CN113528539A - Zea mays seedling stage zebra leaf and white grain gene zb10 and linked molecular marker and application thereof - Google Patents

Abstract

The invention discloses a maize seedling zebra leaf and white grain gene zb10 and its linkage molecular marker and application, belonging to the field of molecular genetics, the nucleotide sequence of the gene is shown in SEQ ID No.2, the gene zb10 contains a 7bp base insertion on the first exon of the coding region, and the sequence is AACGCGCGC. The zebra leaf and white grain gene zb10 only affects the leaf color and grain color characteristics of corn at the seedling stage, has no effect on the gene functions of other genes, has no effect on other agronomic characteristics and the like, is stable in heredity under different genetic backgrounds, and has great utilization value in corn seed production.

Description

Zea mays seedling stage zebra leaf and white grain gene zb10 and linked molecular marker and application thereof

Technical Field

The invention relates to the field of molecular genetics, in particular to a maize seedling zebra leaf and white grain gene zb10 and a linked molecular marker and application thereof.

Background

Corn is an important C4 plant, 90% of dry weight yield of the corn is from photosynthesis of leaves and has important influence on dry matter accumulation, so that the key point for improving crop yield is to improve the light energy utilization rate of the leaves, and the corn yield is influenced in most cases due to the color change of the corn leaves. Researches show that the photosynthetic pigment is essential in photosynthetic reactions as an important pigment for absorbing light energy, mainly comprises three types of chlorophyll, carotenoid and phycobilin, wherein chlorophyll is the most important pigment, and the main reason for causing the color change of the leaves is that related genes for synthesizing and degrading chlorophyll or developing chloroplast in plants are mutated, so that the biosynthesis and degradation processes of chlorophyll are influenced, the content of chlorophyll in the leaves is changed, and finally the color of the leaves is changed. The corn leaf color mutant has obvious phenotype and is easy to observe, and is widely applied to production practice and scientific research. Besides being applied to new variety cultivation as a character marker, the leaf color mutant has important effects on the aspects of researching plant chloroplast development, photomorphogenesis and the like.

Based on the results of the maize database (MaizeGDB), it was shown that there are over 200 maize leaf color mutant genes mapped and cloned to date, most of which regulate leaf color variation mainly through two pathways involved in chlorophyll biosynthesis and affecting chloroplast development. Leaf color mutant genes often directly or indirectly influence the biosynthesis and degradation pathways of various pigments, especially chlorophyll, in plants, and thus leaf color mutations are also often referred to as chlorophyll-deficient mutations. Using maize leaf color mutants, partial chlorophyll biosynthesis and genes involved in chloroplast development have also been cloned sequentially, including ygl-1(Guan et al 2016), yglm1(Wang et al 2014), ygl3(Du et al 2018), v-1(Miao et al 2016), elm1 and elm2(Shi et al 2013; Sawers et al 2004), vyl-Chr.1 and vyl-Chr.9(Zhang et al 2006), tdy1 and dty2(Braun et al 2006; Baker and un2008), Oy1 (Sas Brase et al 2006) and 62(Zhong et al 2015), and so on. The emergence of albino phenotype of maize mutant vp5 leaf at seedling stage is caused by the influence of expression of chloroplast proteins due to deletion of the phytohormone ABA (Hu et al 2006). The maize hcf60-ml mutant encodes a chloroplast ribosomal protein gene, whose mutation results in a significant reduction in the chloroplast ribosomal size subunit content, resulting in a plant albino phenotype at seedling stage (Schulters et al 2000). The yellow streaks of the maize leaf color mutant ys1 are caused by defects in the iron ion uptake system (Wiren et al 1994). Currently, there are 9 zebra leaf genes reported in the maize database, namely zb1, zb2, zb3, zb4, zb6, zb7, zb8, zn1 and zn 2. Wherein, zb7 gene codes 1-hydroxy-2-methyl-2- (E) -butenyl-4-pyrophosphate reductase and participates in 2-methyl-D-erythritol-4-phosphate pathway, and the functional inactivation of the gene can cause zebra stripes on maize leaves (Lu et al.2012); another maize leaf streak mutant, camouflow 1(cf1), which encodes a porphobilinogen deaminase involved in the chlorophyll synthesis pathway, has been shown to produce a leaf streak mutation which results in a leaf color change (Huang et al 2009). Although many leaf color related genes have been cloned, the biosynthesis and development of plant chloroplasts are extremely complex processes, are commonly regulated by nuclear genes and self plastid genomes, and the acquisition of corn leaf color regulating genes and the research on regulating mechanisms thereof are repeated and far-reaching.

Because of the shortage of maize germplasm resources and the narrow genetic basis of inbred lines, the mutant obtained by artificial mutagenesis is regarded as a way of efficiently obtaining functional genes, and the leaf color mutant is used as a basic material for genetic research and is an ideal material for researching the biological functions of genes. Therefore, the development of new corn leaf color mutants and the cloning of the regulatory genes thereof have important significance for disclosing the molecular mechanism of chlorophyll biosynthesis and chloroplast development and the high photosynthetic efficiency breeding practice of corn.

Disclosure of Invention

The invention aims to provide a maize seedling-stage zebra leaf and white grain gene zb10 and a linked molecular marker and application thereof, so as to solve the problems in the prior art.

The invention relates to a method for breeding a P group of corn inbred line seeds Lhc bred by an external germplasm resource, which adopts an artificial simulated space environment to mutate the inbred line seeds, a leaf color mutant is found in the mutagenized offspring, the mutant shows that the leaf color at the seedling stage is yellow-white alternate horizontal stripes, the new leaf color after the 9-leaf stage is normal, and the grain color is white. Further studies have shown that the leaf and grain color mutants are controlled by a single recessive gene, which is designated zebra leaf 10(zb 10). It is on this unexpected discovery that the present invention has been achieved.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a maize seedling zebra leaf and white grain gene zb10, the nucleotide sequence of which is shown in SEQ ID No. 2.

Furthermore, the maize seedling zebra leaf and white grain gene zb10 contains a 7bp base insertion on the first exon of the coding region, and the sequence is AACGCGCGC.

The invention also provides application of the maize seedling-stage zebra leaf and white grain gene zb10 in maize seed production, which is used for identifying or screening maize zebra leaf and white grain characters.

The invention also provides a protein coded by the zebra leaf and white grain gene zb10 in the seedling stage of the corn, and the amino acid sequence of the protein is shown as SEQ ID No. 3.

The invention also provides application of the molecular marker linked with the maize seedling-stage zebra leaf and white grain gene zb10 in identification or screening of maize zebra leaf and white grain traits.

The primer pair for amplifying the molecular marker comprises an upstream primer shown as SEQ ID No.4 and a downstream primer shown as SEQ ID No. 5.

The invention also provides a method for identifying or screening zebra leaf and white-grain corn, which comprises the following steps:

(1) extracting corn DNA to be detected;

(2) amplifying the gene to be detected by adopting the primer pair;

(3) sequencing the amplification product, if the amplification product has 7bp base insertion with the sequence of AACGCGCGC at the mutation site, the amplification product is zebra leaf and white-grain corn.

The invention also provides a molecular marker of the maize seedling-stage zebra leaf and white grain gene zb10, and an amplification primer of the molecular marker comprises an upstream primer shown in SEQ ID No.6 and a downstream primer shown in SEQ ID No. 7.

The method for identifying or screening the zebra leaf and the white-grain corn by using the molecular marker comprises the following steps: taking the genome DNA of the corn material to be detected as a target, and carrying out PCR amplification by using the amplification primer of the molecular marker to obtain an amplification product; performing gel electrophoresis on the amplification product; if the test sample shows a single strip and the strip is consistent with the wild-type corn strip, the corn material to be tested is a wild-type plant, if the test sample shows a single strip and the strip is consistent with the mutant corn strip, the corn material to be tested is a homozygous mutant plant, and if the test sample shows a double strip, the corn material to be tested is a heterozygous plant of the wild-type plant and the mutant.

The invention discloses the following technical effects:

the invention provides a maize seedling-stage zebra leaf and white grain gene zb10, which only affects the leaf color and grain color characteristics of maize seedling stage, has no effect on the gene function of other genes, thus having no effect on other agronomic characteristics and the like, has stable heredity under different genetic backgrounds, and has great utilization value in maize seed production.

The molecular marker provided by the invention is tightly linked with the gene zb10, can be used for identifying or screening whether plants contain the zb10 gene, has reliable and simple detection results, can improve the identification efficiency of the leaf color and grain color traits of corn in the seedling stage by identifying corn materials, is used as a genetic marker for corn molecular breeding, and has higher application value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows the expression of mutant zb10 with wild type;

FIG. 2 shows photosynthetic pigment content of mutant zb10 and wild type leaf;

figure 3 shows the carotenoid content of mutant zb10 and wild type grain;

FIG. 4 shows the ultrastructure of the mutant zb10 and wild chloroplast, wherein, the wild leaf at leaf stage A and D.4, the white region of the mutant at leaf stage B and E.4, and the green region of the mutant at leaf stage C and F.4; A. b, C: 5000X, D, E, F: 15000X;

FIG. 5 is a schematic map-based cloning of Zea mays seedling-stage zebra leaf mutant zb 10;

FIG. 6 shows homology analysis of ZB10 gene;

FIG. 7 shows the expression analysis of ZB10 gene.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1 phenotypic Change of Zea mays leaf mutant at seedling stage

1. Phenotype of mutant zb10

The identification of the maize zebra leaf mutant in multiple places of Sichuan, Yunnan and Hainan shows that the mutant has stable leaf mutant phenotype in seedling stage, and shows that the mutant is zebra leaf or mosaic-like leaf in seedling stage, and all new leaves have normal phenotype after 8-9 leaf stage (figure 1); meanwhile, mutant grains are mutated into white grains.

2. Photosynthetic pigment and seed pigment difference of mutant seedling stage leaf

The 4-leaf stage leaves of the mutant zb10 and the wild type Lhc were measured for chlorophyll a, b (Chl a, Chl b), Total chlorophyll (Total Chl) and carotenoid (Car) changes, and the results showed that the content of the photosynthetic pigments chlorophyll a and b, Total chlorophyll and carotenoid (Car) in the mutant white region was significantly lower than that in the mutant green region and the wild type leaves (FIG. 2). Meanwhile, the carotenoid content in the mutant mature grains is also significantly lower than that of the wild type (fig. 3). The pigment content is measured by a spectrophotometer method.

3. Observation of mutant leaf chloroplast tissue structure and ultrastructure

The maize mutant zb10 and wild chloroplast ultrastructure are observed through a transmission electron microscope to find that the wild chloroplast is in a regular ellipse shape and has a substrate lamellar structure, thylakoids are complete and stacked into basal grains, and osmium-philic bodies are uniformly distributed, while the chloroplast in a white region of the mutant is in an irregular ellipse shape and has a substrate lamellar structure, almost no thylakoids, no basal grains or a small amount of basal grains, and the osmium-philic bodies are aggregated; the chloroplast morphology of the mutant green region is basically consistent with that of the wild type, thylakoids are complete and stacked into basal granules, osmium-philic bodies are uniformly distributed, and only the chloroplast stroma and thylakoids are low in density. The results indicated that the chloroplast structure in the mutant was disrupted (FIG. 4).

Example 2 genetic analysis of mutation traits of zebra leaf and white grain mutant zb10 at seedling stage

The method comprises the following steps:

pollinating the zebra leaf mutant zb10 by using wild type Lhc, B73 and Mo17 to obtain F1 generation, and selfing the F1 generation to obtain F2 generation; phenotype survey and statistics were performed on plants of generation F2. Genetic analysis shows that the zebra stripe and white grain phenotype of the mutant is controlled by a single recessive nuclear gene. After identifying zebra stripe and grain individual plants in the F2 segregating population of zb10 and wild type Lhc and B73, leaf genomic DNA was extracted for gene re-sequencing and mapping (Table 1). The corn leaf genome DNA is extracted by a CTAB method.

TABLE 1 genetic analysis of mutant zb10 with wild type, B73 and Mo17

Example 3 map-based cloning of Zea mays seedling Zebra leaf mutant Gene zb10

1. Initial localization of mutant Gene zb10

30 plants with zebra leaf and grain color phenotypes are selected from F2 segregating populations obtained by hybridizing and selfing the mutant zb10 in the example 1 and wild type Lhc, the leaves are taken to extract DNA, the DNA is equivalently mixed to form DNA pool, the mutant DNA pool is randomly interrupted and warehoused by an ultrasonic method, and the resequencing is carried out. And (3) comparing the sequencing raw data to a B73 reference genome through SOAP2 software after quality monitoring to obtain reads aligned to a unique position. The SOAPsnp software was then used to search for SNPs and INDELs between the mutants and the B73 reference genome. And analyzing the sequencing data of the wild type Lhc to obtain the SNP and the INDEL locus between the wild type Lhc and the B73. Then comparing the two groups of compared differential sites, removing SNP and INDEL sites of the same genotype as the wild type in the mutant, and screening according to the Lhc Allele index of the wild type being more than or equal to 0.8 and the reads covering the sites being more than or equal to 5. SNP index values were calculated for the remaining sites screened and all remaining sites screened were mapped on the chromosome (FIG. 5). The result shows that the differential sites distributed in clusters at the end of the short arm of the chromosome 2 are linked with the phenotypic characters, and the candidate segments are preliminarily positioned at the end of the chromosome 2.

2. Fine localization of the zb10 Gene

Carrying out fine positioning by using an F2 population constructed by the mutants zb10 and B73 in example 1, screening SSR markers with polymorphism at the tail end of the short arm of the No.2 chromosome between the mutants zb10 and B73, carrying out PCR analysis on a wild type mixed pool (mixed DNA of 20 leaf normal green plants) and a mutant type mixed pool (mixed DNA of 20 leaf zebra stripe plants) in an F2 generation segregation population by using the obtained polymorphic SSR markers, carrying out PCR on zebra stripe mutant single plants in 100F 2 generation segregation populations, reading bands after gel electrophoresis of PCR products, carrying out gene linkage analysis, and finding that SSR markers umc2246 and umc2248 on the short arm of the No.2 chromosome are linked with a target gene; further expanding the F2 localization population to 892 leaf zebra stripe mutant individuals. The zb10 gene was then located within an interval of about 350Kb between markers InDel133 and umc2245 using population linkage analysis of 892 leaf zebra stripe mutant individuals with the screened polymorphic SSR and InDel markers based on published SSR and InDel polymorphic markers (FIG. 5). The primer sequences are as follows:

upstream primer umc2246-F (SEQ ID No.8): AGGCTCCAGCTCTAGGGGAGT;

downstream primer umc2246-R (SEQ ID No.9): GTGAACTGTGTAGCGTGGAGTTGT;

upstream primer umc2248-F (SEQ ID No. 10): CTCCGGTTTAATTTCTCCTCGAC, respectively;

downstream primer umc2248-R (SEQ ID No. 11): GGAACCCATCTCGCTACTAGCTC, respectively;

upstream primer InDel133-F (SEQ ID No. 12): AGGTTCTTTGCGCTGGAGAC, respectively;

downstream primer InDel133-R (SEQ ID No. 13): AACAAAATCCAAAGCGGTTG, respectively;

upstream primer umc2245-F (SEQ ID No. 14): GCCCTGTTATTGGAACAGTTTACG, respectively;

downstream primer umc2245-R (SEQ ID No. 15): CGTCGTCTTCGACATGTACTTCAC are provided.

3. Map-based cloning of the mutant Gene zb10

And then carrying out mutation site analysis on the gene coding region in the fine positioning interval of 350kb by using SnpEff, searching a key candidate gene, and finding that a 7bp base insertion exists at 2779425 bases of No.2 chromosome in the fine positioning segment, wherein the insertion sequence fragment is as follows: AACGCGCGC, the insertion site is located at the first exon of gene Zm00001d 001909. Primers are designed at two ends of the candidate gene Zm00001d001909, the gene is amplified in a mutant and a wild type, and sequence alignment shows that the insertion of 7bp base does exist in the first exon of the gene in the mutant, so that the translation of the gene is stopped early. The primer sequences are as follows:

an upstream primer 1909-F (SEQ ID No.4): GAAAGTCGCCATCCCATAC;

the downstream primer 1909-R (SEQ ID No.5): CGAGGCAATGCTTCACAG.

The sequence of the wild type Lhc is shown as SEQ ID No.1, the sequence of the mutant zb10 is shown as SEQ ID No.2, and the amino acid sequence of the protein coded by the mutant zb10 gene is shown as SEQ ID No. 3.

Wherein, SEQ ID No. 1:

ATGGCGGTGG CTTCGACCTC GCCGCTATCC GCCAAGCCCG CCACGGCCCC CTCGCCGCCC GCTCCGGTGT CCGGGTTCCT CGCTCTCCCC GCCCGCCGCG GCCGCGCAAC GCGCCTCGGC TCCGCCGCCG CGTGGAGGAG GCTTCGCGTG GAGGCGATCT GGAAGCAGCA GGAGAAGCAG CGGGCAGAGG TGTCCGTCGA GGAACCCGCC CCCGTCAGGG AGGCCGCCGC GCCCCTGGAC GGAGTCGGAG CTGACGACCC CATGGTTCCT TCCTCGGACG AGAGCTGGGT GGTCAGGCTC GAGCAGTCGG TCAACATTTT CCTCACGGAA TCGGTGATTA TACTACTCAA TACCGTGTAC CGTGATCGGA ACTACGCCAG GTTTTTTGTG CTGGAGACGA TTGCCAGGGT GCCGTATTTC GCGTTCATAT CGGTGCTTCA CATGTATGAA ACCTTTGGCT GGTGGAGACG AGCTGATTAT CTAAAAGTTC ACTTTGCGCA GAGCTTGAAC GAGTTTCATC ATCTCTTGAT CATGGAAGAA TTGGGTGGCA ACGCTATATG GATTGATTGT TTCCTTGCTC GATTTATGGC GTTTTTTTAC TACTTCATGA CTGTTGCGAT GTACATGTTG AGCCCACGAA TGGCATATCA CTTCTCTGAA TGTGTGGAGA GACATGCGTA CTCCACCTAT GATAAGTTCC TCAAGCTCCA TGAAGAGGAA TTGAAAACAC TACCAGCTCC AGAGGCAGCA TTGAACTATT ACCTGAATGA GGACCTTTAC TTATTTGATG AGTTTCAGAC AACAAGAATT CCATGTTCTA GGAGGCCTAA AATAGATAAC TTGTATGATG TATTCGTCAA TATACGAGAT GACGAGGCAG AGCACTGCAA GACAATGAAG GCATGTCAAA CACATGGAAG TCTTCGTTCT CCTCACTCAA TGCCGAACTG CTTAGAAGCT GATACAGAAT GTGTAATACC TGAAAACGAT TGTGAAGGTA TTGTGGACTG TGTCAAAAAG TCCCTTACAA AGTAA；

SEQ ID No.2：

ATGGCGGTGG CTTCGACCTC GCCGCTATCC GCCAAGCCCG CCACGGCCCC CTCGCCGCCC GCTCCGGTGT CCGGGTTCCT CGCTCTCCCC GCCCGCCGCG GCCGCGCAAC GCGCAACGCG CCTCGGCTCC GCCGCCGCGT GGAGGAGGCT TCGCGTGGAG GCGATCTGGA AGCAGCAGGA GAAGCAGCGG GCAGAGGTGT CCGTCGAGGA ACCCGCCCCC GTCAGGGAGG CCGCCGCGCC CCTGGACGGA GTCGGAGCTG ACGACCCCAT GGTTCCTTCC TCGGACGAGA GCTGGGTGGT CAGGCTCGAG CAGTCGGTCA ACATTTTCCT CACGGAATCG GTGATTATAC TACTCAATAC CGTGTACCGT GATCGGAACT ACGCCAGGTT TTTTGTGCTG GAGACGATTG CCAGGGTGCC GTATTTCGCG TTCATATCGG TGCTTCACAT GTATGAAACC TTTGGCTGGT GGAGACGAGC TGATTATCTA AAAGTTCACT TTGCGCAGAG CTTGAACGAG TTTCATCATC TCTTGATCAT GGAAGAATTG GGTGGCAACG CTATATGGAT TGATTGTTTC CTTGCTCGAT TTATGGCGTT TTTTTACTAC TTCATGACTG TTGCGATGTA CATGTTGAGC CCACGAATGG CATATCACTT CTCTGAATGT GTGGAGAGAC ATGCGTACTC CACCTATGAT AAGTTCCTCA AGCTCCATGA AGAGGAATTG AAAACACTAC CAGCTCCAGA GGCAGCATTG AACTATTACC TGAATGAGGA CCTTTACTTATTTGATGAGT TTCAGACAAC AAGAATTCCA TGTTCTAGGA GGCCTAAAAT AGATAACTTG TATGATGTAT TCGTCAATAT ACGAGATGAC GAGGCAGAGC ACTGCAAGAC AATGAAGGCA TGTCAAACAC ATGGAAGTCT TCGTTCTCCT CACTCAATGC CGAACTGCTT AGAAGCTGAT ACAGAATGTG TAATACCTGA AAACGATTGT GAAGGTATTG TGGACTGTGT CAAAAAGTCC CTTACAAAGT AA；

SEQ ID No.3：

MAVASTSPLS AKPATAPSPP APVSGFLALP ARRGRATRLG SAAAWRRLRV EAIWKQQEKQ RAEVSVEEPA PVREAAAPLD GVGADDPMVP SSDESWVVRL EQSVNIFLTE SVIILLNTVY RDRNYARFFV LETIARVPYF AFISVLHMYE TFGWWRRADY LKVHFAQSLN EFHHLLIMEE LGGNAIWIDC FLARFMAFFY YFMTVAMYML SPRMAYHFSE CVERHAYSTY DKFLKLHEEE LKTLPAPEAA LNYYLNEDLY LFDEFQTTRI PCSRRPKIDN LYDVFVNIRD DEAEHCKTMK ACQTHGSLRS PHSMPNCLEA DTECVIPEND CEGIVDCVKK SLTK。

the candidate gene Zm00001d001909 is annotated with functions, and the gene accession number Zm00001d001909 is presumed to be a key candidate gene of the zebra leaf and the grain color mutant at the seedling stage according to the mutant phenotype and the literature report of homologous genes (see figure 5).

Example 4 Zea mays seedling stage zebra leaf and white grain gene zb10 Key candidate gene InDel molecular marker validation

InDel primers are designed at two ends of a mutation site of the candidate gene and named as: PTInDel3, performing linkage analysis on F2 population individuals of ZB10 and B73, and finding that the individuals with normal leaf blades and grain colors and no separation show a single strip and are consistent with a wild-type strip type, namely, the individuals are materials with the genotype of ZB10/ZB 10; the single plant with normal leaves and showing separation shows double bands, and the double bands are consistent with the F1 band type of the ZB10 and B73 hybrid, namely the material with ZB10/ZB10 hybrid genotype; leaf zebra stripes and grain color and no segregation individual plants appeared as single bands and were of the same band type as mutant zb10, i.e., material with zb10/zb10 genotype. All zebra leaf phenotype individuals were co-segregating with the marker (FIG. 5). The primer sequences are as follows:

an upstream primer PTInDel3-F (SEQ ID No.6) is TCCAACACGCACCAGCATC;

the downstream primer PTInDel3-R (SEQ ID No.7) is CGGGAGAACAGCACAGGGAC.

Example 5 molecular evolution and expression profiling of ZB10 resulting in Zea mays leaf mutation phenotype at seedling stage

1. Homology analysis of ZB10 Gene

Homologous sequences of candidate genes in different species are searched in the websites of Gramene (http:// www.gramene.org) and NCBI (https:// www.ncbi.nlm.nih.gov), and homologous genes of ZB10 in 12 species such as rice, tomato, Arabidopsis thaliana and soybean are made into an evolutionary tree (MAGE-X) (FIG. 6). The results showed that maize ZB10 has the highest homology with the ospthox gene in rice.

2. Expression analysis of ZB10 Gene

The method comprises the steps of extracting total RNA of roots, stems, leaves, bracts, male ears, filaments, embryos and endosperm of wild type Lhc of corn by using a TRIzol (purchased from Beijing snow Jett company), carrying out reverse transcription to cDNA by using a HiScript II 1st Strand cDNA Synthesis Kit of Vazyme company, carrying out fluorescent quantitative PCR detection by using a fluorescent quantitative PCR instrument (Bio-Rad), carrying out qPCR by using a Genious 2X SYBR Green Fast qPCR Mix Kit of ABClonal company, and operating all related methods of the kits according to related instructions. The results showed that ZB10 was expressed in all tissues, and the expression level was relatively high in green tissues such as leaf, stem, tassel, filament, and bract, especially in leaf, which is consistent with the important role of the gene in photosynthesis (FIG. 7).

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Sichuan university of agriculture

Xianyang Academy of Agricultural Sciences

<120> Zebra leaf and white grain gene zb10 in corn seedling stage and linked molecular marker and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1035

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcggtgg cttcgacctc gccgctatcc gccaagcccg ccacggcccc ctcgccgccc 60

gctccggtgt ccgggttcct cgctctcccc gcccgccgcg gccgcgcaac gcgcctcggc 120

tccgccgccg cgtggaggag gcttcgcgtg gaggcgatct ggaagcagca ggagaagcag 180

cgggcagagg tgtccgtcga ggaacccgcc cccgtcaggg aggccgccgc gcccctggac 240

ggagtcggag ctgacgaccc catggttcct tcctcggacg agagctgggt ggtcaggctc 300

gagcagtcgg tcaacatttt cctcacggaa tcggtgatta tactactcaa taccgtgtac 360

cgtgatcgga actacgccag gttttttgtg ctggagacga ttgccagggt gccgtatttc 420

gcgttcatat cggtgcttca catgtatgaa acctttggct ggtggagacg agctgattat 480

ctaaaagttc actttgcgca gagcttgaac gagtttcatc atctcttgat catggaagaa 540

ttgggtggca acgctatatg gattgattgt ttccttgctc gatttatggc gtttttttac 600

tacttcatga ctgttgcgat gtacatgttg agcccacgaa tggcatatca cttctctgaa 660

tgtgtggaga gacatgcgta ctccacctat gataagttcc tcaagctcca tgaagaggaa 720

ttgaaaacac taccagctcc agaggcagca ttgaactatt acctgaatga ggacctttac 780

ttatttgatg agtttcagac aacaagaatt ccatgttcta ggaggcctaa aatagataac 840

ttgtatgatg tattcgtcaa tatacgagat gacgaggcag agcactgcaa gacaatgaag 900

gcatgtcaaa cacatggaag tcttcgttct cctcactcaa tgccgaactg cttagaagct 960

gatacagaat gtgtaatacc tgaaaacgat tgtgaaggta ttgtggactg tgtcaaaaag 1020

tcccttacaa agtaa 1035

<210> 2

<211> 1042

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcggtgg cttcgacctc gccgctatcc gccaagcccg ccacggcccc ctcgccgccc 60

gctccggtgt ccgggttcct cgctctcccc gcccgccgcg gccgcgcaac gcgcaacgcg 120

cctcggctcc gccgccgcgt ggaggaggct tcgcgtggag gcgatctgga agcagcagga 180

gaagcagcgg gcagaggtgt ccgtcgagga acccgccccc gtcagggagg ccgccgcgcc 240

cctggacgga gtcggagctg acgaccccat ggttccttcc tcggacgaga gctgggtggt 300

caggctcgag cagtcggtca acattttcct cacggaatcg gtgattatac tactcaatac 360

cgtgtaccgt gatcggaact acgccaggtt ttttgtgctg gagacgattg ccagggtgcc 420

gtatttcgcg ttcatatcgg tgcttcacat gtatgaaacc tttggctggt ggagacgagc 480

tgattatcta aaagttcact ttgcgcagag cttgaacgag tttcatcatc tcttgatcat 540

ggaagaattg ggtggcaacg ctatatggat tgattgtttc cttgctcgat ttatggcgtt 600

tttttactac ttcatgactg ttgcgatgta catgttgagc ccacgaatgg catatcactt 660

ctctgaatgt gtggagagac atgcgtactc cacctatgat aagttcctca agctccatga 720

agaggaattg aaaacactac cagctccaga ggcagcattg aactattacc tgaatgagga 780

cctttactta tttgatgagt ttcagacaac aagaattcca tgttctagga ggcctaaaat 840

agataacttg tatgatgtat tcgtcaatat acgagatgac gaggcagagc actgcaagac 900

aatgaaggca tgtcaaacac atggaagtct tcgttctcct cactcaatgc cgaactgctt 960

agaagctgat acagaatgtg taatacctga aaacgattgt gaaggtattg tggactgtgt 1020

caaaaagtcc cttacaaagt aa 1042

<210> 3

<211> 344

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ala Val Ala Ser Thr Ser Pro Leu Ser Ala Lys Pro Ala Thr Ala

1 5 10 15

Pro Ser Pro Pro Ala Pro Val Ser Gly Phe Leu Ala Leu Pro Ala Arg

20 25 30

Arg Gly Arg Ala Thr Arg Leu Gly Ser Ala Ala Ala Trp Arg Arg Leu

35 40 45

Arg Val Glu Ala Ile Trp Lys Gln Gln Glu Lys Gln Arg Ala Glu Val

50 55 60

Ser Val Glu Glu Pro Ala Pro Val Arg Glu Ala Ala Ala Pro Leu Asp

65 70 75 80

Gly Val Gly Ala Asp Asp Pro Met Val Pro Ser Ser Asp Glu Ser Trp

85 90 95

Val Val Arg Leu Glu Gln Ser Val Asn Ile Phe Leu Thr Glu Ser Val

100 105 110

Ile Ile Leu Leu Asn Thr Val Tyr Arg Asp Arg Asn Tyr Ala Arg Phe

115 120 125

Phe Val Leu Glu Thr Ile Ala Arg Val Pro Tyr Phe Ala Phe Ile Ser

130 135 140

Val Leu His Met Tyr Glu Thr Phe Gly Trp Trp Arg Arg Ala Asp Tyr

145 150 155 160

Leu Lys Val His Phe Ala Gln Ser Leu Asn Glu Phe His His Leu Leu

165 170 175

Ile Met Glu Glu Leu Gly Gly Asn Ala Ile Trp Ile Asp Cys Phe Leu

180 185 190

Ala Arg Phe Met Ala Phe Phe Tyr Tyr Phe Met Thr Val Ala Met Tyr

195 200 205

Met Leu Ser Pro Arg Met Ala Tyr His Phe Ser Glu Cys Val Glu Arg

210 215 220

His Ala Tyr Ser Thr Tyr Asp Lys Phe Leu Lys Leu His Glu Glu Glu

225 230 235 240

Leu Lys Thr Leu Pro Ala Pro Glu Ala Ala Leu Asn Tyr Tyr Leu Asn

245 250 255

Glu Asp Leu Tyr Leu Phe Asp Glu Phe Gln Thr Thr Arg Ile Pro Cys

260 265 270

Ser Arg Arg Pro Lys Ile Asp Asn Leu Tyr Asp Val Phe Val Asn Ile

275 280 285

Arg Asp Asp Glu Ala Glu His Cys Lys Thr Met Lys Ala Cys Gln Thr

290 295 300

His Gly Ser Leu Arg Ser Pro His Ser Met Pro Asn Cys Leu Glu Ala

305 310 315 320

Asp Thr Glu Cys Val Ile Pro Glu Asn Asp Cys Glu Gly Ile Val Asp

325 330 335

Cys Val Lys Lys Ser Leu Thr Lys

340

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaagtcgcc atcccatac 19

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgaggcaatg cttcacag 18

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tccaacacgc accagcatc 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgggagaaca gcacagggac 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggctccagc tctaggggag t 21

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtgaactgtg tagcgtggag ttgt 24

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctccggttta atttctcctc gac 23

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggaacccatc tcgctactag ctc 23

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aggttctttg cgctggagac 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aacaaaatcc aaagcggttg 20

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gccctgttat tggaacagtt tacg 24

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cgtcgtcttc gacatgtact tcac 24

Claims (9)

1. A maize seedling zebra leaf and white grain gene zb10 is characterized in that the nucleotide sequence is shown in SEQ ID No. 2.

2. The maize seedling zebra leaf and white grain gene zb10 of claim 1, wherein the maize seedling zebra leaf and white grain gene zb10 comprises a 7bp base insertion in the first exon of coding region, and the sequence is AACGCGCGC.

3. The application of the maize seedling zebra leaf and white grain gene zb10 in maize seed production according to claim 1 or 2, which is used for identifying or screening maize zebra leaf and white grain traits.

4. The protein encoded by the maize seedling zebra leaf and white grain gene zb10 as claimed in claim 1, wherein the amino acid sequence of the protein is shown as SEQ ID No. 3.

5. The application of a molecular marker linked with the maize seedling-stage zebra leaf and white grain gene zb10 in identifying or screening maize zebra leaf and white grain traits in claims 1 or 2.

6. A primer pair for amplifying the molecular marker of claim 5, comprising an upstream primer as set forth in SEQ ID No.4 and a downstream primer as set forth in SEQ ID No. 5.

7. A method for identifying or screening zebra leaf and white corn is characterized by comprising the following steps:

(1) extracting corn DNA to be detected;

(2) amplifying a test gene using the primer pair of claim 6;

(3) sequencing the amplification product, if the amplification product has 7bp base insertion with the sequence of AACGCGCGC at the mutation site, the amplification product is zebra leaf and white-grain corn.

8. The molecular marker of the maize seedling zebra leaf and white grain gene zb10 as claimed in claim 1 or 2, wherein the amplification primer of the molecular marker comprises an upstream primer as shown in SEQ ID No.6 and a downstream primer as shown in SEQ ID No. 7.

9. The method for identifying or screening zebra leaf and white corn using the molecular marker of claim 8, comprising: performing PCR amplification by using the molecular marker amplification primer of claim 8 to obtain an amplification product, wherein the target is corn material genome DNA to be detected; performing gel electrophoresis on the amplification product; if the test sample shows a single strip and the strip is consistent with the wild-type corn strip, the corn material to be tested is a wild-type plant, if the test sample shows a single strip and the strip is consistent with the mutant corn strip, the corn material to be tested is a homozygous mutant plant, and if the test sample shows a double strip, the corn material to be tested is a heterozygous plant of the wild-type plant and the mutant.

Images