CN116042691A - Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain - Google Patents
Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain Download PDFInfo
- Publication number
- CN116042691A CN116042691A CN202211090749.0A CN202211090749A CN116042691A CN 116042691 A CN116042691 A CN 116042691A CN 202211090749 A CN202211090749 A CN 202211090749A CN 116042691 A CN116042691 A CN 116042691A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- seq
- kluyveromyces marxianus
- recombinant vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/60—Vectors containing traps for, e.g. exons, promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a vector capable of successfully replicating and expressing exogenous genes in Kluyveromyces marxianus strains, which comprises the following fragments connected in sequence: NC1 promoter, CYC terminator, replicon, resistance gene, nutrition gene A, and sequence shown in SEQ ID NO.8 is connected between nutrition gene A and NC1 promoter; wherein replicons, resistance genes, and trophic gene A are in reverse ligation. The invention also provides a recombinant vector composed of the vector and the oxidase A gene, and Kluyveromyces marxianus recombinant strain containing the recombinant vector can stably and efficiently produce protease with an oxidation function, and has the value of industrial popularization and application.
Description
Technical Field
The invention belongs to the field of genetic engineering, and in particular relates to a recombinant vector for expressing exogenous genes in a Kluyveromyces marxianus strain.
Background
With the continuous development of genetic engineering technology and molecular biology technology, various protein expression systems for expressing exogenous genes have appeared, and currently common use includes prokaryotic expression systems, yeast expression systems, insect expression systems, mammalian cell expression systems and the like. The prokaryotic expression technology is represented by an escherichia coli expression system, has the advantages of clear genetic background, low cost, high expression quantity, simple product separation and purification and the like, and is mature at present. Therefore, the use of eukaryotic expression systems to express proteins is becoming increasingly important to researchers.
The gene products of the insect and mammal cell expression systems have good authenticity, but are difficult to operate, low in yield and high in cost, and are not suitable for large-scale production; therefore, eukaryotic expression systems based on yeast expression systems are becoming an important tool for basic research and industrial production.
Currently, the commonly used yeast expression systems are typically represented by the transient expression system Saccharomyces cerevisiae (Saccharomyces cerevisiae) and the stable expression system Pichia pastoris (Pichia pastoris). Saccharomyces cerevisiae has low growth density, is not easy to ferment on a large scale, has weak capability of secreting molecular weight of more than 30kDa and long growth period. Pichia pastoris needs to be induced and expressed by methanol, and has dangerous factors in the fermentation process and long growth period. Therefore, the development of a yeast expression system with short growth cycle, high protein expression and high safety has potential industrial value.
Kluyveromyces marxianus (Kluyveromyces marxianus) belongs to Kluyveromyces of the family Saccharomyces, is food safety-grade yeast, has various physiological and biochemical characteristics of quick growth, high temperature resistance and the like, has realized the expression of a plurality of exogenous proteins in Kluyveromyces marxianus, such as alpha-galactosidase, lactose dehydrogenase, thermostable cellulase and the like (Guo Chao, chen Yongyi, zhou Jungang, and the like at present by utilizing a genetic engineering technology, is a traceless genome modification method [ J ] of the Kluyveromyces marxianus (Kluyveromyces marxianus), is a complex denier academy (natural science edition), 2016,55 (5): 576-586), and has shown good potential in the expression of exogenous proteins.
The oxidase has important significance for green synthesis of chemical and medical important compounds, and no report has been reported at present that Kluyveromyces marxianus can express the oxidase with activity. Thus, the development of a kluyveromyces marxianus-based system for expressing active oxidases is potentially valuable.
For a novel expression system of Kluyveromyces marxianus, the degree of research on physiological characteristics and genetic characteristics of the novel expression system is limited, and reports on recombinant vectors capable of being used for exogenous gene expression are few; the existing reported recombinant vectors for expressing exogenous genes in Kluyveromyces marxianus strains are limited in design type and variety, for example, the recombinant vectors disclosed in patent application CN105063082A, CN105063081A, CN105132452A, CN105063080A and the like are designed based on pKD1 fragments.
Therefore, the development of novel recombinant vectors capable of efficiently expressing oxidase in Kluyveromyces marxianus strains is worthy of further exploration.
Disclosure of Invention
The invention aims to provide a recombinant vector for expressing exogenous genes in Kluyveromyces marxianus strains.
The invention provides a vector comprising the following fragments connected in sequence: NC1 promoter, CYC terminator, replicon, resistance gene, and trophic gene a;
the sequence of the NC1 promoter is shown as SEQ ID NO. 2;
the sequence of the CYC terminator is shown in SEQ ID NO. 4;
the sequence of the nutrition gene A is shown as SEQ ID NO. 5;
the sequence of the replicon is shown as SEQ ID NO. 7;
the sequence shown in SEQ ID NO.8 is connected between the nutrition gene A and the NC1 promoter;
wherein replicons, resistance genes, and trophic gene A are in reverse ligation.
Further, the above-mentioned resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a tetracycline resistance gene or a chloramphenicol resistance gene, preferably an ampicillin resistance gene, the sequence of which is shown in SEQ ID NO. 6.
Further, a sequence shown in SEQ ID NO.9 is connected between the NC1 promoter and the CYC terminator;
and/or a sequence shown in SEQ ID NO.10 is connected between the CYC terminator and the replicon;
and/or the sequence shown in SEQ ID NO.11 is connected between the replicon and the resistance gene;
and/or the sequence shown in SEQ ID NO.12 is connected between the resistance gene and the nutrition gene A, preferably, the sequence of the recombinant vector is shown in SEQ ID NO. 13.
The invention also provides application of the vector in expressing exogenous genes in Kluyveromyces marxianus, and preferably, the exogenous genes are oxidase genes A.
The invention also provides a recombinant vector which is the vector containing the target gene.
Further, the target gene is oxidase gene A, and the recombinant vector contains the following fragments connected in sequence: NC1 promoter, oxidase gene A, CYC terminator, replicon, resistance gene, and nutritional gene a; the sequence of the oxidase gene A is shown as SEQ ID NO. 3.
Further, a sequence shown in SEQ ID NO.9 is connected between the oxidase gene A and the CYC terminator;
preferably, the sequence of the recombinant vector is shown as SEQ ID NO. 1.
The invention also provides application of the recombinant vector in preparation of recombinant kluyveromyces marxianus; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
The invention also provides a recombinant strain which is Kluyveromyces marxianus containing the recombinant vector; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
The invention also provides application of the recombinant bacterium in preparing oxidase A protein.
The invention selects oxidase A as an expression object.
Description of the invention terminology: "reverse connection": each fragment sequence given in the specification of the present invention is expressed in the direction of the 5 '. Fwdarw.3' end. The definition of "reverse ligation" in the claims means that the fragment is inserted into the vector in a direction opposite to the sequence of the fragment given in the specification, i.e., expressed as its reverse complement in the vector.
The invention has the beneficial effects that: the invention provides a recombinant vector capable of successfully replicating and expressing exogenous genes in Kluyveromyces marxianus strains, can stably and efficiently produce oxidase A protein, and has the value of industrial popularization and application.
It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.
Drawings
FIG. 1 is a map of recombinant vector pSUS6 YNPC.
FIG. 2 is a map of recombinant vector pKUPS6 NPC.
FIG. 3 shows the results of polyacrylamide gel electrophoresis of the protein standard (left) and the recombinant vector pSUS6YNPC and the recombinant vector pKUPS6NPC expressed proteins (right).
FIG. 4 shows the activity assay of oxidase A protein expressed by recombinant vector pSUS6YNPC and recombinant vector pKUPS6 NPC.
Detailed Description
The raw materials and equipment used in the invention are all known products and are obtained by purchasing commercial products. The carrier of the invention is entrusted to synthesis by Duqing biological company.
The URA3 auxotroph Kluyveromyces marxianus used in the embodiment of the invention is a CDs knockout of 168bp length of URA3 gene in Kluyveromyces marxianus CBS6556 by utilizing a homologous recombination technology, and the constructed URA3 auxotroph strain has the method reference: loBs A K, engel R, schwartz C, et al CRISPR-Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus [ J ]. Biotechnology for Biofuels,2017,10 (1), (DOI: 10.1186/s 13068-017-0854-5).
EXAMPLE 1 construction of recombinant vectors of the invention
The total gene synthesis recombinant vector pSUS6YNPC is shown in figure 1,
the sequence is as follows (SEQ ID NO. 1):
aaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaacgaatagcccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttccaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaagggtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcagtaaatcggaagggtaaacggatgcccccatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggggctagggcggtgggaagtgtaggggtcacgctgggcgtaaccaccacacccgccgcgcttaatggggcgctacagggcgcgtggggatgatccactagtccacgcagtgtgaatggactttcgagagtgttgttaaatcctgcgagatttctggtgtttgtggtaaaagcatgtaaagttgtatactgaatttgtacgcagtttctaaggcatttcttcttgtgcacaagagcaaaagaaaaaaagcaaaatttatgaaatgacgaaaaactacaaaaaataaaaaataaaaaaaaataagacgtattatttttggtggacacgcagaccacggcgtgcaaagcaagttgtttttgttttttctaattgggcagttgggaaacggtgaaaactgtgaagaaaaaaaacaacatttttctttctttatgcaataccaatttggaaatctcgcggccgtgcgtgttttctagggcgggtgggattttttgacaaatttagaaaagatgccaccagaaataactttttttagatagtgtttttttttctagttgttgttgctagagatctttttcagaaacggaacgaaacgaaaaaggagacctgtgggtggtggcgatagattaccagatggtcgagaaatttttttttgagtatatatacagggggtacgtttcagaattttgaaaacctattcttccttctccttaactcttttattataattattatattattcattttagacttaaaaaaccatagaataatattcttcagtcactcgcttaaacacaaatcaaaaatgaaatattttcccctgttcccaaccttggtctacgcagtgggggtcgttgcttttcctgactacgcctcattggccggcctcagccagcaggaattggacgctataatcccaacactcgaggcccgagagccaggattacctcctggtcctctcgagaatagctctgcaaagttggtgaacgacgaggctcacccatggaagccgcttcgacctggcgatattcgtggaccttgccctggtctcaatactctggcatctcacgggtacctcccgagaaatggcgttgcaaccccggcgcaaataataaacgcggttcaggaaggattcaatttcgacaatcaagccgcaatcttcgccacatatgcggcccaccttgtggacggcaatctcattacggacttgctgagcatcggacgcaagacgcggctcactgggcctgatccaccaccccccgcttccgttggtggactcaatgagcatggcaccttcgaaggcgacgccagtatgacccgaggtgacgcattctttggcaacaaccacgatttcaatgagacgctcttcgaacagttggttgactacagcaaccgatttggaggaggaaaatacaatcttaccgtcgcgggggagctccgtttcaagcgcattcaagactccattgcgaccaaccccaatttctcctttgttgactttaggttctttactgcttacggcgagaccaccttccccgcgaatctttttgtggatgggcgcagggacgacggccagctagatatggatgctgcacggagttttttccaattcagccgtatgcctgacgatttcttccgcgcacccagcccgagaagtggcacaggagtcgaggtagttgtacaggctcatcctatgcagcccggaagaaatgtcggcaagatcaacagctacaccgtcgacccaacatcctctgacttttccaccccctgcttgatgtacgagaaattcgtcaacataacggtcaagtcactctacccgaatccgacggtgcagcttcgcaaagcccttaatacgaatctcgatttcttattccagggagtcgccgctggatgtacccaggtcttcccatacgggcgagatcatcatcatcatcatcattaatctagagggcccttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcctagagggccgcatcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgcaagctgcggccctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaagcccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagcgcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttggcattgctacaggcatcgtggtgtcactctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataatagtgtatcacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatgggtaataactgatataattaaattgaagctctaatttgtgagtttagtatacatgcatttacttataatacagttttttagttttgctggccgcatcttctcaaatatgcttcccagcctgcttttctgtaacgttcaccctctaccttagcatcccttccctttgcaaatagtcctcttccaacaataataatgtcagatcctgtagagaccacatcatccacggttctatactgttgacccaatgcgtctcccttgtcatctaaacccacaccgggtgtcataatcaaccaatcgtaaccttcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtacccttagtatattctccagtagatagggagcccttgcatgacaattctgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaaccgctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctattctgtatacacccgcagagtactgcaatttgactgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtacttggcggataatgcctttagcggcttaactgtgccctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacctaatgcttcaactaactccagtaattccttggtggtacgaacatccaatgaagcacacaagtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacaggactaggatgagtagcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcctgcaggtttttgttctgtgcagttgggttaagaatactgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcggagattaccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaattgaaaagctagcttatcgatgataagctgtcaaagatgagcaatcagaattcgccttcagtcttagttcaccttaaacactcaccaacgttattatttcaaacaaaataataataaattttaaaaaaatataaaatattatgtctataaattgcagctaccgataagtataaaattattttaactttcggaaaagtgtttttaatatatttttcttttaaaaaaataraaagcttttattcttattttaattaaatagcaattcttttaattaataaattaaaaaataatgtattcacaaataatctataatagtttaaaaatttaaataaatattttttaaataacatatttttttgtttagtagtcacgtgaattaaaacacataagttgctggtaagccatcttcatagagggtcaaaaaatactatttatatgtatttattatgttcaatagagctataaatgtactcaccctttacaaaactcgctaacataccgttcaactgctcctgtttaataatttgtttgtttctgaattattaaaatgctcttgcatcctatatttatttaaatcgttcattcaatgtggttttcgaaaaatcattacccaaatgaatttaacactttatcaagaaggccgtattttgagagtactacatcgatagggttgattcacactagtaagataagttgtcaatttcattcaaagcgtccgtataatatttctacttttaaagatataaagtaagaataaatcataaattttaaaaataactgtcagtccaatgtgtaacaattttagtcatataaaaaaagtactagtaattgaaagaatattgattcaaatatattaaagtccttacaaaaacaataaaacacgatgagattaataaagtgatatttaatattcattacgacgcaagaatactaccatgttgtattggttgtattggttgtatttatttttatttaatttaatttaatttaatttaatttaatttgatttaatttttattttattttattttattttatttttttttattaatttaaacatattccaaattcattcggaatagccaagatggccttaaatcgtttttcaaaatggagcagggaaaaagtgttacggataaaaaaaggctccactctaacaaataaacttgatacaattctgaatataacaagagtaaagttagtgccaaaccaaccttcagacttggatcactccaggcgtcgtatccggttgataatcagaaaagccccaaaaacaggaagattgtataagcaaatattt
wherein the main functional fragment sequences involved are as follows:
NC1 promoter sequence (SEQ ID No. 2):
5’-ccacgcagtgtgaatggactttcgagagtgttgttaaatcctgcgagatttctggtgtttgtggtaaaagcatgtaaagttgtatactgaatttgtacgcagtttctaaggcatttcttcttgtgcacaagagcaaaagaaaaaaagcaaaatttatgaaatgacgaaaaactacaaaaaataaaaaataaaaaaaaataagacgtattatttttggtggacacgcagaccacggcgtgcaaagcaagttgtttttgttttttctaattgggcagttgggaaacggtgaaaactgtgaagaaaaaaaacaacatttttctttctttatgcaataccaatttggaaatctcgcggccgtgcgtgttttctagggcgggtgggattttttgacaaatttagaaaagatgccaccagaaataactttttttagatagtgtttttttttctagttgttgttgctagagatctttttcagaaacggaacgaaacgaaaaaggagacctgtgggtggtggcgatagattaccagatggtcgagaaatttttttttgagtatatatacagggggtacgtttcagaattttgaaaacctattcttccttctccttaactcttttattataattattatattattcattttagacttaaaaaaccatagaataatattcttcagtcactcgcttaaacacaaatcaaaa-3’
sequence of oxidase gene A (SEQ ID NO. 3):
5’-atgaaatattttcccctgttcccaaccttggtctacgcagtgggggtcgttgcttttcctgactacgcctcattggccggcctcagccagcaggaattggacgctataatcccaacactcgaggcccgagagccaggattacctcctggtcctctcgagaatagctctgcaaagttggtgaacgacgaggctcacccatggaagccgcttcgacctggcgatattcgtggaccttgccctggtctcaatactctggcatctcacgggtacctcccgagaaatggcgttgcaaccccggcgcaaataataaacgcggttcaggaaggattcaatttcgacaatcaagccgcaatcttcgccacatatgcggcccaccttgtggacggcaatctcattacggacttgctgagcatcggacgcaagacgcggctcactgggcctgatccaccaccccccgcttccgttggtggactcaatgagcatggcaccttcgaaggcgacgccagtatgacccgaggtgacgcattctttggcaacaaccacgatttcaatgagacgctcttcgaacagttggttgactacagcaaccgatttggaggaggaaaatacaatcttaccgtcgcgggggagctccgtttcaagcgcattcaagactccattgcgaccaaccccaatttctcctttgttgactttaggttctttactgcttacggcgagaccaccttccccgcgaatctttttgtggatgggcgcagggacgacggccagctagatatggatgctgcacggagttttttccaattcagccgtatgcctgacgatttcttccgcgcacccagcccgagaagtggcacaggagtcgaggtagttgtacaggctcatcctatgcagcccggaagaaatgtcggcaagatcaacagctacaccgtcgacccaacatcctctgacttttccaccccctgcttgatgtacgagaaattcgtcaacataacggtcaagtcactctacccgaatccgacggtgcagcttcgcaaagcccttaatacgaatctcgatttcttattccagggagtcgccgctggatgtacccaggtcttcccatacgggcgagat-3’
the sequence of the CYC terminator (SEQ ID NO. 4):
5’-tcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgc-3’
sequence of trophic gene A (SEQ ID NO. 5):
5’-ttcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgattcggtaatctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaa-3’
sequence of ampicillin resistance gene (SEQ ID NO. 6):
5’-atgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa-3’
sequence of replicon (SEQ ID No. 7):
5’-ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaa-3’
wherein, the liquid crystal display device comprises a liquid crystal display device,
the NC1 promoter and the oxidase gene A are connected end to end;
the trophic gene A and NC1 promoters are linked by the following sequence (SEQ ID NO. 8):
ttgaaaagctagcttatcgatgataagctgtcaaagatgagcaatcagaattcgccttcagtcttagttcaccttaaacactcaccaacgttattatttcaaacaaaataataataaattttaaaaaaatataaaatattatgtctataaattgcagctaccgataagtataaaattattttaactttcggaaaagtgtttttaatatatttttcttttaaaaaaataraaagcttttattcttattttaattaaatagcaattcttttaattaataaattaaaaaataatgtattcacaaataatctataatagtttaaaaatttaaataaatattttttaaataacatatttttttgtttagtagtcacgtgaattaaaacacataagttgctggtaagccatcttcatagagggtcaaaaaatactatttatatgtatttattatgttcaatagagctataaatgtactcaccctttacaaaactcgctaacataccgttcaactgctcctgtttaataatttgtttgtttctgaattattaaaatgctcttgcatcctatatttatttaaatcgttcattcaatgtggttttcgaaaaatcattacccaaatgaatttaacactttatcaagaaggccgtattttgagagtactacatcgatagggttgattcacactagtaagataagttgtcaatttcattcaaagcgtccgtataatatttctacttttaaagatataaagtaagaataaatcataaattttaaaaataactgtcagtccaatgtgtaacaattttagtcatataaaaaaagtactagtaattgaaagaatattgattcaaatatattaaagtccttacaaaaacaataaaacacgatgagattaataaagtgatatttaatattcattacgacgcaagaatactaccatgttgtattggttgtattggttgtatttatttttatttaatttaatttaatttaatttaatttaatttgatttaatttttattttattttattttattttatttttttttattaatttaaacatattccaaattcattcggaatagccaagatggccttaaatcgtttttcaaaatggagcagggaaaaagtgttacggataaaaaaaggctccactctaacaaataaacttgatacaattctgaatataacaagagtaaagttagtgccaaaccaaccttcagacttggatcactccaggcgtcgtatccggttgataatcagaaaagccccaaaaacaggaagattgtataagcaaatatttaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaacgaatagcccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttccaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaagggtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcagtaaatcggaagggtaaacggatgcccccatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggggctagggcggtgggaagtgtaggggtcacgctgggcgtaaccaccacacccgccgcgcttaatggggcgctacagggcgcgtggggatgatccactagt
the oxidase gene A and the CYC terminator are linked by the following sequence (SEQ ID NO. 9):
catcatcatcatcatcattaatctagagggcccttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcctagagggccgca
the CYC terminator and replicon are linked by the following sequence (SEQ ID NO. 10):
aagctgcggccctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaagcccaggaaccgtaaaaaggccgcgttgctggcgtt
the replicon and the ampicillin resistance gene were linked by the following sequence (SEQ ID NO. 11):
gaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacag
the ampicillin resistance gene and the trophic gene A were linked by the following sequence (SEQ ID NO. 12):
actcttcctttttcaatgggtaataactgatataattaaattgaagctctaatttgtgagtttagtatacatgcatttacttataatacagtttt
EXAMPLE 2 construction of recombinant bacterium of the present invention and production of oxidase A protein
The recombinant vector pSUS6YNPC prepared in example 1 was transferred into URA3 auxotrophic Kluyveromyces marxianus.
Single colonies were picked, cultured in YP liquid medium (yeast extract 1%, peptone 2%) at 30℃and 200rpm for 24-48 hours, and the yeast cell walls were treated with glucanase, and centrifuged at 8000rpm for 5 minutes to obtain a culture supernatant containing oxidase A.
EXAMPLE 3 vectors of the present invention not containing the target Gene
Target gene in example 1: the oxidase A gene can be replaced by other target genes, and the capability of the vector for expressing exogenous genes in Kluyveromyces marxianus is not affected.
The empty vector sequence without the target gene of the invention is shown as (SEQ ID NO. 13), namely, the sequence of oxidase A gene is removed from the recombinant vector sequence of example 1, and the NC1 promoter and the CYC terminator are directly connected through the sequence shown in SEQ ID NO. 9.
aaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaacgaatagcccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttccaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaagggtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcagtaaatcggaagggtaaacggatgcccccatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggggctagggcggtgggaagtgtaggggtcacgctgggcgtaaccaccacacccgccgcgcttaatggggcgctacagggcgcgtggggatgatccactagtccacgcagtgtgaatggactttcgagagtgttgttaaatcctgcgagatttctggtgtttgtggtaaaagcatgtaaagttgtatactgaatttgtacgcagtttctaaggcatttcttcttgtgcacaagagcaaaagaaaaaaagcaaaatttatgaaatgacgaaaaactacaaaaaataaaaaataaaaaaaaataagacgtattatttttggtggacacgcagaccacggcgtgcaaagcaagttgtttttgttttttctaattgggcagttgggaaacggtgaaaactgtgaagaaaaaaaacaacatttttctttctttatgcaataccaatttggaaatctcgcggccgtgcgtgttttctagggcgggtgggattttttgacaaatttagaaaagatgccaccagaaataactttttttagatagtgtttttttttctagttgttgttgctagagatctttttcagaaacggaacgaaacgaaaaaggagacctgtgggtggtggcgatagattaccagatggtcgagaaatttttttttgagtatatatacagggggtacgtttcagaattttgaaaacctattcttccttctccttaactcttttattataattattatattattcattttagacttaaaaaaccatagaataatattcttcagtcactcgcttaaacacaaatcaaaacatcatcatcatcatcattaatctagagggcccttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcctagagggccgcatcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgcaagctgcggccctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaagcccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagcgcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttggcattgctacaggcatcgtggtgtcactctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataatagtgtatcacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatgggtaataactgatataattaaattgaagctctaatttgtgagtttagtatacatgcatttacttataatacagttttttagttttgctggccgcatcttctcaaatatgcttcccagcctgcttttctgtaacgttcaccctctaccttagcatcccttccctttgcaaatagtcctcttccaacaataataatgtcagatcctgtagagaccacatcatccacggttctatactgttgacccaatgcgtctcccttgtcatctaaacccacaccgggtgtcataatcaaccaatcgtaaccttcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgtcgctcttcgcaatgtcaacagtacccttagtatattctccagtagatagggagcccttgcatgacaattctgctaacatcaaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaaccgctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctattctgtatacacccgcagagtactgcaatttgactgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtacttggcggataatgcctttagcggcttaactgtgccctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacctaatgcttcaactaactccagtaattccttggtggtacgaacatccaatgaagcacacaagtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacaggactaggatgagtagcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcctgcaggtttttgttctgtgcagttgggttaagaatactgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcggagattaccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaattgaaaagctagcttatcgatgataagctgtcaaagatgagcaatcagaattcgccttcagtcttagttcaccttaaacactcaccaacgttattatttcaaacaaaataataataaattttaaaaaaatataaaatattatgtctataaattgcagctaccgataagtataaaattattttaactttcggaaaagtgtttttaatatatttttcttttaaaaaaataraaagcttttattcttattttaattaaatagcaattcttttaattaataaattaaaaaataatgtattcacaaataatctataatagtttaaaaatttaaataaatattttttaaataacatatttttttgtttagtagtcacgtgaattaaaacacataagttgctggtaagccatcttcatagagggtcaaaaaatactatttatatgtatttattatgttcaatagagctataaatgtactcaccctttacaaaactcgctaacataccgttcaactgctcctgtttaataatttgtttgtttctgaattattaaaatgctcttgcatcctatatttatttaaatcgttcattcaatgtggttttcgaaaaatcattacccaaatgaatttaacactttatcaagaaggccgtattttgagagtactacatcgatagggttgattcacactagtaagataagttgtcaatttcattcaaagcgtccgtataatatttctacttttaaagatataaagtaagaataaatcataaattttaaaaataactgtcagtccaatgtgtaacaattttagtcatataaaaaaagtactagtaattgaaagaatattgattcaaatatattaaagtccttacaaaaacaataaaacacgatgagattaataaagtgatatttaatattcattacgacgcaagaatactaccatgttgtattggttgtattggttgtatttatttttatttaatttaatttaatttaatttaatttaatttgatttaatttttattttattttattttattttatttttttttattaatttaaacatattccaaattcattcggaatagccaagatggccttaaatcgtttttcaaaatggagcagggaaaaagtgttacggataaaaaaaggctccactctaacaaataaacttgatacaattctgaatataacaagagtaaagttagtgccaaaccaaccttcagacttggatcactccaggcgtcgtatccggttgataatcagaaaagccccaaaaacaggaagattgtataagcaaatattt
Comparative example 1, recombinant vector pKUPS6NPC
The recombinant vector pKUPS6NPC with the following sequence (SEQ ID NO. 14) was constructed as shown in FIG. 2:
gccaagcttgcatgcatcactaatgaaaagcatacgacgcctggagctcctttctgatccaagtctgaaggttggtttggcactaactttactcttgttatattcagaattgtatcaagtttatttgttagagtggagcctttttttatccgtaacactttttccctgctccattttgaaaaacgatttaaggccatcttggctattccgaatgaatttggaatatgtttaaattaataaaaaaaaataaaataaaataaaataaaataaaaattaaatcaaattaaattaaattaaattaaattaaattaaataaaaataaatacaaccaatacaaccaatacaacatggtagtattcttgcgtcgtaatgaatattaaatatcactttattaatctcatcgtgttttattgtttttgtaaggactttaatatatttgaatcaatattctttcaattactagtactttttttatatgactaaaattgttacacattggactgacagttatttttaaaatttatgatttattcttactttatatctttaaaagtagaaatattatacggacgctttgaatgaaattgacaacttatcttactagtgtgaatcaaccctatcgatgtagtactctcaaaatacggccttcttgataaagtgttaaattcatttgggtaatgatttttcgaaaaccacattgaatgaacgatttaaataaatataggatgcaagagcattttaataattcagaaacaaacaaattattaaacaggagcagttgaacggtatgttagcgagttttgtaaagggtgagtacatttatagctctattgaacataataaatacatataaatagtattttttgaccctctatgaagatggcttaccagcaacttatgtgttttaattcacgtgactactaaacaaaaaaatatgttatttaaaaaatatttatttaaatttttaaactattatagattatttgtgaatacattattttttaatttattaattaaaagaattgctatttaattaaaataagaataaaagctttytatttttttaaaagaaaaatatattaaaaacacttttccgaaagttaaaataattttatacttatcggtagctgcaatttatagacataatattttatatttttttaaaatttattattattttgtttgaaataataacgttggtgagtgtttaaggtgaactaagactgaaggcgaattctgattgtaagtagtcaaacaaattgtgttgaaaagctggctccactgatctgactgggaaattattcagggtagtcaagtatgtggtataaagaactaccccagcaagggaatttgccaccaaaggaggcaatattctatcaggaataactttccacccatacttatttagggccttagtaactattccaatggaggaattttcgaagtagtatgtatatttgggactccaaaacttatattttgaacgtcgtaccttagaatccttatttgtatcatcactcccagtcaacagtactcgaatataatgcgtatagtcaaatctggccggtcgaaacagttttaatggagttctcatatagaatgaagtcatctgataaaccatagatcttccaccagcagttaaagcaccaacaagtgacgaattctgattggaaagaccattctgctttacttttagagcatcttggtcttctgagctcattatacctcaatcaaaactgaaattaggtgcctgtcacggctctttttttactgtacctgtgacttcctttcttatttccaaggatgctcatcacaatacgcttctagatctattatgcattataattaatagttgtagctacaaaaggtaaaagaaagtccggggcaggcaacaatagaaatcggcaaaaaaaactacagaaatactaagagcttcttccccattcagtcatcgcatttcgaaacaagaggggaatggctctggctagggaactaaccaccatcgcctgactctatgcactaaccacgtgactacatatatgtgatcgtttttaacatttttcaaaggctgtgtgtctggctgtttccattaattttcactgattaagcagtcatattgaatctgagctcatcaccaacaagaaatactaccgtaaaagtgtaaaagttcgtttaaatcatttgtaaactggaacagcaagaggaagtatcatcagctagccccataaactaatcaaaggaggatgtcgactaagagttactcggaaagagcagctgctcatagaagtccagttgctgccaagcttttaaacttgatggaagagaagaagtcaaacttatgtgcttctcttgatgttcgtaaaacagcagagttgttaagattagttgaggttttgggtccatatatctgtctattgaagacacatgtagatatcttggaggatttcagctttgagaataccattgtgccgttgaagcaattagcagagaaacacaagtttttgatatttgaagacaggaagtttgccgacattgggaacactgttaaattacaatacacgtctggtgtataccgtatcgccgaatggtctgatatcaccaatgcacacggtgtgactggtgcgggcattgttgctggtttgaagcaaggtgccgaggaagttacgaaagaacctagagggttgttaatgcttgccgagttatcgtccaaggggtctctagcgcacggtgaatacactcgtgggaccgtggaaattgccaagagtgataaggactttgttattggatttattgctcaaaacgatatgggtggaagagaagagggctacgattggttgatcatgacgccaggtgttggtcttgatgacaaaggtgatgctttgggacaacaatacagaactgtggatgaagttgttgccggtggatcagacatcattattgttggtagaggtcttttcgcaaagggaagagatcctgtagtggaaggtgagagatacagaaaggcgggatgggacgcttacttgaagagagtaggcagatccgcttaagagttctccgagaacaagcagaggttcgagtgtactcggatcagaagttacaagttgatcgtttatatataaactatacagagatgttagagtgtaatggcattgcgcacattgtatacgctacaagtttagtcacgtgctagaagctgttttttgcaccgaaaatttttttttttttgttttttggtgaagtacattatgtgaaatttcacaaccaaagaaaaagagtttaatacaagtgcgaagaaccaaaccttgcttcttagtccattgaccgttataaaagatacacatttctgcgcgcgcaaattaaagccttcgagcgtcccaaaaccttctcaagcaaggttttcagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacataactataaaaaaataaatagggacctagacttcaggttgtctaactccttccttttcggttagagcggatgtggggggagggcgtgaatgtaagcgtgacataactaattacatgatgcggccctctaggatcagcgggtttaaactcaatggtgatggtgatgatgaccggtacgcgtagaatcgagaccgaggagagggttagggataggcttaccttcgaagggccctctagattaatgatgatgatgatgatgatctcgcccgtatgggaagacctgggtacatccagcggcgactccctggaataagaaatcgagattcgtattaagggctttgcgaagctgcaccgtcggattcgggtagagtgacttgaccgttatgttgacgaatttctcgtacatcaagcagggggtggaaaagtcagaggatgttgggtcgacggtgtagctgttgatcttgccgacatttcttccgggctgcataggatgagcctgtacaactacctcgactcctgtgccacttctcgggctgggtgcgcggaagaaatcgtcaggcatacggctgaattggaaaaaactccgtgcagcatccatatctagctggccgtcgtccctgcgcccatccacaaaaagattcgcggggaaggtggtctcgccgtaagcagtaaagaacctaaagtcaacaaaggagaaattggggttggtcgcaatggagtcttgaatgcgcttgaaacggagctcccccgcgacggtaagattgtattttcctcctccaaatcggttgctgtagtcaaccaactgttcgaagagcgtctcattgaaatcgtggttgttgccaaagaatgcgtcacctcgggtcatactggcgtcgccttcgaaggtgccatgctcattgagtccaccaacggaagcggggggtggtggatcaggcccagtgagccgcgtcttgcgtccgatgctcagcaagtccgtaatgagattgccgtccacaaggtgggccgcatatgtggcgaagattgcggcttgattgtcgaaattgaatccttcctgaaccgcgtttattatttgcgccggggttgcaacgccatttctcgggaggtacccgtgagatgccagagtattgagaccagggcaaggtccacgaatatcgccaggtcgaagcggcttccatgggtgagcctcgtcgttcaccaactttgcagagctattctcgagaggaccaggaggtaatcctggctctcgggcctcgagtgttgggattatagcgtccaattcctgctggctgaggccggccaatgaggcgtagtcaggaaaagcaacgacccccactgcgtagaccaaggttgggaacaggggaaaatatttcatttttgatttgtgtttaagcgagtgactgaagaatattattctatggttttttaagtctaaaatgaataatataataattataataaaagagttaaggagaaggaagaataggttttcaaaattctgaaacgtaccccctgtatatatactcaaaaaaaaatttctcgaccatctggtaatctatcgccaccacccacaggtctcctttttcgtttcgttccgtttctgaaaaagatctctagcaacaacaactagaaaaaaaaacactatctaaaaaaagttatttctggtggcatcttttctaaatttgtcaaaaaatcccacccgccctagaaaacacgcacggccgcgagatttccaaattggtattgcataaagaaagaaaaatgttgttttttttcttcacagttttcaccgtttcccaactgcccaattagaaaaaacaaaaacaacttgctttgcacgccgtggtctgcgtgtccaccaaaaataatacgtcttatttttttttattttttattttttgtagtttttcgtcatttcataaattttgctttttttcttttgctcttgtgcacaagaagaaatgccttagaaactgcgtacaaattcagtatacaactttacatgcttttaccacaaacaccagaaatctcgcaggatttaacaacactctcgaaagtccattcacactgcgtgggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccataaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagcccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtactatggttgctttgacgtatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagt
and cultured by the method of example 2 to obtain a culture supernatant.
The following experiments prove the beneficial effects of the invention.
Experimental example 1 expression of oxidase Gene by recombinant vector of the invention in Kluyveromyces marxianus Strain
1. Experimental method
(1) The molecular weight of the protein expressed by the recombinant vector of example 2 and comparative example 1 was verified by polyacrylamide gel electrophoresis, wherein the protein standard (Marker) used was Shanghai industrial product, cat No. C520010, and the schematic diagram is shown in fig. 3 (left).
(2) 100. Mu.L of the culture supernatant of example 2 and comparative example 1 was taken, and 0.3mM of ABTS (2, 2' -biazo-bis-3-ethylbenzothiazoline-6-sulfonic acid), 1mM of hydrogen peroxide, and 1mL of the mixture was supplemented with pH 4.2 citric acid-phosphate buffer at room temperature and reacted for 5 minutes to verify the activity of oxidase A protein.
2. Experimental results
(1) While the theoretical molecular weight of the oxidase A protein was 41kDa, the pSUS1NPC recombinant vector of example 1 of the present invention can successfully express a protein having a molecular weight of 40kDa-50kDa according to the result shown in FIG. 3 (right), and the pKUPS6NPC of comparative example 1 fails to express a protein having a molecular weight of 40kDa-50 kDa. The recombinant vector of the invention can be proved to successfully express oxidase A protein.
(2) As a result, as shown in FIG. 4, it can be seen that the pSUS6YNPC recombinant vector of example 1 of the present invention has significantly higher protein activity than the pKUPS6NPC recombinant vector of comparative example 1.
The above results show that the recombinant vector of the present invention is a recombinant vector which can successfully and efficiently replicate and express exogenous genes in Kluyveromyces marxianus strains.
In conclusion, the invention provides a recombinant vector capable of successfully replicating and expressing exogenous genes in Kluyveromyces marxianus strains, can stably and efficiently produce oxidase A protein, and has the value of industrial popularization and application.
Claims (10)
1. A vector comprising the following fragments linked in sequence: NC1 promoter, CYC terminator, replicon, resistance gene, and trophic gene a;
the sequence of the NC1 promoter is shown as SEQ ID NO. 2;
the sequence of the CYC terminator is shown in SEQ ID NO. 4;
the sequence of the nutrition gene A is shown as SEQ ID NO. 5;
the sequence of the replicon is shown as SEQ ID NO. 7;
the sequence shown in SEQ ID NO.8 is connected between the nutrition gene A and the NC1 promoter;
wherein replicons, resistance genes, and trophic gene A are in reverse ligation.
2. Vector according to claim 1, wherein the resistance gene is an ampicillin resistance gene, a kanamycin resistance gene, a tetracycline resistance gene or a chloramphenicol resistance gene, preferably an ampicillin resistance gene, the sequence of which is shown in SEQ ID No. 6.
3. The vector of claim 1, wherein the NC1 promoter and CYC terminator are linked with the sequence of SEQ ID No. 9;
and/or a sequence shown in SEQ ID NO.10 is connected between the CYC terminator and the replicon;
and/or the sequence shown in SEQ ID NO.11 is connected between the replicon and the resistance gene;
and/or the sequence shown in SEQ ID NO.12 is connected between the resistance gene and the nutrition gene A;
preferably, the sequence of the recombinant vector is shown in SEQ ID NO. 13.
4. Use of the vector according to any one of claims 1 to 3 for expressing an exogenous gene in kluyveromyces marxianus, preferably the exogenous gene is oxidase gene a.
5. A recombinant vector according to any one of claims 1 to 3 comprising a gene of interest.
6. The recombinant vector of claim 5, wherein the target gene is oxidase gene a, and wherein the recombinant vector comprises the following fragments, linked in sequence: NC1 promoter, oxidase gene A, CYC terminator, replicon, resistance gene, and nutritional gene a; the sequence of the oxidase gene A is shown as SEQ ID NO. 3.
7. The recombinant vector according to claim 6, wherein the sequence shown in SEQ ID NO.9 is connected between the oxidase gene A and the CYC terminator;
preferably, the sequence of the recombinant vector is shown as SEQ ID NO. 1.
8. Use of the recombinant vector of any one of claims 5 to 7 in the preparation of recombinant kluyveromyces marxianus; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
9. A recombinant bacterium, characterized in that it is kluyveromyces marxianus comprising the recombinant vector of any one of claims 5-7; preferably, the kluyveromyces marxianus is URA3 auxotrophic kluyveromyces marxianus.
10. Use of the recombinant bacterium of claim 9 in the preparation of oxidase a protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211090749.0A CN116042691A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211090749.0A CN116042691A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116042691A true CN116042691A (en) | 2023-05-02 |
Family
ID=86114056
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211090749.0A Pending CN116042691A (en) | 2022-09-07 | 2022-09-07 | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116042691A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012176981A1 (en) * | 2011-06-24 | 2012-12-27 | Samsung Electronics Co., Ltd. | Enhanced heterologous protein production in kluyveromyces marxianus |
| CN105063080A (en) * | 2015-09-07 | 2015-11-18 | 复旦大学 | Signal peptide-free recombinant vector for exogenous gene expression in Kluyveromyces marxianus nutritional deficient strain |
| CN105132452A (en) * | 2015-09-07 | 2015-12-09 | 复旦大学 | Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain |
| US20190024058A1 (en) * | 2015-11-13 | 2019-01-24 | Consejo Superior Investigaciones Cierntificas (Csic) | Mutants of unspecific peroxygenase with high monooxygenase activity and uses thereof |
-
2022
- 2022-09-07 CN CN202211090749.0A patent/CN116042691A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012176981A1 (en) * | 2011-06-24 | 2012-12-27 | Samsung Electronics Co., Ltd. | Enhanced heterologous protein production in kluyveromyces marxianus |
| CN105063080A (en) * | 2015-09-07 | 2015-11-18 | 复旦大学 | Signal peptide-free recombinant vector for exogenous gene expression in Kluyveromyces marxianus nutritional deficient strain |
| CN105132452A (en) * | 2015-09-07 | 2015-12-09 | 复旦大学 | Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain |
| US20190024058A1 (en) * | 2015-11-13 | 2019-01-24 | Consejo Superior Investigaciones Cierntificas (Csic) | Mutants of unspecific peroxygenase with high monooxygenase activity and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| MOBINI-DEHKORDI, M. 等: ""Yeast shuttle Vector p316-IRES-GFP, complete sequence，GenBank: MG833229.1"", 《GENBANK》, pages 1 - 3 * |
| XUYE LANG 等: ""Developing a broad-range promoter set for metabolic engineering in the thermotolerant yeast Kluyveromyces marxianus"", 《METABOLIC ENGINEERING COMMUNICATIONS》, vol. 11, pages 1 - 8 * |
| 郭超 等: "一种针对马克斯克鲁维酵母(Kluyveromyces marxianus)的无痕基因组改造方法", 复旦学报(自然科学版), vol. 55, no. 5, pages 576 - 586 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105985968B (en) | Improved wide spectrum endonuclease and its industrial process | |
| CN112522173B (en) | Engineering bacterium for producing heterologous alkaline protease and construction method thereof | |
| CN109790510A (en) | Albumen in the case where inducing substrate is not present in filamentous fungal cells generates | |
| CN105087614A (en) | Thermomyces lanuginosus lipase gene, engineering bacteria and application of engineering bacteria | |
| CN113265346A (en) | Genetically engineered bacterium for producing porcine myoglobin through fermentation and application thereof | |
| CN110643620B (en) | High-activity poria cocos cellulose endonuclease gene and protein and recombinant vector thereof | |
| CN115820709A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN108291245A (en) | Use high concentration sugar mixture inducible gene expression | |
| CN113913357A (en) | Chassis strain for producing alkaline protease and construction method and application thereof | |
| CN116042691A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116103328A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116042690A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN116179587A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN101487019A (en) | Candida utilis expression vector and construction method thereof | |
| CN115820711A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN115851806A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| CN115820710A (en) | Recombinant vector for expressing exogenous gene in Kluyveromyces marxianus strain | |
| US8663970B1 (en) | Recombinant thermotolerant yeast with a substitute heat shock protein 104 promoter | |
| CN109401991B (en) | Recombinant saccharomyces cerevisiae and method for producing ethanol by fermenting raw materials | |
| CN111349575B (en) | Pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen C and application thereof | |
| CN102533841B (en) | Method for increasing expression of bacillus thuringiensis(Bt) insecticidalcrystalprotein in hansenula polymorpha | |
| CN106754446B (en) | Transformed yarrowia lipolytica and construction method and application thereof | |
| CN110592121A (en) | High-expression cellulose endonuclease gene and recombinant vector and protein thereof | |
| US20240084084A1 (en) | Promoter for yeast | |
| EP3824072A1 (en) | Materials and methods for creating strains of saccharomyces cerevisiae that exhibit an increased ability to ferment oligosaccharides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |