CN115807100B

CN115807100B - SNP molecular marker related to abdominal fat rate of broiler chickens and application thereof

Info

Publication number: CN115807100B
Application number: CN202210866915.5A
Authority: CN
Inventors: 罗庆斌; 栾康; 聂庆华; 张细权; 黎镇晖; 张德祥; 罗文�; 范折霞; 詹惠娜
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2022-07-22
Filing date: 2022-07-22
Publication date: 2023-08-22
Anticipated expiration: 2042-07-22
Also published as: CN115807100A

Abstract

The invention discloses a SNP molecular marker related to the abdominal fat rate of broiler chickens and application thereof, and belongs to the technical field of gene detection. The invention provides a SNP molecular marker related to the abdominal fat rate of broiler chickens, the sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the genotype of the mutation site of the SNP molecular marker comprises TT, TC and CC. The invention also provides a specific primer group for detecting the SNP and a specific detection method, which can efficiently, sensitively and rapidly detect the SNP sequence so as to screen and identify low-fat broiler breeds. The SNP molecular marker can effectively screen low-abdomen-fat broiler chickens, provides a new technical scheme for genetic breeding of broiler chickens, and is suitable for large-scale popularization and application in the broiler chicken raising industry.

Description

SNP molecular marker related to abdominal fat rate of broiler chickens and application thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to a SNP molecular marker related to abdominal fat rate of broiler chickens and application thereof.

Background

Genetic selection of commercial broilers is always biased to increase the growth speed of broilers and increase the feed conversion rate. The sales mode of centralized slaughtering and ice fresh marketing in the broiler industry can generate a large amount of slaughtering waste, abdominal fat belongs to waste which is difficult to reprocess, and excessive abdominal fat deposition is one of the main problems facing the broiler industry at present, has great negative influence on feed efficiency, and simultaneously causes huge economic loss for processing factories. In such a concentrated slaughtering environment, how to reduce the abdominal fat deposition during the production process becomes a big problem for chicken raising enterprises. Therefore, in genetic breeding of broilers, breeders and academic workers are beginning to pay attention to solving the problem of excessive fat deposition on the abdomen of broilers.

In modern poultry breeding work, molecular breeding dominates. Molecular Marker Assisted Selection (MAS) methods are widely used in molecular breeding, such as Single Nucleotide Polymorphisms (SNPs), restriction Fragment Length Polymorphisms (RFLP), and the like. The SNP markers have the advantages of large quantity, wide distribution and easy accurate identification, and are widely applied to genetic breeding research. The SNPs which are obviously related to the abdominal fat properties are screened out for marker assisted selection by researching the target genes related to the abdominal fat deposition, so that a certain help can be provided for improving the abdominal fat deposition of the broiler chickens.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to the abdominal fat rate of broiler chickens and application thereof, so as to solve the problems in the prior art. The molecular marker can realize early screening of the abdominal fat rate of the broiler chickens, and provides a new molecular marker resource for the marker-assisted selection of the chickens.

In order to achieve the above object, the present invention provides the following solutions:

the technical scheme is as follows: the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the 108 th site of the sequence shown as SEQ ID NO. 1 is a SNP mutation site, and the site has T/C mutation.

Further, genotypes of the SNP mutation sites include TT, TC and CC.

The second technical scheme is as follows: the SNP molecular marker is applied to screening of low-abdomen-fat-rate broiler chickens.

The technical scheme is as follows: a primer group for detecting the SNP molecular marker, wherein the nucleotide sequence of the primer group is shown as SEQ ID NO: 2-3.

The technical scheme is as follows: a kit for screening low-abdomen-fat broiler chickens, which comprises the primer group.

The fifth technical scheme is that: a method for screening low-abdomen-fat broiler chickens by using the SNP molecular markers comprises the following steps:

(1) Extracting DNA of chicken to be detected;

(2) Obtaining and sequencing the target fragment: amplifying the molecular marker by using the DNA as a template and analyzing the genotype of the molecular marker according to the sequencing result of the amplified product by using a primer group;

(3) Individuals retaining the CC genotype are selected.

Further, the primer group comprises a nucleotide sequence shown as SEQ ID NO. 2-3.

Further, in step (2), the reaction system for PCR amplification comprises: 100ng of DNA template, 2 XM 5 HiPerplus Taq HiFi PCR mix. Mu.l of each of the upstream and downstream primers, 0.75. Mu.l of each of the downstream primers, ddH ₂ O was made up to 30. Mu.l.

Further, in step (2), the reaction conditions for the PCR amplification are: pre-denaturation at 95℃for 3min; denaturation at 94℃for 25s, annealing at 58℃for 25s, extension at 72℃for 10s,32 cycles; extending at 72℃for 5min.

The sixth technical scheme is as follows: the application of the molecular marker or the primer group or the kit in broiler breeding.

The technical proposal is that: the application of the molecular marker or the primer group or the kit in screening low-abdominal-fat broiler chickens.

The invention discloses the following technical effects:

the method for screening the low-abdomen-fat-rate broiler chickens by using the screened molecular markers has the advantages of simplicity and convenience in operation, high speed, low cost, high accuracy and the like. The implementation of the invention can effectively screen the low-abdomen-fat-rate broiler chickens, provides a new technical scheme for genetic breeding of the broiler chickens, and is suitable for large-scale popularization and application in the broiler chickens breeding industry.

Drawings

FIG. 1 shows agarose gel electrophoresis results, wherein M is a Marker of DL2000, and is 2000, 1000, 750, 500, 250 and 100bp from top to bottom respectively; 1-8 are all PCR products;

FIG. 2 shows the different genotypes of RGS16 g.2860T > C locus.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

EXAMPLE 1SNP site screening

The experimental object: 500 hens of N409 line (Guangxi Ling mountain chicken) were bred with blood samples of the isotactic family provided by the Guangdong Wen's emerging chicken farm, and were fed with uniform free feeding and drinking water during the breeding period.

Selection of candidate genes: candidate gene RGS16 related to fat deposition of slow yellow-feathered broilers is selected.

Extraction of genomic DNA: extracting chicken genome DNA by using a blood DNA extraction kit, extracting genome DNA of a blood sample according to the operation of a blood DNA extraction instruction, detecting the concentration and OD value of the DNA sample, and obtaining the DNA concentration of more than 25 ng/. Mu.l and OD ₂₆₀ /OD ₂₈₀ Samples with the ratio between 1.7 and 1.8 are stored at the temperature of minus 20 ℃ for standby, DNA is removed, and samples with insufficient quality are extracted.

Candidate gene primer: according to the chicken candidate genome sequences published in NCBI, primers are designed to amplify candidate gene fragments by using Oligo7 software, and the specific primers are shown in Table 1:

TABLE 1 PCR amplification primers for candidate genes

PCR amplification and sequence analysis of candidate gene fragments, wherein the PCR reaction system is as follows: 100ng of DNA template, 2 XM 5 HiPerplus Taq HiFi PCRmix. Mu.l of each of the upstream and downstream primers, 0.75. Mu.l of each of the downstream primers, ddH ₂ O was made up to 30. Mu.l. The PCR reaction conditions were: pre-denaturation at 95℃for 3min; denaturation at 94℃for 25s,58 ℃Annealing 25s, extending at 72 ℃ for 12s,32 cycles; extending at 72 ℃ for 5min; preserving at 12 ℃.

Agarose gel electrophoresis is carried out on the amplified product, and the result is judged according to the size of the product: PCR amplified products were detected by EB-containing 1.5% agarose gel electrophoresis at a voltage of 100V for 20min, and bands (about 1000bp, as shown in FIG. 1) were observed in a gel imaging system and recovered and purified. The PCR amplified product (SEQ ID NO: 4) was directly sequenced.

The SEQ ID NO. 4 is as follows:

CACCGCCTCCCAGTGCAAGTCCTGATGACTTCTTCCCCCCCAGCCCCACTCACCGCCTGTCCCTCTGTTGCAGATGGGGTGACCGCCTTCCACACCTTCCTGAAGACTGAGTTCAGTGAGGAGAACTTGGACTTCTGGCTGGCCTGCGAGGACTTCAAGAAGACCCGCTCCAAAACCAAGCTGGCCTCCAAAGCCAACAGGATCTTCGAGGAGTTTGTCCAAAGCGAGGCACCCAGAGAGGTGAGAGCTGACCCTGCCTCTGCTGCGTGGCACTGGATGGGATGGGGAAGGGATAAAACATCCTAAAATATCCATTGGGTTTCGTTAGATGCTATTTCAGCTCGGTGGGAAGGCTTGGCCTCATTGACCTGAGCTTTCCGATCTCATGTGGTGACCCAAAATGAAGGGGTGTAAAGGCCTGCAAGTTCCATACGAGGAAAAAATTATTCTCAGAAGGAACGGTGAAGCATTGGTACAGGCTGCCCGGAGAGGTGATGGAGTCACCATCCCTGGGGGTTTTCAAGGGAAGGGTAGATACTGCACTTAGTGACATGGTCTGAGCAGTCAGGGGCACGGGTTGATGGTGGGTCATGATGATCATAGAGGTCTTTCCATCCGTAATGATTCTATGATTCCATGTCTTCACCCTCTTTAGGATAAACCTGCTCCCCTCCCCACGTTTGGCCAGTGCCAAGCTAACAATTATGGGCACTCCTTCCTTGCAGGTCAACATTGACCACGAAACCAGGGAGATCACCAGGAAGAACCTGACGGGAGCCACCTCCGCTTGCTTCAACGAGGCGCAGGCGAAGACCCGCACCCTGATGGAGAAGGACTCCTACCCCCGCTTCCTGAAGTCAGCCTCCTACCAGGACATGACCAAGCAGGCCACCAGCCGCAGCATCAACAAGCGTTTGCACACCTGACCCATGCCCAACACCAAACCCGCTCCGGGTGGGCACCCAGGGCCTGGTGGTGGGGTTTTGGCTGAAATCCCAGCCTTCCAGCAGGACGCCCAGGACCTTGA。

the sequencing result of SEQ ID NO. 4 is analyzed by Seqman in DNASTAR software, SNP sites (SEQ ID NO. 1) which are obviously related to the abdominal fat rate are obtained through screening according to peak diagrams, the partial sequencing peak diagrams are shown in FIG. 2, and specific information of the SNP sites is shown in Table 2.

TABLE 2 SNP site information Table

Example 2 association analysis of SNP loci with abdominal fat Properties

And typing the SNP locus according to the sequencing result. After the samples with incomplete typing data or no corresponding abdominal fat character data are removed, the SNP locus and the genotype of the SNP locus are subjected to correlation analysis on the abdominal fat rate, abdominal fat weight and subcutaneous fat thickness characteristics of N409 population recorded by abdominal fat characteristics (abdominal fat rate and abdominal fat weight) by using a single-factor analysis of variance model in SPSS 21.0 software.

Example 3 analysis of the differences between genotypes of SNPs significantly correlated with abdominal fat Rate

The analysis results of the different genotypes of the SNP sites significantly related to the abdominal fat percentage and the characteristics of the abdominal fat percentage, abdominal fat weight, subcutaneous fat thickness, etc. by the SPSS 21.0 software are shown in table 3, wherein the weights of the individuals with the CC genotypes are not significantly different, the abdominal fat weight of the individuals with the CC genotypes is significantly lower than that of the individuals with the TT genotypes (p=0.03) and the TC genotypes (p=0.011), and the abdominal fat percentage of the individuals with the CC genotypes is lower than that of the individuals with the TT genotypes (p=0.055) and significantly lower than that of the TC genotypes (p=0.013).

TABLE 3 analysis of genotypes of SNPs significantly correlated with abdominal fat percentage

Note that: numbers in brackets after genotypes indicate the number of samples of genotypes; the same letters among the 3 genotypes indicate that the difference is not obvious (P > 0.05), the different letters indicate that the difference is obvious (P < 0.05), and no letter mark indicates that the difference between the genotypes and other 2 genotypes is not obvious.

Therefore, the RGS16 gene marker is used for assisting in selection, and chickens with low abdominal fat rate are selected in the broiler chicken breeding, so that the breeding work of high-quality chickens is promoted.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. A method for screening low-fat broiler chickens by utilizing SNP molecular markers related to the abdominal fat rate of the broiler chickens, which is characterized by comprising the following steps:

(1) Extracting DNA of chicken to be detected;

(2) Obtaining and sequencing the target fragment: amplifying the SNP molecular marker by using the DNA as a template and using a primer group, and analyzing the genotype of the SNP molecular marker according to the sequencing result of an amplified product;

(3) Selecting an individual retaining the CC genotype;

the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the 108 th site of the sequence shown as SEQ ID NO. 1 is a SNP mutation site, and the site has T/C mutation; genotypes of the SNP mutation sites comprise TT, TC and CC; the chicken to be detected is Guangxi Ling pheasant.

2. The method of claim 1, wherein the nucleotide sequence of the primer set is set forth in SEQ ID No. 2-3.

3. The method of claim 1, wherein in step (2), the amplification reaction system comprises: 100ng of DNA template, 2 XM 5 HiPer plus Taq HiFi PCR mix. Mu.l of each of the upstream and downstream primers, 0.75. Mu.l of each of the downstream primers, ddH ₂ O was made up to 30. Mu.l.

4. The method of claim 1, wherein in step (2), the amplification reaction conditions are: pre-denaturation at 95℃for 3min; denaturation at 94℃for 25s, annealing at 58℃for 25s, extension at 72℃for 10s,32 cycles; extending at 72℃for 5min.

5. The application of the SNP molecular marker related to the abdominal fat rate of broiler chickens in screening of Guangxi Ling pheasants with low abdominal fat rate is characterized in that the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the 108 th site of the sequence shown as SEQ ID NO. 1 is a SNP mutation site, and the site has T/C mutation; genotypes of the SNP mutation sites include TT, TC and CC.