CN115807068A

CN115807068A - Quality detection method of adapter primer for high-throughput sequencing and high-throughput sequencing method

Info

Publication number: CN115807068A
Application number: CN202211146078.5A
Authority: CN
Inventors: 吴辉辉; 张丹丹; 李心如
Original assignee: Genewiz Suzhou Ltd
Current assignee: Genewiz Suzhou Ltd
Priority date: 2022-09-20
Filing date: 2022-09-20
Publication date: 2023-03-17

Abstract

The invention discloses a quality detection method and a high-throughput sequencing method of a joint primer for high-throughput sequencing. The quality inspection method comprises the following steps: mixing a to-be-detected joint primer and a 3 'joint for a connection reaction, adding an extension primer for an extension reaction to form a DNA second chain, adding a 5' joint for a connection reaction, performing PCR amplification to obtain an MGI library, and sequencing and analyzing data of the MGI library based on an MGI sequencing platform, wherein the 3 'joint and the 5' joint are joints matched with the MGI sequencing platform. The invention designs a quality detection method of the adapter primer for high-throughput sequencing, designs an MGI library construction strategy of the adapter primer to be detected, performs sequencing and data analysis based on an MGI sequencing platform, can accurately analyze the integrity, mutation rate, deletion rate and insertion rate of the adapter primer, and evaluates the quality of the adapter primer, thereby effectively performing quality detection on the high-throughput sequencing adapter primer.

Description

Quality detection method and high-throughput sequencing method of adapter primer for high-throughput sequencing

Technical Field

The invention belongs to the technical field of molecular biology, and relates to a quality detection method and a high-throughput sequencing method of a joint primer for high-throughput sequencing.

Background

High-throughput sequencing (hereinafter-sequencing), also known as "Next-generation" sequencing technology (NGS), or Massively Parallel Sequencing (MPS), is different from conventional Sanger sequencing, and can perform parallel sequencing on a large number of nucleic acid molecules in parallel at one time, and usually a sequencing reaction can yield sequencing data of not less than 100 Mb.

Currently, widely used high throughput sequencing technologies mainly include LifeTech, illumina and watson-promoted MGI DNB (DNA nanoballs, DNB) technologies, and Nanopore and Pacific Biosciences-promoted single molecule sequencing technologies. The technology can simultaneously sequence millions of DNA molecules, detect hundreds or even thousands of samples in parallel at one time, and the detection process usually comprises the following steps: library construction kits (such as library construction kits provided by manufacturers such as illumina, roche, NEB and the like) are adopted for constructing libraries and sequencing analysis is carried out, and the main process for constructing the libraries comprises the following steps: 1. breaking the large-fragment DNA into DNA fragments with the length of 200-500 bp; 2. carrying out end repair on the fragmented DNA to form flat ends at two ends; 3. adding A bases to the 3' end of the DNA fragment using the terminal transferase activity of a polymerase; 4. hybridizing and ligating dsDNA having a 3'A terminus with a double-stranded Y-type adaptor having a 3' terminal T base; 5. and performing PCR enrichment on the product connected with the linker to obtain a library capable of being subjected to on-machine sequencing. The quality of the NGS adaptor primer used in the library establishment process directly influences the data output and the data quality of a sequencer, however, a quality control method of the quality of the adaptor primer applied in the library establishment process is lacked at present.

In conclusion, the quality detection method for the high-throughput sequencing adapter primer is provided, helps to improve the production process, can better provide high-quality NGS library building and sequencing adapter primers, and has important significance in the field of high-throughput sequencing.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a quality detection method and a high-throughput sequencing method of a linker primer for high-throughput sequencing, the quality detection method of the linker primer for high-throughput sequencing is designed, the quality of the linker primer, including the integrity, mutation rate, deletion rate, insertion rate and the like of the linker primer, can be effectively evaluated, the production process can be assisted to be improved, high-quality NGS (Next Generation Standard) library building and sequencing linker primers are provided, and the method has important significance for the field of high-throughput sequencing.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a method for quality control of an adapter primer for high-throughput sequencing, the method comprising:

mixing a to-be-detected joint primer and a 3 'joint for a connection reaction, adding an extension primer for an extension reaction to form a DNA second chain, adding a 5' joint for a connection reaction, performing PCR amplification to obtain an MGI library, and sequencing and analyzing data of the MGI library based on an MGI sequencing platform, wherein the 3 'joint and the 5' joint are joints matched with the MGI sequencing platform.

According to the invention, the quality inspection method of the joint primer for high-throughput sequencing is designed, the MGI library construction strategy of the joint primer to be tested is designed, sequencing and data analysis are carried out based on an MGI sequencing platform, the integrity, mutation rate, deletion rate and insertion rate of the joint primer can be accurately analyzed, the quality of the joint primer is evaluated, and thus the quality analysis of the high-throughput sequencing primer is effectively carried out.

In the invention, the MGI (Huada) sequencing platform is a sequencing technology platform with synthesis and sequencing by taking a unique DNBSEQ technology, a DNA nanosphere technology and a combined probe anchoring polymerization (cPAS) sequencing technology as cores, and in the sequencing process, a fluorescence signal is detected and converted into an electric signal to record a base.

In the present invention, the flow of the method for analyzing the integrity, mutation rate, deletion rate and insertion rate of the adapter primer is shown in FIG. 1, and the manual for using the oligonucleotide quality analysis software V1.0 software (accession No. 2021SR 1616309) can be referred to.

In the invention, the adapter primers used for high-throughput sequencing can be effectively analyzed without special limitation.

Preferably, the test adaptor primer comprises an illumina platform adaptor primer.

Preferably, the 3' linker is modified with biotin.

The quality inspection method of the adapter primer for high-throughput sequencing can effectively evaluate any adapter primer suitable for the illumina platform.

Preferably, the nucleic acid sequence of the adapter primer to be detected comprises a sequence shown in SEQ ID NO.1 or SEQ ID NO. 2.

In the present invention, the linkers suitable for the MGI sequencing platform are all suitable for the present invention, and no particular limitation is required.

Preferably, the nucleic acid sequence of the 3' linker comprises the sequences shown in SEQ ID No.3 and SEQ ID No. 4.

Preferably, the nucleic acid sequence of the 5' linker comprises the sequences shown in SEQ ID No.5 and SEQ ID No. 6.

In the present invention, the 5' adaptor is a double-stranded structure, and is usually synthesized in a single-stranded form, and the two single strands are usually prepared into a double-stranded adaptor by annealing in a mixed manner before use.

Preferably, the annealing procedure comprises an incubation at 95 ℃ for 10s, followed by a reduction to 10 ℃ at a rate of 0.1 ℃/s, as shown in Table 1.

TABLE 1

Preferably, the ligation reaction procedure of the 3' linker comprises: reacting at 35-40 ℃ for 40-80min, and reacting at 90-98 ℃ for 30 s-2 min.

Preferably, the ligation reaction system of the 3' linker comprises 10 XT 4 DNA ligation buffer, PEG-8000, ATP, T4 DNA ligase and water.

In the present invention, the extension linkers applicable to the MGI sequencing platform are all applicable to the present invention, and no special restriction is required.

Preferably, the nucleic acid sequence of the extension primer comprises the sequence shown in SEQ ID NO. 7.

In the invention, primers suitable for PCR amplification of MGI sequencing platform library construction are all suitable for the invention, and no special limitation is required.

Preferably, the nucleic acid sequence of the PCR amplified primer comprises the sequence shown in SEQ ID NO.8 and SEQ ID NO. 9.

SEQ ID NO.1：

AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T。

SEQ ID NO.2：

CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T。

SEQ ID NO.3：Pho-AAGTCGGATC[C3Spacer]10-TEG-biotin。

SEQ ID NO.4：SpacerC12-AA(SpacerC12)GATCCGACTTNNNNNNN-AmC6

SEQ ID NO.5：CCGCTTGGCCTCCGACTT-ddC。

SEQ ID NO.6：

Pho-GAAGTCGGAGGCCAAGCGGTCTTAGGAAGA*C*A*A。

SEQ ID NO.7：

CAACTCCTTGGCTCACAGAACGACATGGCTACGATCC*GA*CT*T。

SEQ ID NO.8：

5’Pho/TCTCAGTACGTCAGCAGTTNNNNNNNNNNCAACTCCTTGGCTCAC。

SEQ ID NO.9：

GGCATGGCGACCTTATCAGNNNNNNNNNNTTGTCTTCCTAAGACC。

Wherein, XXXXXXXXX: represents a specific tag sequence, X can be any base of A, T, G and C; * : carrying out sulfo modification; pho: a phosphorylation modification; [ C3Spacer ]10: 10C 3 arms are connected in series; TEG-biotin: triethylene glycol-biotin; spacerC12: a carbon 12 spacer; amC6: amino carbon 6 modification; ddC: dideoxycytosine; n: may be any of A, T, G and C.

Preferably, the procedure of PCR amplification comprises:

pre-denaturation at 90-98 ℃ for 1-5 min;

denaturation at 95-98 ℃ for 15-30s, annealing at 55-65 ℃ for 10-25s, extension at 70-75 ℃ for 20-40s, and 10-20 circulation;

70～75℃，2～6min。

preferably, the quality control method further comprises a step of purifying the ligation product and the PCR amplification product:

preferably, the quality inspection method comprises the steps of:

(1) Mixing a to-be-detected joint primer and a 3' joint for a connection reaction, purifying a connection product, adding an extension primer, reacting at 35-40 ℃ for 40-80min, and reacting at 90-98 ℃ for 30 s-2 min to form a DNA second chain;

(2) Mixing the product obtained in the step (1) with a 5' joint for a ligation reaction, and performing PCR amplification to obtain an MGI library;

(3) Sequencing and data analysis were performed on the MGI library based on MGI sequencing platform.

In a second aspect, the present invention provides a high-throughput sequencing method comprising:

and (3) performing quality detection on the adapter primer by using the quality detection method of the adapter primer for high-throughput sequencing, and selecting the adapter primer for high-throughput sequencing according to a quality detection result.

Compared with the prior art, the invention has the following beneficial effects:

the invention designs a quality detection method of the adapter primer for high-throughput sequencing, designs an MGI library construction strategy of the adapter primer to be detected, performs sequencing and data analysis based on an MGI sequencing platform, can accurately analyze the integrity, mutation rate, deletion rate and insertion rate of the adapter primer, and evaluates the quality of the adapter primer, thereby effectively guiding high-throughput sequencing, assisting in improving the production process, providing high-quality NGS library construction and sequencing adapter primer, and having important significance for the field of high-throughput sequencing.

Drawings

FIG. 1 is a flow chart of a method for analyzing the integrity, mutation rate, deletion rate and insertion rate of adapter primers;

FIG. 2 is a diagram showing the results of MGI library quality inspection by capillary electrophoresis;

FIG. 3 is a diagram showing the results of quality evaluation of sequence 1 adaptor primers;

FIG. 4 is a diagram showing the results of quality evaluation of the sequence 2 adaptor primer.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and that no limitation of the invention is intended.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

In the embodiment of the invention, the quality detection method of the linker primer for high-throughput sequencing is verified by taking the linker primer of an illumina platform (sequence 1.

Example 1

This example prepares a 5 'linker and a 3' linker.

Mixing 10 μ L of linker 1 (final concentration 100 μ M, SEQ ID NO. 3) with 10 μ L of linker 2 (final concentration 100 μ M, SEQ ID NO. 4); mixing 10 μ L of linker 3 (final concentration 100 μ M, SEQ ID NO. 5) with 10 μ L of linker 4 (final concentration 100 μ M, SEQ ID NO. 6) and 0.2 μ L of 5M (mol/L) NaCl; the mixture was incubated in a PCR apparatus at 95 ℃ for 10s and then reduced to 10 ℃ at a rate of 0.1 ℃/s, following the specific procedure shown in Table 2, linker 1 and linker 2 annealed to form a double stranded 3 'linker and linker 3 and linker 4 annealed to form a double stranded 5' linker.

TABLE 2

Example 2

This example performed 3' linker ligation.

(1) The 3' linker ligation reaction system is shown in Table 3.

TABLE 3

Components	Dosage (mu L)
		10 XT 4 DNA ligation buffer (purchased from Thermo Fisher, cat # EL 0013)	4μL
50％PEG-8000	16μL
		100mM ATP	0.2μL
Illumina linker primers to be detected (SEQ ID NO: 1 and SEQ ID NO: 2)	20pmol
		EXAMPLE 1 preparation of 3' Joint (100. Mu.M)	0.5μL
T4 DNA ligase (30U/. Mu.L) (purchased from Thermo Fisher, cat. No. EL 0013)	1μL
		H ₂ O	Make up to 40 mu L

(2) The procedure for the 3' linker ligation reaction is shown in Table 4.

TABLE 4

Temperature of	Time
		37℃	60min
95℃	1min
		10℃	Holding

After the reaction, the mixture was immediately stored at-20 ℃.

(3) And purifying the streptavidin magnetic beads to recover the 3' joint connection product.

1) Resuspending and mixing Dynabead by using a shaking mixer ^TM MyOne ^TM Streptavidin C1 (purchased from Thermo Fisher, cat # 65001). Magnetic bead cleaning: pipetting X μ L (20 μ L per sample, N samples, then X = N × 20 μ L) of the suspension of magnetic beads, transferring to a 1.5mL EP tube, placing on a magnetic rack for 3min, and discarding the supernatant after the solution is clarified; resuspending and mixing the magnetic beads uniformly with 500. Mu.L of 0.1 xBWT + SDS, placing on a magnetic rack, clarifying, discarding the supernatant, and repeatedly washing with 500. Mu.L of 0.1 xBWT + SDS once; resuspend the beads well with Y μ L0.1 × BWT + SDS (120 μ L per sample, N samples, Y = N × 120 μ L) and place on ice until needed.

2) Taking out the 3' joint connection product from the step-20 ℃, unfreezing, placing in a PCR instrument, incubating at 95 ℃ for 1min, immediately placing on ice for 2min, adding 120 mu L of magnetic bead suspension into each connection product PCR tube, shaking, resuspending and uniformly mixing, and placing in a rotary instrument at room temperature for incubating for 20min.

3) Centrifuging for a short time, placing the magnetic beads on a magnetic frame until the solution is clear, discarding the supernatant (taking care not to absorb the magnetic beads), taking out the magnetic frame, adding 200. Mu.L of 0.1 xBWT + SDS, resuspending, mixing, centrifuging, and placing in the magnetic frame.

4) Discarding the supernatant, adding 100. Mu.L of Wash Buffer into the magnetic beads, resuspending and mixing uniformly, placing in a PCR instrument for incubation at 45 ℃ for 3min, centrifuging for a short time, and placing on a magnetic frame.

5) After the solution was clarified, the supernatant was discarded, 200. Mu.L of 0.1 × BWT was added and resuspended and mixed well with shaking.

(4) Taking the purified and recovered 3' joint connection product to carry out DNA second strand synthesis.

1) The synthesis reaction system (46. Mu.L) is shown in Table 5.

TABLE 5

2) And (4) centrifuging the magnetic bead mixture obtained in the step (3) for a short time, placing the mixture in a magnetic rack for about 5min, removing the supernatant, adding the 46 mu L system, blowing and resuspending the mixture uniformly by using a gun head, placing the mixture in a PCR instrument, incubating the mixture for 2min at 65 ℃, and immediately placing the mixture on ice for later use.

3) mu.L of Klenow fragment (5U/. Mu.L, from NEB, cat # M0212L) was added, tip-blown, mixed, and transferred to a PCR instrument for the procedure shown in Table 6.

TABLE 6

Temperature of	Time
		25℃	5min
35℃	25min

4) And (5) centrifuging for a short time, and placing the magnetic beads on a magnetic rack until the solution is clear.

5) The supernatant was discarded, and the magnetic beads were washed three times with 200. Mu.L of Wash Buffer (containing 15mM sodium chloride, 1.5mM sodium acetate (pH 7.0) and 0.1% SDS).

Example 3

This example was performed for 5' linker ligation and purification.

(1) The system (100. Mu.L) was prepared as in Table 7.

TABLE 7

Components	Volume (mu L)
		H ₂ O	74.75
10 XT 4 DNA ligation buffer	10
		50％PEG-4000	10
EXAMPLE 1 preparation of 5' linker	2
		2％Tween-20	1.25
T4 DNA ligase (5U/. Mu.L)	2

(2) The magnetic beads obtained in step (4) of example 2 were placed in a magnetic rack by brief centrifugation, the supernatant was completely removed, resuspended in the above 100. Mu.L system, and incubated in a metal bath at 22 ℃ and 300rpm for 1h.

(3) The sample was placed in a magnetic rack, the supernatant was removed, and the beads were washed three times with 200. Mu.L of Wash Buffer.

(4) After a short centrifugation, the supernatant was placed in a magnetic rack, completely removed, resuspended with 50. Mu.L of TT Buffer (containing 10mM Tris-HCl (pH7.5) and 0.05% Tween 20) by shaking, centrifuged briefly, incubated at 95 ℃ for 1min, immediately placed in a magnetic rack, and 48. Mu.L of supernatant (containing unamplified library) was immediately transferred to a new 0.2mL PCR for use.

Example 4

This example performs library amplification and the addition of library-specific tags.

(1) The reaction system is shown in Table 8.

TABLE 8

(2) The PCR reaction procedure is shown in FIG. 9.

TABLE 9

(3) Library purification

1) 1 XVAHTS DNA Clean Beads (purchased from Novonoprazan, cat No. N411-01) were used for purification, 50. Mu.L of magnetic Beads were directly added to the PCR reaction system, vortexed or gently pipetted 10 times to mix well, and incubated at 25 ℃ for 5min.

2) The PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid.

3) After the solution was clarified, the supernatant was carefully transferred to a new PCR tube and retained.

4) The PCR tube was kept in the magnetic rack all the time, 200. Mu.L of freshly prepared 80% ethanol was added to rinse the magnetic beads, incubated at 25 ℃ for 30s, and the supernatant was removed.

5) The last step 4) was repeated for a total of two rinses.

6) And keeping the PCR tube in the magnetic frame all the time, and opening the cover to dry the magnetic beads until no ethanol remains. The PCR tube was removed from the magnetic stand and 20. Mu.L of H was added ₂ And O, eluting to obtain the MGI library.

Example 5

DNA library quality detection was performed by capillary electrophoresis, and the MGI library was further circularized according to the instruction manual of the DNA circularization kit (purchased from Huada MGI platform, cat # 1000005259), and sequenced and the results were analyzed.

The result of DNA library quality inspection by capillary electrophoresis of the sequence 1 and sequence 2 linker primers is shown in FIG. 2, and the library is built by applying the quality inspection method of the invention to the illumina sequencing linker primers, so that a high-quality DNA library can be obtained; fig. 3 and 4 show the quality of the sequence 1 and sequence 2 adapter primers, including adapter primer integrity, mutation rate, deletion rate and insertion rate, respectively, with sequence 1 adapter primer integrity of 87.4%, sequence 2 adapter primer integrity of 29.23%, and the remainder being incomplete or containing erroneous bases. The insertion rate, deletion rate and mutation rate statistics for the sequence 1 adapter primers and the sequence 2 adapter primers are shown in table 10.

TABLE 10

	Insertion rate	Rate of absence	Mutation rate
				Sequence 1	0.02％	0.03％	0.04％
Sequence 2	0.02％	0.96％	0.03％

In conclusion, the quality inspection method for the adapter primer for high-throughput sequencing, which is disclosed by the invention, is used for designing the MGI library construction strategy of the adapter primer to be tested, performing sequencing and data analysis based on the MGI sequencing platform, and accurately analyzing the integrity, mutation rate, deletion rate and insertion rate of the adapter primer and evaluating the quality of the adapter primer, so that high-throughput sequencing is effectively guided, the production process can be assisted to be improved, high-quality NGS library building and sequencing adapter primer are provided, and the method has important significance for the field of high-throughput sequencing.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Claims

1. A quality control method of an adaptor primer for high-throughput sequencing, which is characterized by comprising the following steps:

mixing a to-be-detected adaptor primer and a 3 'adaptor for a ligation reaction, adding an extension primer for an extension reaction to form a DNA second chain, adding a 5' adaptor for a ligation reaction, performing PCR amplification to obtain an MGI library, and sequencing and analyzing data of the MGI library based on an MGI sequencing platform;

the 3 'and 5' linkers are linkers that match the MGI sequencing platform.

2. The method for quality control of the adaptor primer for high throughput sequencing according to claim 1, wherein the adaptor primer to be tested comprises an illumina platform adaptor primer;

preferably, the 3' linker is modified with biotin.

3. The method for quality control of the adaptor primer for high throughput sequencing according to claim 1 or 2, wherein the nucleic acid sequence of the adaptor primer to be tested comprises the sequence shown in SEQ ID No.1 or SEQ ID No. 2.

4. The method for quality control of the adaptor primer for high throughput sequencing according to any one of claims 1 to 3, wherein the nucleic acid sequence of the 3' adaptor comprises the sequences shown as SEQ ID No.3 and SEQ ID No. 4;

5. The method for quality control of the adaptor primer for high throughput sequencing according to any one of claims 1 to 4, wherein the ligation reaction procedure of the 3' adaptor comprises: reacting at 35-40 ℃ for 40-80min, and reacting at 90-98 ℃ for 30 s-2 min.

6. The method for quality control of the adaptor primer for high throughput sequencing according to any one of claims 1 to 5, wherein the nucleic acid sequence of the extension primer comprises the sequence shown in SEQ ID No. 7.

7. The method for quality control of the adaptor primer for high throughput sequencing according to any one of claims 1 to 6, wherein the nucleic acid sequence of the primer amplified by PCR comprises the sequence shown as SEQ ID No.8 and SEQ ID No. 9.

8. The method for quality control of adapter primers for high throughput sequencing according to any one of claims 1 to 7, wherein the PCR amplification procedure comprises:

pre-denaturation at 90-98 deg.c for 1-5 min;

denaturation at 95-98 ℃ for 15-30s, annealing at 55-65 ℃ for 10-25s, extension at 70-75 ℃ for 20-40s, and 10-20 cycles;

70～75℃，2～6min。

9. the method for quality control of the adaptor primer for high throughput sequencing according to any one of claims 1 to 8, wherein the method for quality control further comprises the steps of purifying the ligation product and the PCR amplification product;

preferably, the quality inspection method comprises the steps of:

(3) Sequencing and data analysis of the MGI library were performed based on MGI sequencing platform.

10. A high throughput sequencing method, wherein said high throughput sequencing method comprises:

performing quality inspection on the adapter primer by using the method for detecting the quality of the adapter primer for high-throughput sequencing according to any one of claims 1 to 9, and selecting the adapter primer for high-throughput sequencing according to the quality inspection result.