CN115807100A

CN115807100A - SNP molecular marker related to broiler abdominal fat percentage and application thereof

Info

Publication number: CN115807100A
Application number: CN202210866915.5A
Authority: CN
Inventors: 罗庆斌; 栾康; 聂庆华; 张细权; 黎镇晖; 张德祥; 罗文�; 范折霞; 詹惠娜
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2022-07-22
Filing date: 2022-07-22
Publication date: 2023-03-17
Anticipated expiration: 2042-07-22
Also published as: CN115807100B

Abstract

The invention discloses an SNP molecular marker related to broiler abdominal fat percentage and application thereof, belonging to the technical field of gene detection. The invention provides an SNP molecular marker related to the abdominal fat percentage of broiler chickens, the sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the genotype of the mutation site of the SNP molecular marker comprises TT, TC and CC. The invention also provides a specific primer group for detecting the SNP and a specific detection method, which can detect the SNP sequence efficiently, sensitively and quickly so as to screen and identify the broiler varieties with low abdominal fat percentage. The SNP molecular marker can effectively screen the broiler chickens with low abdominal fat percentage, provides a new technical scheme for the genetic breeding of the broiler chickens, and is suitable for large-scale popularization and application in the broiler chicken breeding industry.

Description

SNP molecular marker related to broiler abdominal fat percentage and application thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to an SNP molecular marker related to broiler abdominal fat percentage and application thereof.

Background

The genetic selection of commercial broilers always favors the improvement of the growth speed of the broilers and the improvement of the feed conversion rate. A great amount of slaughtering waste can be generated in a centralized slaughtering and icy fresh marketing mode in the broiler industry, abdominal fat belongs to waste which is difficult to reprocess, excessive abdominal fat deposition is one of the main problems in the current broiler industry, the feed efficiency is greatly influenced, and huge economic loss is caused to a processing factory. Under the intensive slaughtering environment, how to reduce abdominal fat deposition in the production process becomes a great problem for chicken raising enterprises. Therefore, in the genetic breeding of broiler chickens, breeding workers and academic workers begin to attach importance to solving the problem of excessive fat deposition in the abdominal region of broiler chickens.

In modern poultry breeding work, molecular breeding dominates. Molecular Marker Assisted Selection (MAS) methods are widely used in molecular breeding, such as Single Nucleotide Polymorphisms (SNPs), restriction Fragment Length Polymorphisms (RFLPs), and the like. The SNP markers have the advantages of large quantity, wide distribution and easy and accurate identification, and are widely applied to genetic breeding research. Through researching the target genes related to abdominal fat deposition and screening SNPs remarkably related to abdominal fat characters for marker-assisted selection, certain help can be provided for improving abdominal fat deposition of broiler chickens.

Disclosure of Invention

The invention aims to provide an SNP molecular marker related to the abdominal fat percentage of broiler chickens and application thereof, so as to solve the problems in the prior art. The molecular marker can realize early screening of the abdominal fat rate of the broiler chicken and provide a new molecular marker resource for marker-assisted selection of the chicken.

In order to achieve the purpose, the invention provides the following scheme:

the first technical scheme is as follows: the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the 108 th site of the sequence shown as SEQ ID NO. 1 is a SNP mutation site, and T/C mutation exists at the site.

Further, the genotype of the SNP mutation site includes TT, TC and CC.

The second technical scheme is as follows: an application of the SNP molecular marker in screening the broiler with low abdominal fat percentage.

The third technical scheme is as follows: a primer group for detecting the SNP molecular marker has a nucleotide sequence shown as SEQ ID NO: 2-3.

The technical scheme is as follows: a kit for screening broiler chickens with low abdominal fat percentage comprises the primer group.

The technical scheme is as follows: a method for screening broiler chickens with low abdominal fat percentage by using the SNP molecular markers comprises the following steps:

(1) Extracting DNA of a chicken to be detected;

(2) Obtaining and sequencing a target fragment: amplifying the molecular marker by using the DNA as a template and utilizing a primer group, and analyzing the genotype of the molecular marker according to the sequencing result of an amplification product;

(3) Individuals were selected that retained the CC genotype.

Further, the primer group comprises nucleotide sequences shown as SEQ ID NO. 2-3.

Further, in the step (2), the reaction system for PCR amplification comprises: DNA template 100ng,2 XM 5HiPerplus Taq HiFi PCR mix 15. Mu.l, upstream and downstream primers 0.75. Mu.l each, ddH ₂ Make up to 30. Mu.l of O.

Further, in the step (2), the reaction conditions of the PCR amplification are: pre-denaturation at 95 ℃ for 3min; denaturation at 94 ℃ for 25s, annealing at 58 ℃ for 25s, extension at 72 ℃ for 10s, and 32 cycles; extension at 72 ℃ for 5min.

The technical scheme is six: the molecular marker or the primer group or the kit is applied to broiler breeding.

The technical scheme is seven: the molecular marker or the primer group or the kit is applied to screening of the broiler chickens with low abdominal fat percentage.

The invention discloses the following technical effects:

the method for screening the broiler chickens with the low abdominal fat percentage by using the screened molecular markers has the advantages of simplicity and convenience in operation, high speed, low cost, high accuracy and the like. The implementation of the invention can effectively screen the broiler chickens with low abdominal fat percentage, provides a new technical scheme for the genetic breeding of the broiler chickens, and is suitable for large-scale popularization and application in the broiler chicken breeding industry.

Drawings

FIG. 1 shows the result of agarose gel electrophoresis, wherein M is a Marker of DL2000, which is 2000, 1000, 750, 500, 250, 100bp from top to bottom; 1-8 are PCR products;

FIG. 2 is a drawing of the different genotypes of RGS16 g.2860T > C site.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1SNP site screening

Subject: blood samples were taken from 500N 409 (guangxi Ling pheasant) hen families of the same sibling family, which were provided by the emerging chicken farm of wenshi, guangdong, and were fed with uniform free food intake and water intake during the feeding period.

Selection of candidate genes: selecting a candidate gene RGS16 related to the fat deposition of the slow yellow-feathered broilers.

Extraction of genomic DNA: extracting chicken genome DNA by using a blood DNA extraction kit, extracting the genome DNA of a blood sample according to the operation of a blood DNA extraction instruction, detecting the concentration and OD value of the DNA sample, and enabling the DNA concentration to be more than 25 ng/mu l and the OD value to be larger than ₂₆₀ /OD ₂₈₀ Samples with a ratio of 1.7-1.8 were stored at-20 ℃ for later use, DNA was eliminated, and samples of insufficient quality were extracted.

Candidate gene primers: according to the candidate genome sequence of chicken published in NCBI, oligo7 software is used for designing primers to amplify candidate gene segments, and specific primers are shown in Table 1:

TABLE 1 PCR amplification primers for candidate genes

PCR amplification and sequence analysis of the candidate gene fragment, wherein the PCR reaction system is as follows: DNA template 100ng,2 XM 5HiPerplus Taq HiFi PCRmix 15. Mu.l, upstream and downstream primers 0.75. Mu.l each, ddH ₂ Make up to 30. Mu.l of O. The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 3min; denaturation at 94 ℃ for 25s, annealing at 58 ℃ for 25s, extension at 72 ℃ for 12s, and 32 cycles; extending for 5min at 72 ℃; storing at 12 deg.C.

Carrying out agarose gel electrophoresis on the amplification product, and judging the result according to the size of the product: the PCR amplification product was detected by 1.5% agarose gel electrophoresis containing EB under a voltage of 100V for 20min, and a band (about 1000bp, as shown in FIG. 1) was observed in a gel imaging system, and recovered and purified. The product obtained by PCR amplification (SEQ ID NO: 4) was directly sequenced.

The SEQ ID NO. 4 is as follows:

CACCGCCTCCCAGTGCAAGTCCTGATGACTTCTTCCCCCCCAGCCCCACTCACCGCCTGTCCCTCTGTTGCAGATGGGGTGACCGCCTTCCACACCTTCCTGAAGACTGAGTTCAGTGAGGAGAACTTGGACTTCTGGCTGGCCTGCGAGGACTTCAAGAAGACCCGCTCCAAAACCAAGCTGGCCTCCAAAGCCAACAGGATCTTCGAGGAGTTTGTCCAAAGCGAGGCACCCAGAGAGGTGAGAGCTGACCCTGCCTCTGCTGCGTGGCACTGGATGGGATGGGGAAGGGATAAAACATCCTAAAATATCCATTGGGTTTCGTTAGATGCTATTTCAGCTCGGTGGGAAGGCTTGGCCTCATTGACCTGAGCTTTCCGATCTCATGTGGTGACCCAAAATGAAGGGGTGTAAAGGCCTGCAAGTTCCATACGAGGAAAAAATTATTCTCAGAAGGAACGGTGAAGCATTGGTACAGGCTGCCCGGAGAGGTGATGGAGTCACCATCCCTGGGGGTTTTCAAGGGAAGGGTAGATACTGCACTTAGTGACATGGTCTGAGCAGTCAGGGGCACGGGTTGATGGTGGGTCATGATGATCATAGAGGTCTTTCCATCCGTAATGATTCTATGATTCCATGTCTTCACCCTCTTTAGGATAAACCTGCTCCCCTCCCCACGTTTGGCCAGTGCCAAGCTAACAATTATGGGCACTCCTTCCTTGCAGGTCAACATTGACCACGAAACCAGGGAGATCACCAGGAAGAACCTGACGGGAGCCACCTCCGCTTGCTTCAACGAGGCGCAGGCGAAGACCCGCACCCTGATGGAGAAGGACTCCTACCCCCGCTTCCTGAAGTCAGCCTCCTACCAGGACATGACCAAGCAGGCCACCAGCCGCAGCATCAACAAGCGTTTGCACACCTGACCCATGCCCAACACCAAACCCGCTCCGGGTGGGCACCCAGGGCCTGGTGGTGGGGTTTTGGCTGAAATCCCAGCCTTCCAGCAGGACGCCCAGGACCTTGA。

the sequencing result of SEQ ID NO. 4 is analyzed by Seqman in DNASTAR software, SNP sites (SEQ ID NO: 1) which are obviously related to the abdominal fat percentage are obtained by screening according to a peak diagram, a partial sequencing peak diagram is shown in figure 2, and the specific information of the SNP sites is shown in table 2.

TABLE 2 SNP site information Table

Example 2 Association analysis of SNP sites with Abdominal fat trait

And (4) typing the SNP sites according to a sequencing result. After the typing data is incomplete or the samples without corresponding abdominal fat trait data are removed, the SNP sites and SNP site genotypes are subjected to correlation analysis on the abdominal fat rate, abdominal fat weight and subcutaneous fat thickness traits of the N409 population recorded with abdominal fat traits (abdominal fat rate and abdominal fat weight) by using a single-factor variance analysis model in SPSS 21.0 software.

Example 3 analysis of the differences between genotypes of SNPs significantly associated with abdominal fat Rate

The results of analysis of different genotypes at SNP sites significantly correlated with abdominal fat rate by SPSS 21.0 software, as well as abdominal fat rate, abdominal fat weight, subcutaneous fat thickness, and the like, are shown in table 3, where there is no significant difference in live weight among the individuals, abdominal fat weight is significantly lower in the CC genotype than in the TT genotype (p = 0.03) and TC genotype (p = 0.011), abdominal fat rate is lower in the CC genotype than in the TT genotype (p = 0.055), and significantly lower in the TC genotype (p = 0.013).

TABLE 3 analysis of the differences in genotypes of SNPs significantly associated with abdominal fat Rate

Note: the number in parentheses after the genotype indicates the number of samples of the genotype; the same letter between 3 genotypes indicates that the difference is not significant (P > 0.05), different letters indicate that the difference is significant (P < 0.05), and no letter mark indicates that the difference between the genotype and other 2 genotypes is not significant.

Therefore, the broiler chickens with low abdominal fat percentage can be selected in broiler breeding through RGS16 gene marker-assisted selection, and the breeding work of high-quality chickens is promoted.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Claims

1. An SNP molecular marker related to the abdominal fat percentage of broiler chickens is characterized in that the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein the 108 th site of the sequence shown as SEQ ID NO. 1 is an SNP mutation site, and T/C mutation exists at the site.

2. The molecular marker of claim 1, wherein the genotype of the SNP mutation site includes TT, TC, and CC.

3. A primer set for detecting the SNP molecular marker of claim 1, wherein the nucleotide sequence of the primer set is set forth in SEQ ID NO: 2-3.

4. A kit for screening broiler chickens with low abdominal fat percentage, which comprises the primer set of claim 3.

5. The method for screening the broiler chickens with low abdominal fat percentage by using the SNP molecular marker of claim 1, which comprises the following steps:

(1) Extracting DNA of the chicken to be detected;

(2) Obtaining and sequencing a target fragment: amplifying the molecular marker by using the DNA as a template and using a primer group, and analyzing the genotype of the molecular marker according to the sequencing result of an amplification product;

(3) Individuals were selected that retained the CC genotype.

6. The method of claim 5, wherein the primer set comprises the nucleotide sequence set forth in SEQ ID nos. 2-3.

7. The method of claim 5, wherein in step (2), the amplification reaction system comprises: DNA template 100ng,2 XM 5HiPerplusTaqHiFiPCRmix 15. Mu.l, upstream and downstream primers 0.75. Mu.l each, ddH ₂ Make up to 30. Mu.l of O.

8. The method of claim 5, wherein in step (2), the amplification reaction conditions are: pre-denaturation at 95 ℃ for 3min; denaturation at 94 ℃ for 25s, annealing at 58 ℃ for 25s, extension at 72 ℃ for 10s, and 32 cycles; extension at 72 ℃ for 5min.

9. Use of the molecular marker of claim 1, the primer set of claim 3, or the kit of claim 4 in broiler breeding.

10. The application of the molecular marker of claim 1, the primer set of claim 3 or the kit of claim 4 in screening of broiler chickens with low abdominal fat percentage.