CN115820661B

CN115820661B - Corn dwarf gene and application thereof

Info

Publication number: CN115820661B
Application number: CN202210885719.2A
Authority: CN
Inventors: 马庆; 赵阳; 黄远翔; 路小铎; 吴红影
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2022-07-26
Filing date: 2022-07-26
Publication date: 2023-07-28
Anticipated expiration: 2042-07-26
Also published as: CN115820661A

Abstract

The invention discloses a maize dwarf gene BR2-rph1 and application thereof, and relates to the technical field of maize breeding, wherein the BR2-rph1 gene is formed by mutating a 1144 th base of a CDS nucleotide sequence of a maize BR2 gene from G to A. According to the invention, through investigation of mutants and wild type plant types, the mutant plant types are more reduced compared with the wild type plant types, the plant types are compact, and the br2-rph1 gene can be used for cultivating maize dwarf plants, so that lodging-resistant maize dwarf varieties are obtained, and the invention has important application value in breeding.

Description

Corn dwarf gene and application thereof

Technical Field

The invention relates to the technical field of corn breeding, in particular to a corn dwarf gene and application thereof.

Background

Plant height is one of the most important plant type traits that affect planting density, determining crop yield [ Yin X, jaja N, mcture M A, et al Comparison of Models in Assessing Relationship of Corn Yield with Plant Height Measured during Early-to Mid-Season [ J ]. Journal of Agricultural ence,2011,3 (3) ]. The planting density is increased by reducing the plant height and the included angle of the small leaves, so that the yield of the corn in unit area can be continuously improved. It has now been found that genes capable of regulating plant height are mostly involved in biological processes such as synthesis, transport and signal transduction of related hormones, synthesis of cell walls, alternative splicing of mRNA, etc. The semi-dwarf genes sd1 and rht1 in corn and wheat are widely applied in the first green revolution, and the plant height of the two semi-dwarf genes is obviously reduced by only 1 site, and the influence on the yield property is small. Research on maize dwarf genes has been the focus of maize genetic breeding work, but compared with sd1 and rht1, most of the half dwarf genes identified from maize are linked with various bad shapes and have great influence on yield, and can be directly applied to production.

Based on the above, a maize dwarf gene which can be directly applied in production and application thereof are provided.

Disclosure of Invention

The invention aims to provide a corn dwarf gene, which is realized by the following technical scheme:

the invention provides a maize dwarf gene BR2-rph1, wherein the BR2-rph1 gene is obtained by mutating 1144 th base of CDS sequence of maize BR2 gene from G to A.

A further improvement is that the CDS sequence of the br2-rph1 gene is shown as SEQ ID NO. 1.

The invention provides an application of the maize dwarf gene br2-rph1 in maize molecular breeding.

The further improvement is that the maize variety to be improved and the variety containing the maize dwarf gene br2-rph1 are hybridized and backcrossed and bred, and the offspring containing the maize dwarf gene br2-rph1 and the excellent character of the maize variety to be improved are screened to obtain the dwarf line of the maize variety to be improved

The further improvement is that the 1144 th base of the BR2 gene CDS in the genome of the corn to be improved is mutated from G to A by utilizing the gene editing technology, so as to obtain the dwarf strain of the corn variety to be improved.

The invention has the following beneficial effects: according to the invention, through investigation of mutants and wild type plant types, the mutant plant types are more reduced in height compared with the wild type plant types, the plant types are more compact, and the br2-rph1 gene can be used for cultivating corn dwarf plants, so that lodging-resistant corn dwarf varieties with excellent yield are obtained, and the invention has important application value in breeding.

Drawings

Figure 1 is a d129 vs WT plant height (bar=20 cm);

FIG. 2 shows the plant height and ear height comparison of d129 and WT (A: plant height comparison (n=10), B: ear height comparison (n=10), indicating that d129 and WT differ significantly at 0.01 level);

FIG. 3 is a comparison of the phenotype of WT, d129, br2 and d129/br2 (A: plant bar=20 cm; B: leaf bar=10 cm; C: internode bar=10 cm; D-F: tassel bar=10 cm);

FIG. 4 shows WT, D129, br2 and D129/br2 plant type trait comparisons (A: plant height comparison (n=25), B: spike height comparison (n=25), C: tassel branch number comparison (n=25), D: spike 3 leaf length comparison (S: spike leaf, S+1: 1 st leaf on spike leaf, S-1: 1 st leaf under spike leaf; n=25), E: spike 3 leaf width comparison (n=25), F: spike 3 leaf included angle comparison (n=25), G: internode length comparison (S: main spike bearing internode, S-1: spike internode 1, S+1: spike internode upper internode, analogized, n=25), H: internode diameter comparison (n=25));

FIG. 5 is a comparison of d129 with WT yield traits (A: ear bar=5 cm; B: grain length bar=5 cm; C: grain width bar=5 cm);

FIG. 6 shows the plant height and ear height comparison of WT/d129 to WT (A: plant height comparison (n=10); B: ear height comparison (n=10); indicating significant difference between WT/d129 and WT at 0.01 level).

Detailed Description

The following detailed description of the present application is provided in conjunction with the accompanying drawings, and it is to be understood that the following detailed description is merely illustrative of the application and is not to be construed as limiting the scope of the application, since numerous insubstantial modifications and adaptations of the application will be to those skilled in the art in light of the foregoing disclosure.

1. Material

All reagents used in the experiment are conventional reagents unless specified, all reagents are prepared by deionized water, and all used instruments are laboratory conventional instruments.

The corn used in the experiment is selected from a B73 inbred line, and the B73 inbred line is provided by national institute of science and crop stress-tolerant breeding and disaster reduction national and local joint engineering laboratory of Anhui agricultural university.

The maize line d129 mutant used in this experiment was obtained from EMS mutant library (http:// elabacas. Cn/memd/index. Php), wherein the BR2 gene CDS sequence of the d129 mutant was G to A mutated at position 1144, the BR2 mutant gene of the d129 mutant had the nucleotide sequence shown as SEQ ID NO.1, and the BR2 mutant plant was a functionally influencing mutant of the BR2 gene.

2. Method of

2.1 dwarf maize identification

10 WT wild type plants (B73 inbred line) and d129 mutant plants (from EMS mutant pool (http:// elabacas. Cn/memd/index. Php)) were selected, each with uniform vigour, and after emasculation, the plant height and ear height were investigated. FIG. 1 shows the phenotype of WT wild-type plants B73 and d129 mutant plants, as shown in FIG. 1, the d129 mutant plants were significantly shorter than the WT wild-type plants. From fig. 2, d129 was reduced by 26.67% relative to the wild-type average plant height, the spike height was reduced by 39.43%, the difference reached an extremely significant level, and the leaf number and internode number were unchanged; the mutant male was slightly later than the wild type by 1 to 2 days.

2.1.1 d129 mutant plant gene mapping

(1) Specific analysis of genetic segregation

d129 mutant plants and WT wild type plants B73 hybrid 1 generation F ₁ (WT/d 129), selfing for 1 generation to obtain F2 generation, and field investigation ₂ Isolation of high and low strains occurs in the population. Further to F ₂ The wild type and mutant phenotype segregation ratios in the generation populations were counted and the results are shown in Table 1, wherein the wild type phenotype has 269 strains, the mutant phenotype 87 strains, and the segregation ratio is 3.1:1 chi of chi-square test ² ＝0.06<χ ² 0.05 (1) =3.84, conforming to 3:1 Mendelian's law of separation shows that the dwarf phenotype of the mutant is regulated by a single recessive gene, and the mutation of G to A is further caused by gene localization by Mutmap technology to find that the mutant is the 1144 th base of CDS of BR2 gene.

TABLE 1 genetic segregation ratio analysis

Note that: x-shaped articles ² ＝0.06<χ ² 0.05(1)＝3.84

(2) Mutation site sequencing verification

Taking d129 mutant plants as materials, extracting RNA, and carrying out reverse transcription on the extracted RNA to generate a cDNA first strand which is used as a template for PCR amplification.

Using designed specific primers:

d129-F：(5'>GGAGATGCCCGGCCTGTGGT<3')

d129-R：(5'>CGGCTTCGTCGTGGGGTTCA<3')

the conventional PCR amplification technology is utilized to obtain a gene fragment, and the nucleotide sequence shown as SEQ ID NO.1 is obtained through connection carrier, transformation and sequencing. The result shows that the 1144 th base of BR2 gene in the mutant d129 genome is mutated from G to A by comparison with the WT wild type sequence SEQ ID NO.2, and the novel allelic mutation of BR2 gene is named BR2-rph1.

2.2 agronomic trait analysis of wild type B73, d129 mutant plants, br2 mutant plants, WT/d129 hybrid plants

The br2 mutant plants (from EMS mutant library (http:// elabacas. Cn/memd/index. Php)) were crossed with the d129 mutant plants to give F ₁ F is to F ₁ The generation d129/br2 is planted synchronously with wild type WT B73 and d129 mutant plants, and a phenotype investigation is carried out, if the two mutant phenotypes are caused by different gene mutations, the genes are complementary, F ₁ The generation reverts to wild type phenotype; if the two mutant phenotypes are caused by the same gene mutation, F ₁ The substitution is also a mutant phenotype, and the mutation of the gene is the main cause of the mutant phenotype.

For wild type B73, br2 and d129 and F thereof ₁ The field phenotype of the generation was investigated. As shown in FIG. 3, the BR2 phenotype is consistent with the typical characteristics of the known BR2 mutants, the plant height and the ear height are both obviously reduced, the length of the tassel is shortened, the branch number is reduced, and the internode at the lower part of the tassel is obviously shortened compared with the internode at the upper part of the tassel.

Further to two mutants and F thereof ₁ Comparing the generation with wild agronomic characters, finding that the plant height, spike position, tassel length, leaf length and leaf angle of the 3 strains are all obviously reduced compared with the wild type, and the leaf width is widened compared with the wild type of the WT, F ₁ The generation is still a mutant phenotype, no gene complementation occurs, and F ₁ The representative pattern was between the two mutants and showed a high degree of phenotypic similarity with d129, confirming that the reduced plant height of mutant d129 was indeed caused by the BR2 gene mutation.

Further to br2 and d129 and F ₁ The strain type characters of the generations and the WT are compared in detail. As shown in fig. 4, the plant height of d129 was reduced by 26.53% and the ear height was reduced by 46.63% compared to WT; d129 tassel number of branchesA 20.43% reduction compared to WT; meanwhile, the comparison of leaf shapes of 3 leaves of the ears shows that the leaf length of the ears is shortened by 3.53%, the leaf length of the ears is shortened by 1.76%, the leaf length of the ears is shortened by 6.55%, the leaf width is increased by relatively small amplitude, the leaf width of the ears is increased by 3.26%, the leaf length of the ears is increased by 2.40%, the leaf length of the ears is increased by 1.45%, the light receiving area of the leaves is increased, and meanwhile, statistics of leaf included angles shows that the leaf included angle of the ears is reduced by 5.78%, the leaf included angle of the ears is reduced by 2.00%, the leaf included angle of the ears is reduced by 12.94%, and the compact d129 strain meets the close planting tolerance condition.

After harvesting, detailed statistics and comparisons of yield traits were also made. As a result, as shown in FIG. 5, d129 was reduced by 5.29% in spike length, 3.04% in row number, and 8.59% in spike number compared to WT; the single spike grain weight and the hundred grain weight are respectively reduced by 19.71 percent and 19.99 percent; the grain length, grain width and grain thickness are respectively reduced by 4.29%, 3.82% and 1.17%; the seed yield is increased by 0.89%. By examining the mutant and wild type strain types, it was found that the mutant strain type has a significant effect on yield, but the strain height is reduced more than WT, and the strain type is compact, and thus the strain type has utility in the breeding work of the inbred line.

2.2.3 Application of br2-rph1

The lodging resistance of the corn plants can be enhanced to a certain extent, but often, some bad characters can be caused by the lodging resistance, the plant types are too compact, the photosynthesis efficiency is low due to the mutual shielding of leaves, the female ears are shortened, the yield of the single plant is reduced due to the reduction of seeds, and the probability of encountering bad weather in the pollination period and the harvest period is increased due to the advance or delay of the growth period. Therefore, the plant height should be improved while avoiding the influence of the bad shape as much as possible. To further explore the value of br2-rph1 application, agronomic traits were examined for WT/d129 hybrid plants and wild type.

2.1.1 obtaining dwarf maize plants as male parent, wild B73 maize varieties as female parent, hybridizing the female parent and the male parent, and mixing and pollinating to obtain F ₁ And the generation is the WT/d129 hybrid plant.

As seen from FIG. 6, WT/d129 was shorter in plant height, lower in ear position, more compact in upper leaf type, shorter in tassel length, unchanged in number of internodes but shorter in lower internodes, which is a major cause of the decrease in ear position and plant height. And the investigation data are analyzed, the plant height and the spike position of the hybrid are reduced to a certain extent compared with the wild type, and the lodging resistance of the plants is enhanced.

The excellent phenotype of WT/d129 shows that d129 has important application prospect in variety dwarf improvement, br2-rph1 is used as 1 new plant height dwarf gene, has small influence on hybrid seeds, has no extreme adverse character, can be used for corn molecular breeding application, and is expected to provide ideal gene resources for corn plant type breeding.

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention.

Claims

1. Corn dwarf genebr2-rph1Characterized in that the method comprisesbr2-rph1The gene is cornBR2Mutation of 1144 th base of gene CDS sequence from G to A, saidbr2-rph1The CDS sequence of the gene is shown as SEQ ID NO. 1.

2. A maize dwarf gene as set forth in claim 1br2-rph1The application in corn molecular breeding.

3. The use according to claim 2, wherein the maize variety to be improved is combined with a maize dwarf genebr2-rph1The variety of (2) is hybridized and backcrossed for breeding, and the excellent character of the corn variety to be improved is screened and the corn dwarf gene is containedbr2-rph1And (3) obtaining the low strain of the corn variety to be improved.

4. The use according to claim 2, wherein the maize genome to be modified is subjected to gene editing techniquesBR2The 1144 th base of the gene is mutated from G to A, so that a short strain of the maize variety to be improved is obtained.