CN115820661A

CN115820661A - Maize dwarfing gene and application thereof

Info

Publication number: CN115820661A
Application number: CN202210885719.2A
Authority: CN
Inventors: 马庆; 赵阳; 黄远翔; 路小铎; 吴红影
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2022-07-26
Filing date: 2022-07-26
Publication date: 2023-03-21
Anticipated expiration: 2042-07-26
Also published as: CN115820661B

Abstract

The invention discloses a corn dwarfing gene BR2-rph1 and application thereof, relating to the technical field of corn breeding, wherein the BR2-rph1 gene is obtained by mutating the 1144 th base of a CDS nucleotide sequence of a corn BR2 gene from G to A. According to the invention, through investigation of the mutant and wild type plant types, the mutant plant types are reduced more than the wild type plant types, and the plant types are compact, and the br2-rph1 gene can be used for cultivating maize dwarf plants, so that lodging-resistant maize dwarf varieties are obtained, and the method has important application values in breeding.

Description

Maize dwarfing gene and application thereof

Technical Field

The invention relates to the technical field of corn breeding, in particular to a corn dwarfing gene and application thereof.

Background

Plant Height is one of the most important Plant type traits affecting Plant density and determining crop Yield [ Yin X, jaja N, mcClure M A, et al, company of Models in analysis Relationship of Corn Yield and Plant Height Measured and Yield-to Mid-search [ J ]. Journal of Agricultural science, 2011,3 (3) ]. The yield of the corn in unit area can be continuously improved by reducing the plant height and the included angle of the small leaves and increasing the planting density. It has now been found that genes capable of regulating plant height are mostly involved in the biological processes of synthesis, trafficking and signal transduction of related hormones, synthesis of cell walls and alternative splicing of mRNA. The semi-dwarf genes sd1 and rht1 in corn and wheat are widely applied in the first green revolution, and the two semi-dwarf genes only use 1 locus to obviously reduce the plant height and have small influence on yield traits. The research on the maize dwarfing gene is always the key point of the maize genetic breeding work, but compared with sd1 and rht1, most of the semi-dwarf genes identified from the maize are linked with various bad characters, have larger influence on the yield, and can be directly applied to production rarely.

Based on the content, the maize dwarfing gene capable of being directly applied to production and the application thereof are provided.

Disclosure of Invention

The invention aims to provide a maize dwarfing gene, which is realized by the following technical scheme:

the invention provides a maize dwarf gene BR2-rph1, wherein the BR2-rph1 gene is obtained by mutating the 1144 th base of a CDS sequence of a maize BR2 gene from G to A.

The further improvement is that the CDS sequence of the br2-rph1 gene is shown as SEQ ID NO. 1.

The invention provides an application of the maize dwarfing gene br2-rph1 in maize molecular breeding.

The further improvement is that the corn variety to be improved and the variety containing the corn dwarf gene br2-rph1 are hybridized and backcrossed for breeding, the offspring which contains the excellent characters of the corn variety to be improved and the corn dwarf gene br2-rph1 is screened, and the dwarf strain line of the corn variety to be improved is obtained

The further improvement is that the 1144 th base of the CDS of the BR2 gene in the maize genome to be improved is mutated from G to A by utilizing a gene editing technology to obtain a dwarf strain of the maize variety to be improved.

The invention has the following beneficial effects: according to the invention, through investigation on the mutant and wild type plant types, the mutant plant types are reduced more than the wild type plant types, the plant types are more compact, and the br2-rph1 gene can be used for cultivating the maize dwarf plants, so that the maize dwarf varieties with lodging resistance and excellent yield can be obtained, and the important application value in breeding is realized.

Drawings

FIG. 1 shows the plant height of d129 compared to WT plants (bar =20 cm);

FIG. 2 shows the comparison of d129 with WT plant height and ear height (A: plant height (n = 10); B: ear height (n = 10); indicates that d129 differs significantly from WT at a level of 0.01);

FIG. 3 shows the WT, d129, br2 and d129/br2 phenotypic comparisons (A: plant bar =20cm, B: leaf bar =10cm, C: internode bar =10cm, D-F: tassel bar =10cm;

FIG. 4 shows the comparison of the plant type traits of WT, D129, br2 and D129/br2 (A: plant height comparison (n = 25); B: ear height comparison (n = 25); C: tassel branch number comparison (n = 25); D: ear 3 leaf length comparison (S: ear leaf, S +1: the 1 st leaf above ear leaf, S-1: the 1 st leaf below ear leaf, n = 25); E: ear 3 leaf width comparison (n = 25); F: ear 3 leaf angle comparison (n = 25); G: internode length comparison (S: internode of main ear, S-1: the 1 st internode below ear leaf, S +1: the 1 st internode above ear internode, and so on in this order; n = 25); H: internode diameter comparison (n = 25));

FIG. 5 compares d129 with WT yield traits (A: ear bar =5cm, B: kernel length bar =5cm, C: kernel width bar =5cm;

FIG. 6 shows the comparison of the height of WT/d129 and the height of the WT plant (A: plant height comparison (n = 10); B: ear height comparison (n = 10); indicates that WT/d129 differs significantly from WT at a level of 0.01).

Detailed Description

The present application will now be described in further detail with reference to the drawings, it should be noted that the following detailed description is given for illustrative purposes only and is not to be construed as limiting the scope of the present application, as those skilled in the art will be able to make numerous insubstantial modifications and adaptations to the present application based on the above disclosure.

1. Material

All reagents used in the experiment are conventional reagents unless specified otherwise, are prepared by using deionized water, and instruments used are conventional laboratory instruments.

The maize used in the experiment selects a B73 inbred line, and the B73 inbred line is provided by a national local combined engineering laboratory for stress-resistant breeding and disaster reduction of crops of life science college of agriculture university of Anhui province.

The maize line d129 mutant plant used in the experiment is obtained from an EMS mutant library (http:// elabcaas. Cn/memd/index. Php), wherein the BR2 gene CDS sequence of the d129 mutant strain generates G to A mutation at position 1144, the BR2 mutant gene of the d129 mutant strain has a nucleotide sequence shown in SEQ ID NO.1, and the BR2 mutant plant is a function-affected mutant of the BR2 gene.

2. Method of producing a composite material

2.1 identification of dwarf maize

10 WT wild-type plants (B73 inbred line) and d129 mutant plants (from an EMS mutant library (http:// elabcaas. Cn/memd/index. Php)) which were sown at the same period and have uniform growth vigor were selected, and the plant height and the ear height were investigated after tasseling. FIG. 1 shows the phenotype of WT wild type plants B73 and d129 mutant plants, and as shown in FIG. 1, the height of d129 mutant plants is significantly lower than that of WT wild type plants. From figure 2, d129 is reduced by 26.67% relative to the average plant height of the wild type, the ear height is reduced by 39.43%, the difference reaches a very significant level, and the leaf number and the internode number are unchanged; the tasking of the mutant was slightly delayed from that of the wild type by 1 to 2 days.

2.1.1 d129 mutant plant Gene mapping

(1) Analysis of genetic segregation ratio

d129 mutant and WT wild type B73 plants were crossed for generation 1F ₁ (WT/d 129), selfing again for 1 generation to obtain F2 generation, and performing field investigation to obtain F ₂ Tall and short plant segregation occurs in the population. Further to F ₂ Statistics of the segregation ratios of the wild type and mutant phenotypes in the generation population are shown in table 1, wherein the wild type phenotype comprises 269 strains, the mutant phenotype comprises 87 strains, the segregation ratio is 3.1:1, chi square test ² ＝0.06<χ ² 0.05 (1) =3.84, conform to 3:1 bengDelr's law of segregation indicates that the mutant dwarf phenotype is regulated by a recessive single gene, and further gene localization is carried out by a Mutmap technology to discover that the mutant is caused by mutation of G to A of the 1144 th base of CDS of BR2 gene.

TABLE 1 analysis of genetic segregation ratios

Note: chi shape ² ＝0.06<χ ² 0.05(1)＝3.84

(2) Mutation site sequencing verification

Taking the d129 mutant plant as a material, extracting RNA, and carrying out reverse transcription on the extracted RNA to generate a cDNA first chain which is used as a template for PCR amplification.

With the designed specific primers:

d129-F：(5'>GGAGATGCCCGGCCTGTGGT<3')

d129-R：(5'>CGGCTTCGTCGTGGGGTTCA<3')

obtaining gene segments by using a conventional PCR amplification technology, and obtaining a nucleotide sequence shown as SEQ ID NO.1 by connecting a vector, converting and sequencing. Compared with the WT wild-type sequence SEQ ID NO.2, the result shows that the 1144 th base of the BR2 gene in the mutant d129 genome is mutated from G to A, the base is a new allelic mutation of the BR2 gene, and the new BR2 allele generated by the site mutation is named BR2-rph1.

2.2 agronomic trait analysis of wild type B73, d129 mutant plants, br2 mutant plants, WT/d129 hybrid plants

The br2 mutant (from EMS mutant library (http:// elabcaas. Cn/memd/index. Php)) was crossed with the d129 mutant to obtain F ₁ Will F ₁ The generation d129/br2 and WT wild type B73 and d129 mutant plants are planted at the same time, the phenotype investigation is carried out, if the two mutant phenotypes are caused by different gene mutations, the genes are complementary, F ₁ The generation reverts to a wild type phenotype; if the two mutant phenotypes are caused by mutations in the same gene, F ₁ The generation should also be mutant phenotype, and the gene mutation is the main cause of mutant phenotype.

For wild type B73, br2 and d129 and F thereof ₁ The field phenotype of the generations was investigated. As shown in FIG. 3, the BR2 phenotype is consistent with the typical characteristics of known BR2 mutants, both plant height and ear height are significantly reduced, the tassel length is reduced while the number of branches is reduced, and the reduction in the internodes below the tassel is more significant than that in the internodes above the tassel.

Further on two mutants and F thereof ₁ Compared with the wild type agronomic traits, the plant height, the ear position height, the tassel length, the leaf length and the leaf angle of the 3 lines are obviously reduced compared with the wild type, the leaf width is widened compared with the wild type WT, and F ₁ The progeny are still mutant phenotypes, no gene complementation has occurred, and F ₁ The phenotype is between the two mutants, and the similarity of the phenotype with d129 is higher, which confirms that the reduction of the plant height of the mutant d129 is really caused by BR2 gene mutation.

Further on br2 and d129 and F thereof ₁ The plant type traits of the generations and WT are compared in detail. As shown in FIG. 4, the plant height of d129 was reduced by 26.53% and the ear height was reduced by 46.63% compared with WT; the tassel branch number of d129 was reduced by 20.43% compared to WT; meanwhile, the comparison of the leaf types of the 3 leaves of the ear shows that the leaf length on the ear is shortened by 3.53%, the leaf length on the ear position is shortened by 1.76%, the leaf length under the ear is shortened by 6.55%, the leaf width is relatively slightly increased, the leaf width on the ear is increased by 3.26%, the leaf length on the ear position is increased by 2.40%, the leaf length under the ear is increased by 1.45%, the light-receiving area of the leaf is increased, and meanwhile, the statistics of the leaf included angle shows that the leaf included angle on the ear is reduced by 5.78%, the leaf included angle on the ear position is reduced by 2.00%, the leaf included angle under the ear is reduced by 12.94%, thus also indicating that the compact d129 plant type meets the dense planting resistant condition.

After harvest, detailed statistics and comparisons of yield traits were also performed. As a result, as shown in FIG. 5, d129 showed a 5.29% reduction in ear length, a 3.04% reduction in row size, and an 8.59% increase in ear row number, as compared to WT; the single ear grain weight and the hundred grain weight are respectively reduced by 19.71 percent and 19.99 percent; the grain length, the grain width and the grain thickness are respectively reduced by 4.29 percent, 3.82 percent and 1.17 percent; the seed yield is increased by 0.89%. Through investigation on the mutant and wild type plant types, the mutant plant type has a remarkable effect on yield, but the plant height is reduced more compared with WT, the plant type is compact, and the mutant plant type has a utilization value in the breeding work of the inbred line.

2.2.3 Application of br2-rph1

The lodging resistance of corn plants can be enhanced to a certain extent by high dwarfing, but some undesirable traits are usually followed, the plant type is too compact, leaves are shielded from each other to cause low photosynthetic efficiency, the female ears are shortened, the seeds are reduced to reduce the yield of a single plant, and the probability of adverse climate meeting at the pollination period and the harvest period is increased due to the fact that the growth period is advanced or delayed. Therefore, the improved strain is high and the influence of the undesirable traits should be avoided as much as possible. In order to further explore the application value of br2-rph1, the agronomic character investigation is carried out on WT/d129 hybrid plants and wild type plants.

The dwarf plant of corn obtained at 2.1.1 is used as male parent, the wild type B73 corn variety is used as female parent, the female parent and the male parent are hybridized and pollinated in a mixing way to obtain F ₁ The generation is the WT/d129 hybrid plant.

As seen from FIG. 6, WT/d129 was highly dwarf compared to the wild type, the ear position was reduced, the leaf pattern on the upper ear was compact, the tassel length was shortened, the internode number was unchanged, but the internode on the lower ear was shortened, which is a major cause of the reduction in ear position and plant height. The survey data is analyzed, the plant height and the ear position of the hybrid seeds are reduced to a certain extent compared with the wild type, and the lodging resistance of the hybrid seeds to plants is enhanced.

The excellent phenotype of WT/d129 shows that d129 has an important application prospect in variety dwarfing improvement, and br2-rph1 as 1 new plant height dwarfing gene has small influence on hybrid seeds, has no extreme adverse character, can be used for corn molecular breeding application, and is expected to provide ideal gene resources for corn plant type breeding.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.

Claims

1. A maize dwarfing gene BR2-rph1 is characterized in that the BR2-rph1 gene is A mutated from G at the 1144 th basic group of a CDS sequence of a maize BR2 gene.

2. The maize dwarfing gene br2-rph1 as claimed in claim 1, wherein the CDS sequence of br2-rph1 is shown in SEQ ID NO. 1.

3. Use of the maize dwarfing gene br2-rph1 according to any one of claims 1 to 2 in molecular breeding of maize.

4. The use of claim 3, wherein the maize variety to be improved is crossed and backcrossed with a variety containing the maize dwarfing gene br2-rph1, and the progeny containing the maize variety to be improved and the maize dwarfing gene br2-rph1 is selected to obtain the dwarf line of the maize variety to be improved.

5. The use of claim 3, wherein the base 1144 of the BR2 gene in the maize genome to be improved is mutated from G to A by using a gene editing technology to obtain a dwarf strain of the maize variety to be improved.