacaaaaataaattatttttaatgtattttttaattatattttgtatgtaattatatccacaggtattatgttgaatttagctgttttagtttacctgtgtggtactatgagttttgcctctcaaaagctatttttagaactctctctctcttagaaataggtggtgttgcggttgacttttaacgatatatcattttcaatttatttattttaaagtgacatagagagattccttttaatttttaatttttattttcaataattttaaaatggggacttttagattggaacaaaatgaaaatatctgttatacgtgcaactgaattttactgaccttaaaggactatctcgaacttggttcggaaatccttgaaatgattgatattttggtggattttctctgattttcaaacaagtagtattttatttaatatttattatattttttacatttttttatatttttttattgtttggaagggaaagcaacaattactttcaaaatatataaattaaactgaaatacttaataagagacaaataacattcaagaatcaaatactgggttattaatcaaaagatctctctacatgcacccaaattcactatttaaatttactataccactgacagaatatatgaacccagattaagtagccagaggctcttccactatattgagtatatagccttacatattttctgcgcataattttctggatgtaaaataaacaaaaatagttagtttgtagttatgaaaaaaggcttttggaaaatgcggaatacgtgttatttaaggttaatcaacaaaacgcatatccatagtggatagttggataaaacttcaattgatggcgaattctgattgctcatctttgacagcttatcatcgataagctagcttttcaa
the nutrient gene A and the ampicillin resistance gene are connected by the following sequence (SEQ ID NO. 9):
aaaactgtattataagtaaatgcatgtatactaaactcacaaattagagcttcaatttaattatatcagttattacccattgaaaaaggaagagt
the ampicillin-resistant gene and the replicon were linked by the following sequence (SEQ ID NO. 10):
ctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttc
the replicon and CYC terminators were linked by the following sequence (SEQ ID No. 11):
aacgccagcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagggccgcagctt
the CYC terminator and the oxidase gene A are linked by the following sequence (SEQ ID NO. 12):
tgcggccctctaggatcagcgggtttaaactcaatggtgatggtgatgatgaccggtacgcgtagaatcgagaccgaggagagggttagggataggcttaccttcgaagggccctctagattaatgatgatgatgatgatg
the oxidase gene A and the TEF3 promoter are connected end to end;
example 2 construction of recombinant bacteria of the invention and production of oxidase A protein
The recombinant vector pSUS1YTPC prepared in example 1 was transferred into a URA3 auxotrophic Kluyveromyces marxianus.
A single colony was picked, cultured in YP liquid medium (yeast extract 1%, peptone 2%) at 30 ℃ for 24-48h at 200rpm, yeast cell wall was treated with dextranase, and centrifuged at 8000rpm for 5min to obtain a culture supernatant containing oxidase A.
Example 3 vector of the present invention not containing target Gene
Target genes in example 1: the oxidase A gene can be replaced by other target genes, and the capability of the vector for expressing the foreign gene in Kluyveromyces marxianus is not influenced.
The empty vector sequence without the target gene of the present invention is as follows (SEQ ID NO. 13), i.e., the oxidase A gene sequence is removed from the recombinant vector sequence of example 1, and the CYC terminator and the TEF3 promoter are directly linked by the sequence shown in SEQ ID NO. 12.
aaatatttgcttatacaatcttcctgtttttggggcttttctgattatcaaccggatacgacgcctggagctcctttcatttctgataaaagtaaggtttctctatttatcttttcacccacattatccttcgaagtacgtatacaatattagttcaacgtaaaaacaaaacttactgtaaatatgcgtaaaaaaaatctattaaattcatagcagtttcaaggaaagagaaccattatggtctggtcacgtgtgtataaattattaattttaacactatataatttattatttttttattttgaagtttagagtaattttagtagtattttatattttaaataaatatattttaaatttttacttaatattttattatttttaatacaatgtttttatttaaaacaaaattataaattaaaatgttgttccgaaagtaaaatatattttatggttttacaaaaataaattatttttaatgtattttttaattatattttgtatgtaattatatccacaggtattatgttgaatttagctgttttagtttacctgtgtggtactatgagttttgcctctcaaaagctatttttagaactctctctctcttagaaataggtggtgttgcggttgacttttaacgatatatcattttcaatttatttattttaaagtgacatagagagattccttttaatttttaatttttattttcaataattttaaaatggggacttttagattggaacaaaatgaaaatatctgttatacgtgcaactgaattttactgaccttaaaggactatctcgaacttggttcggaaatccttgaaatgattgatattttggtggattttctctgattttcaaacaagtagtattttatttaatatttattatattttttacatttttttatatttttttattgtttggaagggaaagcaacaattactttcaaaatatataaattaaactgaaatacttaataagagacaaataacattcaagaatcaaatactgggttattaatcaaaagatctctctacatgcacccaaattcactatttaaatttactataccactgacagaatatatgaacccagattaagtagccagaggctcttccactatattgagtatatagccttacatattttctgcgcataattttctggatgtaaaataaacaaaaatagttagtttgtagttatgaaaaaaggcttttggaaaatgcggaatacgtgttatttaaggttaatcaacaaaacgcatatccatagtggatagttggataaaacttcaattgatggcgaattctgattgctcatctttgacagcttatcatcgataagctagcttttcaattcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaatctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaaaaaactgtattataagtaaatgcatgtatactaaactcacaaattagagcttcaatttaattatatcagttattacccattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgatacactattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagagtgacaccacgatgcctgtagcaatgccaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcgctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagggccgcagcttgcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaattacatgatgcggccctctaggatcagcgggtttaaactcaatggtgatggtgatgatgaccggtacgcgtagaatcgagaccgaggagagggttagggataggcttaccttcgaagggccctctagattaatgatgatgatgatgatgctttaatgttacttctcttggagttagaactatgagaatactagtaaataaactacaaatcaactaaaatacaactgaatactcaaacgaaacttgcaattaaaacttgaaaacatttctgctagaaaaaatttttcaatctccttttatattcaaaaaaaatttacattatcgaaaaagggtatcccaagcaaaaaaaatttttttgaccactctaattattcaaaattgacacgccttctcaatgtcccagtactaaacagaaggaaaaaaaatttttttttttccttctcccgccagcgaaaagaaagaagttacttattccatcaattcaaagtttttcaaccttattacccggtcccgctcagaaccagtcgcatcccgccccactcctgtggcccagcttcccacttattttcggtatttttcgtttttttttccaattatgctacattgcttatacactggggcagaagccaggtctgggtgctgtgcgcctgtttctacgtattgtatatgaaactaattatcagatcagaaaaagaagataaaagaaaggtggatggatgtcgtatttgtgcggttgtttctggggtgaatttggttctctttagaaatttctgttgatgctatgctgcttgtttttttttgttgtgtttgtttttctttcctgctgttacttctttgcttcatcggtgttactagtggatcatccccacgcgccctgtagcgccccattaagcgcggcgggtgtggtggttacgcccagcgtgacccctacacttcccaccgccctagcccccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatgggggcatccgtttacccttccgatttactgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagaccctttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttggaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcgggctattcgttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaattt
Comparative example 1 recombinant vector pKUPS6NPC
A recombinant vector pKSUPS 6NPC with the following sequence (SEQ ID NO. 14) was constructed as shown in FIG. 2:
gccaagcttgcatgcatcactaatgaaaagcatacgacgcctggagctcctttctgatccaagtctgaaggttggtttggcactaactttactcttgttatattcagaattgtatcaagtttatttgttagagtggagcctttttttatccgtaacactttttccctgctccattttgaaaaacgatttaaggccatcttggctattccgaatgaatttggaatatgtttaaattaataaaaaaaaataaaataaaataaaataaaataaaaattaaatcaaattaaattaaattaaattaaattaaattaaataaaaataaatacaaccaatacaaccaatacaacatggtagtattcttgcgtcgtaatgaatattaaatatcactttattaatctcatcgtgttttattgtttttgtaaggactttaatatatttgaatcaatattctttcaattactagtactttttttatatgactaaaattgttacacattggactgacagttatttttaaaatttatgatttattcttactttatatctttaaaagtagaaatattatacggacgctttgaatgaaattgacaacttatcttactagtgtgaatcaaccctatcgatgtagtactctcaaaatacggccttcttgataaagtgttaaattcatttgggtaatgatttttcgaaaaccacattgaatgaacgatttaaataaatataggatgcaagagcattttaataattcagaaacaaacaaattattaaacaggagcagttgaacggtatgttagcgagttttgtaaagggtgagtacatttatagctctattgaacataataaatacatataaatagtattttttgaccctctatgaagatggcttaccagcaacttatgtgttttaattcacgtgactactaaacaaaaaaatatgttatttaaaaaatatttatttaaatttttaaactattatagattatttgtgaatacattattttttaatttattaattaaaagaattgctatttaattaaaataagaataaaagctttytatttttttaaaagaaaaatatattaaaaacacttttccgaaagttaaaataattttatacttatcggtagctgcaatttatagacataatattttatatttttttaaaatttattattattttgtttgaaataataacgttggtgagtgtttaaggtgaactaagactgaaggcgaattctgattgtaagtagtcaaacaaattgtgttgaaaagctggctccactgatctgactgggaaattattcagggtagtcaagtatgtggtataaagaactaccccagcaagggaatttgccaccaaaggaggcaatattctatcaggaataactttccacccatacttatttagggccttagtaactattccaatggaggaattttcgaagtagtatgtatatttgggactccaaaacttatattttgaacgtcgtaccttagaatccttatttgtatcatcactcccagtcaacagtactcgaatataatgcgtatagtcaaatctggccggtcgaaacagttttaatggagttctcatatagaatgaagtcatctgataaaccatagatcttccaccagcagttaaagcaccaacaagtgacgaattctgattggaaagaccattctgctttacttttagagcatcttggtcttctgagctcattatacctcaatcaaaactgaaattaggtgcctgtcacggctctttttttactgtacctgtgacttcctttcttatttccaaggatgctcatcacaatacgcttctagatctattatgcattataattaatagttgtagctacaaaaggtaaaagaaagtccggggcaggcaacaatagaaatcggcaaaaaaaactacagaaatactaagagcttcttccccattcagtcatcgcatttcgaaacaagaggggaatggctctggctagggaactaaccaccatcgcctgactctatgcactaaccacgtgactacatatatgtgatcgtttttaacatttttcaaaggctgtgtgtctggctgtttccattaattttcactgattaagcagtcatattgaatctgagctcatcaccaacaagaaatactaccgtaaaagtgtaaaagttcgtttaaatcatttgtaaactggaacagcaagaggaagtatcatcagctagccccataaactaatcaaaggaggatgtcgactaagagttactcggaaagagcagctgctcatagaagtccagttgctgccaagcttttaaacttgatggaagagaagaagtcaaacttatgtgcttctcttgatgttcgtaaaacagcagagttgttaagattagttgaggttttgggtccatatatctgtctattgaagacacatgtagatatcttggaggatttcagctttgagaataccattgtgccgttgaagcaattagcagagaaacacaagtttttgatatttgaagacaggaagtttgccgacattgggaacactgttaaattacaatacacgtctggtgtataccgtatcgccgaatggtctgatatcaccaatgcacacggtgtgactggtgcgggcattgttgctggtttgaagcaaggtgccgaggaagttacgaaagaacctagagggttgttaatgcttgccgagttatcgtccaaggggtctctagcgcacggtgaatacactcgtgggaccgtggaaattgccaagagtgataaggactttgttattggatttattgctcaaaacgatatgggtggaagagaagagggctacgattggttgatcatgacgccaggtgttggtcttgatgacaaaggtgatgctttgggacaacaatacagaactgtggatgaagttgttgccggtggatcagacatcattattgttggtagaggtcttttcgcaaagggaagagatcctgtagtggaaggtgagagatacagaaaggcgggatgggacgcttacttgaagagagtaggcagatccgcttaagagttctccgagaacaagcagaggttcgagtgtactcggatcagaagttacaagttgatcgtttatatataaactatacagagatgttagagtgtaatggcattgcgcacattgtatacgctacaagtttagtcacgtgctagaagctgttttttgcaccgaaaatttttttttttttgttttttggtgaagtacattatgtgaaatttcacaaccaaagaaaaagagtttaatacaagtgcgaagaaccaaaccttgcttcttagtccattgaccgttataaaagatacacatttctgcgcgcgcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaattacatgatgcggccctctaggatcagcgggtttaaactcaatggtgatggtgatgatgaccggtacgcgtagaatcgagaccgaggagagggttagggataggcttaccttcgaagggccctctagattaatgatgatgatgatgatgatctcgcccgtatgggaagacctgggtacatccagcggcgactccctggaataagaaatcgagattcgtattaagggctttgcgaagctgcaccgtcggattcgggtagagtgacttgaccgttatgttgacgaatttctcgtacatcaagcagggggtggaaaagtcagaggatgttgggtcgacggtgtagctgttgatcttgccgacatttcttccgggctgcataggatgagcctgtacaactacctcgactcctgtgccacttctcgggctgggtgcgcggaagaaatcgtcaggcatacggctgaattggaaaaaactccgtgcagcatccatatctagctggccgtcgtccctgcgcccatccacaaaaagattcgcggggaaggtggtctcgccgtaagcagtaaagaacctaaagtcaacaaaggagaaattggggttggtcgcaatggagtcttgaatgcgcttgaaacggagctcccccgcgacggtaagattgtattttcctcctccaaatcggttgctgtagtcaaccaactgttcgaagagcgtctcattgaaatcgtggttgttgccaaagaatgcgtcacctcgggtcatactggcgtcgccttcgaaggtgccatgctcattgagtccaccaacggaagcggggggtggtggatcaggcccagtgagccgcgtcttgcgtccgatgctcagcaagtccgtaatgagattgccgtccacaaggtgggccgcatatgtggcgaagattgcggcttgattgtcgaaattgaatccttcctgaaccgcgtttattatttgcgccggggttgcaacgccatttctcgggaggtacccgtgagatgccagagtattgagaccagggcaaggtccacgaatatcgccaggtcgaagcggcttccatgggtgagcctcgtcgttcaccaactttgcagagctattctcgagaggaccaggaggtaatcctggctctcgggcctcgagtgttgggattatagcgtccaattcctgctggctgaggccggccaatgaggcgtagtcaggaaaagcaacgacccccactgcgtagaccaaggttgggaacaggggaaaatatttcatttttgatttgtgtttaagcgagtgactgaagaatattattctatggttttttaagtctaaaatgaataatataataattataataaaagagttaaggagaaggaagaataggttttcaaaattctgaaacgtaccccctgtatatatactcaaaaaaaaatttctcgaccatctggtaatctatcgccaccacccacaggtctcctttttcgtttcgttccgtttctgaaaaagatctctagcaacaacaactagaaaaaaaaacactatctaaaaaaagttatttctggtggcatcttttctaaatttgtcaaaaaatcccacccgccctagaaaacacgcacggccgcgagatttccaaattggtattgcataaagaaagaaaaatgttgttttttttcttcacagttttcaccgtttcccaactgcccaattagaaaaaacaaaaacaacttgctttgcacgccgtggtctgcgtgtccaccaaaaataatacgtcttatttttttttattttttattttttgtagtttttcgtcatttcataaattttgctttttttcttttgctcttgtgcacaagaagaaatgccttagaaactgcgtacaaattcagtatacaactttacatgcttttaccacaaacaccagaaatctcgcaggatttaacaacactctcgaaagtccattcacactgcgtgggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccataaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagcccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtactatggttgctttgacgtatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagt
and cultured according to the method of example 2 to obtain a culture supernatant.
The beneficial effects of the present invention are demonstrated by the following experimental examples.
Experimental example 1 expression of oxidase Gene by recombinant vector of the present invention in Kluyveromyces marxianus Strain
1. Experimental methods
(1) The molecular weight of the protein expressed by the recombinant vector of example 2 and comparative example 1 was verified by polyacrylamide gel electrophoresis, wherein the protein standard (Marker) used was Shanghai's product, product number C520010, and the schematic diagram is shown in FIG. 3 (left).
(2) The activity of oxidase A protein was confirmed by taking 100. Mu.L of the culture supernatant of example 2 and comparative example 1, 0.3mM ABTS (2, 2' -biazobis-3-ethylbenzothiazoline-6-sulfonic acid), 1mM hydrogen peroxide, and supplementing 1mL of the solution with pH 4.2 citrate-phosphate buffer solution and reacting at room temperature for 5 min.
2. Results of the experiment
(1) The theoretical molecular weight of the oxidase A protein was 41kDa, and according to the results shown in FIG. 3 (right), the pSUS1NPC recombinant vector of example 1 of the present invention successfully expressed the protein having a molecular weight of 40kDa to 50kDa, while the pKSPS 6NPC of comparative example 1 failed to express the protein having a molecular weight of 40kDa to 50 kDa. The recombinant vector can successfully express the oxidase A protein.
(2) As a result, as shown in FIG. 4, it can be seen that the pSUS1YTPC recombinant vector of example 1 of the present invention has significantly higher protein activity than the pKUS 6NPC recombinant vector of comparative example 1.
The above results indicate that the recombinant vector of the present invention is a recombinant vector that can successfully and efficiently replicate and express foreign genes in Kluyveromyces marxianus strains.
In conclusion, the invention provides a recombinant vector which can successfully replicate and express the exogenous gene in the Kluyveromyces marxianus strain, can stably and efficiently produce the oxidase A protein, and has the value of industrial popularization and application.
Claims (10)
1. A vector comprising the following fragments linked in sequence: a nutritional gene A, a resistance gene, a replicon, a CYC terminator and a TEF3 promoter;
the sequence of the TEF3 promoter is shown as SEQ ID NO. 2;
the sequence of the CYC terminator is shown as SEQ ID NO. 4;
the sequence of the nutrition gene A is shown as SEQ ID NO. 5;
the sequence of the replicon is shown as SEQ ID NO. 7;
a sequence shown as SEQ ID NO.8 is connected between the TEF3 promoter and the nutritional gene A;
wherein, the CYC terminator and the TEF3 promoter are reversely connected.
2. The vector according to claim 1, wherein the resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a tetracycline resistance gene or a chloramphenicol resistance gene, preferably an ampicillin resistance gene, the sequence of which is shown in SEQ ID No. 6.
3. The vector of claim 1, wherein the sequence shown in SEQ ID No.9 is linked between the trophic gene a and the resistance gene;
and/or a sequence shown in SEQ ID NO.10 is connected between the resistance gene and the replicon;
and/or a sequence shown as SEQ ID NO.11 is connected between the replicon and the CYC terminator;
and/or a sequence shown as SEQ ID NO.12 is connected between the CYC terminator and the TEF3 promoter;
preferably, the sequence of the recombinant vector is shown as SEQ ID NO. 13.
4. Use of the vector of any one of claims 1 to 3 for expressing a foreign gene in kluyveromyces marxianus, preferably, the foreign gene is oxidase gene a.
5. A recombinant vector according to any one of claims 1 to 3, which comprises a gene of interest.
6. The recombinant vector according to claim 5, wherein the target gene is oxidase gene A, and the recombinant vector comprises the following fragments connected in sequence: a nutritional gene A, a resistance gene, a replicon, a CYC terminator, an oxidase gene A and a TEF3 promoter; the sequence of the oxidase gene A is shown in SEQ ID NO.3, and the oxidase gene A is reversely connected.
7. The recombinant vector according to claim 6, wherein the sequence of SEQ ID No.12 is linked between the CYC terminator and the oxidase gene A;
preferably, the sequence of the recombinant vector is shown in SEQ ID NO. 1.
8. Use of the recombinant vector according to any one of claims 5 to 7 for the preparation of recombinant kluyveromyces marxianus; preferably, the kluyveromyces marxianus is URA3 auxotroph kluyveromyces marxianus.
9. A recombinant bacterium characterized by comprising the recombinant vector of any one of claims 5 to 7; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
10. Use of the recombinant bacterium of claim 9 for preparing oxidase a protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211091347.2A CN115820709A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211091347.2A CN115820709A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115820709A true CN115820709A (en) | 2023-03-21 |
Family
ID=85523454
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211091347.2A Pending CN115820709A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820709A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117230091A (en) * | 2023-11-16 | 2023-12-15 | 四川大学华西第二医院 | Imine reductase IR11 or mutant and application thereof |
-
2022
- 2022-09-07 CN CN202211091347.2A patent/CN115820709A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117230091A (en) * | 2023-11-16 | 2023-12-15 | 四川大学华西第二医院 | Imine reductase IR11 or mutant and application thereof |
| CN117230091B (en) * | 2023-11-16 | 2024-01-19 | 四川大学华西第二医院 | Imine reductase IR11 or mutant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103088041B (en) | Cutinase gene capable of efficiently producing cutinase and application thereof | |
| CN105087614A (en) | Thermomyces lanuginosus lipase gene, engineering bacteria and application of engineering bacteria | |
| CN113265346A (en) | Genetically engineered bacterium for producing porcine myoglobin through fermentation and application thereof | |
| CN115820709A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN104789586A (en) | Escherichia coli genome integration vector, genetically engineered bacterium and application of genetically engineered bacterium to xylitol production | |
| EP0399455B1 (en) | Stably transformed yeast host cells and their use for the production of albumin | |
| Marten et al. | Localization of cloned invertase in Saccharomyces cerevisiae directed by the SUC2 and MFα1 signal sequences | |
| CN115820711A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN115851806A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN101487019A (en) | Candida utilis expression vector and construction method thereof | |
| CN115820710A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN103131718A (en) | Cloning of hypertonicity-resistant functional gene CgHog1 from Candida glycerinogenes and application thereof | |
| CN116179587A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116042690A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116042691A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116103328A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN102559730A (en) | Method for increasing expression of CP4-EPSPS in Hansenula polymorpha | |
| CN115806889A (en) | Saccharomyces cerevisiae engineering bacterium capable of improving gene expression level and construction method and application thereof | |
| CN103205403A (en) | Method for producing ligninolytic enzymes | |
| US20210309982A1 (en) | Materials and methods for creating strains of saccharomyces cerevisiae that exhibit an increased ability to ferment oligosaccharides into ethanol | |
| CN102533841B (en) | Method for increasing expression of bacillus thuringiensis(Bt) insecticidalcrystalprotein in hansenula polymorpha | |
| WO2018236294A1 (en) | Gene expression product for producing target proteins or bio-products from heat-tolerant yeast by methanol induction and non-induction including its process of product usage | |
| US20240084084A1 (en) | Promoter for yeast | |
| CN113462713B (en) | Method for improving expression level of glucagon-like peptide hexa-linked peptide in pichia pastoris | |
| CN112779174B (en) | Saccharomyces cerevisiae genetically engineered bacterium for knocking out Cln3 gene, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |