CN113308514A - Construction method and kit for detection library of trace m6A and high-throughput detection method - Google Patents

Construction method and kit for detection library of trace m6A and high-throughput detection method Download PDF

Info

Publication number
CN113308514A
CN113308514A CN202110543274.5A CN202110543274A CN113308514A CN 113308514 A CN113308514 A CN 113308514A CN 202110543274 A CN202110543274 A CN 202110543274A CN 113308514 A CN113308514 A CN 113308514A
Authority
CN
China
Prior art keywords
trace
library
product
primer
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN202110543274.5A
Other languages
Chinese (zh)
Inventor
张好建
印容
常继伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan University WHU
Original Assignee
Wuhan University WHU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan University WHU filed Critical Wuhan University WHU
Priority to CN202110543274.5A priority Critical patent/CN113308514A/en
Publication of CN113308514A publication Critical patent/CN113308514A/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804—Nucleic acid analysis using immunogens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms

Abstract

The invention provides a construction method, a kit and a high-throughput detection method for a detection library of trace m6A, wherein the construction method comprises the following steps: co-immunoprecipitating the total RNA product by using an m6A antibody to obtain an m6A modified RNA product; carrying out reverse transcription on the m6A modified RNA product by using reverse transcriptase, oligo dT30 (shown as SEQ ID NO: 1) and a TSO primer (shown as SEQ ID NO: 2) to obtain a first strand cDNA product; performing PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer (shown as SEQ ID NO: 3) to obtain full-length transcriptome cDNA; after library construction, a detection library of m6A in minute quantities was obtained. The library is subjected to high-throughput sequencing to obtain a detection result of a trace m6A, the total RNA demand is reduced from 100 mu g to 100ng, and the cost is low.

Description

Construction method and kit for detection library of trace m6A and high-throughput detection method
Technical Field
The invention belongs to the technical field of biology, and relates to a construction method of a detection library of trace m6A, a kit and a high-throughput detection method.
Background
N6-methyladenine (N6-methyladenosine, m6A) is a more common modification on eukaryotic mRNA, accounting for approximately 0.1% to 0.4% of the total adenosine content of cellular mRNA. The modification of RNA m6A regulates the stability, positioning, transportation, shearing, translation and the like of RNA, influences the determination of RNA fate, and plays an important role in various biological processes. At present, MeRIP-seq is the main technical means for researching methylation modification of RNA m6A at present. The method comprises the steps of incubating an m6A specific antibody and a random broken mRNA fragment, identifying and immunoprecipitating a m6A modified fragment, and then constructing a high-pass sequencing library and sequencing. The biggest defect of the method is that the method needs the initial sample amount of milligram (mg) grade, and the method cannot be applied to the high-throughput detection of m6A modified mRNA of a small amount or a trace amount of sample. With various rare cell populations (such as stem cells) and the like becoming research hotspots, the development of a technology for high-throughput detection of m6A modified mRNA from a small or trace sample source becomes important.
Therefore, how to establish a high-throughput detection technology for m6A modified mRNA from a micro sample with high general applicability is a technical problem to be solved urgently.
Disclosure of Invention
In order to solve the technical problems, the invention provides a construction method, a kit and a high-throughput detection method of a detection library of trace m6A, which can reduce the total RNA requirement from 100mg to 100ng, and has the advantages of low cost and high general applicability.
In a first aspect of the present invention, there is provided a method for constructing a detection library of trace m6A, the method comprising:
extracting total RNA in a cell sample to obtain a total RNA product;
co-immunoprecipitating the total RNA product with an m6A antibody to obtain an m6A modified RNA product;
carrying out reverse transcription on the m6A modified RNA product by using reverse transcriptase, oligo dT30 and a TSO primer to obtain a first strand cDNA product; wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2 is shown in the specification;
performing PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer to obtain full-length transcriptome cDNA; wherein the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3 is shown in the specification;
and constructing a library of the full-length transcriptome cDNA to obtain a detection library of trace m 6A.
Further, the co-immunoprecipitating the total RNA product with m6A antibody to obtain m6A modified RNA product comprising:
and adding the total RNA product into a co-immunoprecipitation buffer containing an anti-m 6A-antibody and protein A/G-magnetic beads, uniformly mixing, incubating, performing magnetic separation, removing supernatant, and washing with a buffer containing an RNase inhibitor to obtain an m6A modified RNA product.
Further, the m6A modified RNA product is subjected to reverse transcription by using reverse transcriptase, oligo dT30 and TSO primer to obtain a first strand cDNA product, which comprises:
adding the m6A modified RNA product into oligo dT30 and dNTP for first incubation and centrifugation, then adding reverse transcriptase, reverse transcriptase buffer solution, TSO primer and RNase inhibitor, mixing uniformly and carrying out second incubation to obtain a first strand cDNA product.
Further, the conditions of the first incubation are: incubating at 72 + -2 deg.C for 3 + -1 min; the conditions of the second incubation are: incubating at 42 + -2 deg.C for 90 + -2 min, and incubating at 70 + -2 deg.C for 15 + -2 min.
Further, 1. mu.L, 10. mu.M oligo dT30 and 1. mu.L, 100. mu.M dNTP were added per (0.001-0.004). mu.g of the M6A-modified RNA product; to this second incubation was added 0.5. mu.L reverse transcriptase, 5. mu.L reverse transcriptase buffer, 1. mu.L, 10. mu.M TSO primer and 0.5. mu.L LRNA enzyme inhibitor.
Further, the first strand product of the cDNA is PCR amplified and purified using an ISPCR primer to obtain a full-length transcriptome cDNA, comprising:
adding 0.5 mu L of the first strand cDNA product into 10 mu M ISPCR primer and 20 mu LKAPA HiFi HotStart ReadyMix (2 x), mixing uniformly, performing PCR amplification, and then purifying to obtain full-length transcriptome cDNA, wherein the conditions of the PCR amplification are as follows: 3min at 98 ℃; the following steps were performed for 18 cycles: 20s at 98 ℃, 15s at 67 ℃ and 3min at 72 ℃; 5min at 72 ℃; keeping at 4 ℃.
In a second aspect of the invention, there is provided a test library of trace m6A obtained using the method.
In a third aspect of the present invention, there is provided a high throughput detection method of trace m6A, the method comprising: and (3) carrying out high-throughput sequencing on the detection library of the trace m6A to obtain a detection result of the trace m 6A.
In a fourth aspect of the present invention, there is provided a kit for constructing a detection library of trace m6A, the kit comprising: reverse transcriptase, oligo dT30, TSO primer and ISPCR primer, wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2, the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3, respectively.
In the fifth aspect of the invention, the application of the method for constructing the detection library of the trace m6A, the method for constructing the detection library of the trace m6A, the method for detecting the trace m6A at high throughput, or the kit for constructing the detection library of the trace m6A in the detection of the trace m6A is provided.
One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
the invention provides a construction method, a kit and a high-throughput detection method for a detection library of trace m6A, wherein the construction method for the detection library of trace m6A comprises the following steps: extracting total RNA in a cell sample to obtain a total RNA product; co-immunoprecipitating the total RNA product with an m6A antibody to obtain an m6A modified RNA product; carrying out reverse transcription on the m6A modified RNA product by adopting reverse transcriptase, oligo dT30 and a TSO primer to obtain a first strand cDNA product; wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2 is shown in the specification; performing PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer to obtain full-length transcriptome cDNA; wherein the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3 is shown in the specification; and constructing a library of the full-length transcriptome cDNA to obtain a detection library of trace m 6A. The high-throughput detection method of the trace m6A comprises the following steps: and (3) carrying out high-throughput sequencing on the detection library of the trace m6A to obtain a detection result of the trace m 6A. The method breaks through the biggest defect of the existing sequencing technology, can be used for detecting the m6A methylated transcriptome of a small amount of samples (100ng or 10000 cells), reduces the total RNA demand from 100mg to 100ng, has low cost and high universal applicability.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.
FIG. 1 is a flow chart of a method for constructing a detection library of trace m6A according to an embodiment of the present invention;
FIG. 2 is a technical schematic diagram of a method for constructing a trace m6A detection library according to an embodiment of the present invention;
FIG. 3 is an in vitro synthesis of m6A modified transcripts and transcripts without m6A modification;
FIG. 4 is the result of the bioinformatic analysis in the high-throughput detection method of the trace amount m6A in example two;
FIG. 5 shows the results of biological replicate assays of the present invention.
Detailed Description
The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.
Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.
Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.
In order to solve the technical problems, the embodiment of the invention provides the following general ideas:
according to an exemplary embodiment of the present invention, a method for constructing a detection library of m6A is provided, as shown in fig. 1-2, the method includes:
s1, extracting total RNA in the cell sample to obtain a total RNA product;
s2, performing co-immunoprecipitation on the total RNA product by using an m6A antibody to obtain an m6A modified RNA product;
s3, carrying out reverse transcription on the m6A modified RNA product by using reverse transcriptase, oligo dT30 and a TSO primer to obtain a first strand cDNA product; wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2 is shown in the specification;
s4, carrying out PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer to obtain full-length transcriptome cDNA; wherein the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3 is shown in the specification;
s5, constructing a library of the full-length transcriptome cDNA to obtain a detection library of trace m 6A.
The co-immunoprecipitation is carried out after the total RNA product is obtained (instead of breaking and purifying the obtained total RNA product, and then the co-immunoprecipitation is carried out on the product obtained after fragmentation treatment);
then carrying out reverse transcription on the m6A modified RNA product by using reverse transcriptase, oligo dT30 and a TSO primer to obtain a first strand cDNA product; in the reverse transcription, reverse transcriptase adds a plurality of C bases at the 3' end of a cDNA chain formed by reverse transcription, the C bases are matched with a TSO primer containing locked nucleic acid Gr to achieve template conversion, and thus a first cDNA chain generated by reverse transcription is obtained;
performing PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer to obtain full-length transcriptome cDNA; then, library construction is carried out, and a detection library of trace m6A is obtained.
Because the invention combines m6A antibody recognition and PCR amplification, the invention has the advantages of low required initial sample amount, high library building speed and low cost.
As an alternative embodiment, in step S1, the extraction of small amount of total RNA from cell source may be performed by using Trizol method, or may be performed by using a commercial kit, and when the extraction is performed by using Trizol method, glycogen may be added during the extraction of RNA to reduce the loss of RNA;
as an optional implementation manner, in step S2, the method specifically includes:
adding the total RNA product into co-immunoprecipitation buffer containing anti-m 6A-antibody and protein A/G-magnetic beads, mixing uniformly, incubating (preferably incubating for 2h or incubating overnight), performing magnetic separation, removing supernatant, and washing with buffer containing RNase inhibitor to obtain m6A modified RNA product.
The formula of the used precipitation buffer solution is as follows: 10mM Tris-HCl pH 7.4, 100mM NaCl, 0.1% NP-40, 0.4U/. mu.LRNasin.
Preferably, short oligo blocking antibodies and magnetic beads can be used to reduce non-specific adsorption.
The washing comprises the following steps: washing with low-salt precipitation buffer solution for 2-3 times; washing with high salt buffer solution for 2-3 times; wherein the content of the first and second substances,
the low salt buffer comprises 10mM Tris-HCl pH 7.4, 50mM NaCl, 0.1% NP40, 0.4U/. mu.LRNasin
The high-salt buffer comprises the following components: 10mM Tris-HCl pH 7.4, 500mM NaCl, 0.1% NP40, 0.4U/. mu.LRNasin
As an optional implementation manner, in step S3, the method specifically includes:
adding the m6A modified RNA product into oligo dT30 and dNTP for first incubation and centrifugation, then adding reverse transcriptase, reverse transcriptase buffer solution, TSO primer and RNase inhibitor, mixing uniformly and carrying out second incubation to obtain a first strand cDNA product.
The conditions of the first incubation are: incubating at 72 + -2 deg.C for 3 + -1 min; the conditions of the second incubation are: incubating at 42 + -2 deg.C for 90 + -2 min, and incubating at 70 + -2 deg.C for 15 + -2 min.
Add 1. mu.L, 10. mu.M oligo dT30 and 1. mu.L, 100. mu.M dNTP per (0.001-0.004). mu.g of the M6A modified RNA product; adding 0.5 mu L of reverse transcriptase, 5 mu L of reverse transcriptase buffer solution, 1 mu L of 10 mu M TSO primer and 0.5 mu L of LRNA enzyme inhibitor in the second incubation;
as an optional implementation manner, in step S4, the method specifically includes: adding 0.5 mu L of the first strand cDNA product into 10 mu M ISPCR primer and 20 mu LKAPA HiFi HotStart ReadyMix (2 x), mixing uniformly, performing PCR amplification, and then purifying to obtain full-length transcriptome cDNA, wherein the conditions of the PCR amplification are as follows: 3min at 98 ℃; the following steps were performed for 18 cycles: 20s at 98 ℃, 15s at 67 ℃ and 3min at 72 ℃; 5min at 72 ℃; keeping at 4 ℃.
Wherein KAPA HiFi HotStart ReadyMix (2X) is purchased from Roche (KM 2602);
as an optional implementation manner, in step S5, the method specifically includes: and performing library construction by using Tn5 transposase, fragmenting cDNA, adding a sequencing universal adapter sequence to complete library construction, and sequencing.
The specific operation step of the step S5 can be according to a kit QubitTMThe specification for the dsDNA HS Assay Kit, wherein the sequencing universal linker sequence is:
P5 5’adapter：
ATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG；
P7 3’adapter：
P7-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG；
according to another exemplary embodiment of the present invention, there is provided a detection library of m6A in trace amount obtained by the method.
According to another exemplary embodiment of the embodiments of the present invention, there is provided a method for high-throughput detection of trace m6A, the method including: and (3) carrying out high-throughput sequencing on the detection library of the trace m6A to obtain a detection result of the trace m 6A. The method specifically comprises the following steps: after high-throughput sequencing, genome comparison is carried out by adopting a bioinformatics method, according to IP/input, Log2 fold change values of corresponding genes or transcripts are output after being processed by DESeq2, the values are subjected to Z-score conversion, and the converted values are used as indexes of m6a modification levels and are used for comparison among groups.
According to another exemplary embodiment of the present invention, there is provided a kit for constructing a detection library of trace m6A, the kit comprising: reverse transcriptase, oligo dT30, TSO primer and ISPCR primer, wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2, the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3, respectively.
The kit may also comprise other reagents used in the above steps S1-S5, in particular:
an RNA extraction reagent in step S1 may be included;
the method also comprises a precipitation buffer solution, a low-salt buffer solution and a high-salt buffer solution in the step S2;
optionally oligo dT30, dNTP, reverse transcriptase buffer, TSO primer and RNase inhibitor in step S3;
may further include KAPA HiFi HotStart ReadyMix (2 ×) in step S4;
it may further include the Qubit in step S5TMdsDNA HS Assay Kit and sequencing universal linker;
according to another exemplary embodiment of the embodiments of the present invention, there is provided a method for constructing the m6 trace 6A test library, a method for constructing the m6 trace 6A test library, a method for high throughput testing of m6 trace 6A, or a kit for constructing the m6 trace 6A test library, for use in the m6 trace 6A test.
The effects of the present application will be described in detail below with reference to examples and experimental data.
Example I, detection library of trace m6A and construction method thereof
1. Extraction of Total RNA
Extracting total RNA of the obtained small amount of cell samples by using a Trizol method, wherein the specific method comprises the following steps:
putting the cells into 1.5ml eppendorf tubes of RNase-free;
adding lml Trizol, and shaking to obtain homogeneous solution;
③ adding 200 mu L chloroform, violently shaking to obtain a uniform solution, and centrifuging for 15min at 4 ℃ at 12000 g;
fourthly, taking the supernatant to another 1.5ml eppendorf tube of RNase-free, adding 4 mu L glycogen, adding isopropanol with the same volume, mixing evenly, incubating for 10min at room temperature, centrifuging for 10min at 12000g at 4 ℃;
fifthly, removing supernatant, washing precipitate with lml 75% ethanol, centrifuging for 5min at the temperature of 4 ℃ at 7500 g;
sixthly, the mixture is prepared by using 20 mu LRNase-free H 20 is dissolved.
The RNA obtained by the final extraction was (100-200) ng.
2. Co-immunoprecipitation
Taken out about 50ng of total RNA as Input (control), and the rest is defined as IP (immunoprecipitation).
② the coupling and blocking of the antibody-beads complex,
Figure BDA0003072563630000072
protein A, Life technologies, 10002D) 10. mu.Lbeads were placed on a magnetic frame, the supernatant discarded, washed three times with lml IP buffer, resuspended in 200. mu.LIP buffer, 0.5. mu.Lm 6A antibody, 5. mu.L 100. mu.M short primer added and incubated at 4 ℃ for 2 h. The formulation of IP buffer is as follows:
IP buffer：10mM Tris-HCl pH 7.4，100mM NaCl，0.1％NP-40，0.4U/μLRNasin；
③ after 2h incubation, three washes with lml IP buffer and resuspend with 200. mu.LIP buffer.
And fourthly, immunoprecipitating the total RNA and the beads-antibody, and incubating for 2 hours at a low temperature of 4 ℃.
Fifthly, placing the sample obtained in the step (iv) on a magnetic frame, discarding the supernatant, washing twice with 200 muL 1 IP buffer, twice with 200 muL low salt buffer, twice with 200 muL high salt buffer, once with 200 muL 1 IP buffer, adding 9 muL LRNase-free water, 2min at 94 ℃, washing 8 muL of supernatant to a new PCR tube, placing on ice, and carrying out the next reaction.
High salt buffer 10mM Tris-HCl pH 7.4, 500mM NaCl, 0.1% NP40, 0.4U/. mu.LRNasin;
low-salt buffer: 10mM Tris-HCl pH 7.4, 50mM NaCl, 0.1% NP40, 0.4U/. mu.LRNasin;
3. first Strand cDNA Synthesis
Add 1. mu.L of 10. mu.M oligo dT30(VN), 1. mu.L of 100. mu.M dNTP to the supernatant obtained in the previous step and the input sample. oligo (dT) is typically used for construction libraries, all of which are T-terminated for binding to the poly A tail at the 3-terminus of the mRNA.
OligodT30:5’-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-VN-3’(SEQ ID NO：1)；
② incubating for 3min at 72 ℃ and rapidly placing on ice.
③ centrifuging for a short time, adding the reagent shown in Table 1, repeatedly beating and mixing evenly, and carrying out 90min at 42 ℃ and 15min at 70 ℃. The starting RNA was used in the system shown in Table 1 in the range of 100 ng.
TABLE 1
Figure BDA0003072563630000071
Figure BDA0003072563630000081
Wherein, TSO: 5 '-AAGCAGTGGTATCAACGCAGAGAATCATrGrG + G-3' (SEQ ID NO: 2);
wherein rG means RNA G and + G is for template replacement;
4. double chain synthesis
Adding 10 μ M ISPCR primer (nucleotide sequence of ISPCR primer is shown in SEQ ID NO: 3) 0.5 μ L, 20 μ LKAPA HiFi HotStart ReadyMix (2 ×), placing in PCR instrument at 98 deg.C for 3 min; 18cycles of 98 ℃ for 20s, 67 ℃ for 15s, 72 ℃ for 3 min; 72 ℃ for 5 min; and keeping at 4 ℃.
5. PCR products were purified with Agencourt AMPure XP Beads:
fully resuspending AMPure XP Beads, and placing the AMPure XP Beads for 30min in advance at room temperature to balance to the room temperature;
② adding equal volume of AMPure XP Beads, blowing and beating for 10 times by a gun, and fully and uniformly mixing;
incubation for 5min at room temperature;
fourthly, after the mixture is centrifuged for a short time, the mixture is placed in a magnetic frame for 5min until the solution is completely clear. Carefully remove the supernatant (note not to hit the beads), and leave the beads;
fifthly, placing the PCR tube on a magnetic frame, directly adding 200 mu L of 80% ethanol for washing beads, placing the PCR tube at room temperature for 30s, and carefully removing supernatant;
sixthly, repeating the step (v).
Seventhly, the PCR tube is centrifuged for a short time, placed on a magnetic frame, and the residual liquid is sucked by a 10 mu L gun. The PCR tube cap was opened and the ethanol was allowed to evaporate completely. Care was taken not to over-dry the beads;
eighthly, taking down the PCR tube, adding 20 mu L of nuclease-free water, repeatedly blowing and uniformly mixing, incubating at room temperature for 5min, and placing the PCR tube on a magnetic frame until the solution is completely clear;
ninthly, absorbing 19 mu L of the supernatant into a new PCR tube;
using Qubit on the RTMThe dsDNAHS Assay Kit quantitates cDNA, operates according to Kit instructions, and dilutes to 2.5 ng/. mu.L after quantitation is completed, and prepares for library construction.
6. The end-to-end of cDNA of a second generation sequencing Library is constructed by using TruePrep DNA Library Kit V2 for Illumina of Vazyme for capturing
Tn5 was used to fragment and add adapters to the cDNA in the following reaction system, with a cDNA input of 25 ng.
5×TTBL buffer：5μL
TTE Mix V50 mix：2.5μL
cDNA(25ng)：10μL
ddH2O：7.5μL
After all the components are added, mixing evenly and centrifuging for a short time
Secondly, setting the PCR temperature to be 55 ℃ and reacting for 10 min; after completion of the reaction, 4. mu.L of 0.1% SDS was immediately added thereto and the mixture was left at room temperature for 5 min. Mix well and briefly centrifuge the collected liquid on the tube wall plus 0.5. mu. LI5index primer/I7index primer, 20. mu. LKAPA HiFi HotStart ReadyMix (2X) each. Setting a PCR program as follows, and placing the system into a PCR instrument for reaction:
72℃for 3min；95℃for 3min；6cycles of 98℃for 10s，55℃for 30s，72℃for 60s；72℃for 5min 7；4℃hold。
PCR of the library followed by purification, according to step 5.
7. Quality control and quantification of libraries
The library constructed in step 6 was subjected to quality inspection using Agilent Bioanalyzer 2100, and the library fragments were concentrated between 300 and 500 bp.
② use of the QubitTMThe dsDNA HS Assay Kit quantifies the library constructed in step 6, the operation is carried out according to the Kit instruction, and the library is diluted to 10nM for sequencing after the quantification is finished.
Example two, high throughput detection method of trace m6A
1. Performing high-throughput sequencing on the detection library of the trace m6A described in the first embodiment;
2. bioinformatics analysis
Removing the linker sequence and low-quality reads in the original sequencing data by using fastp to generate clean sequencing data.
Alignment of clean sequencing data to the cDNA sequences of the sequenced species, each corresponding to a transcript of the gene, using the Kallisto software. The expression level of the gene is obtained by treating with the txiprort software package.
③ comparing the difference between the IP sample and the control sample by using the DESeq2 software package based on the expression level of the gene and the expression level of the transcript, and determining that the gene is m 6-high 6a modified gene if P _ value shows a significant statistical difference (P _ value <0.05) and fold change > 0.
And fourthly, after each group of samples are processed by the DESeq2, outputting a Log2 fold change value of a corresponding gene or transcript, carrying out Z-score conversion on the value, and taking the converted value as an index of m6a modification level and using the index for comparison among groups. The results of transcript alignment for input and IP groups (two replicate samples) are shown in FIG. 4.
EXAMPLE III sensitivity and stability determination
1. The sensitivity and stability of the high-throughput detection method for trace m6A provided by the embodiment of the invention are measured, and the specific measurement method comprises the following steps: RNA without m6A modification (luciferase) was synthesized by in vitro transcription from a luciferase-containing plasmid. RNA containing m6A modifications (GFP) was synthesized by transcription using GFP-containing plasmids in the presence of m 6A-ATP. luciferase and GFP were mixed in different percentages. The mixed RNA was co-immunoprecipitated using the m6A antibody according to the SLIM-seq method described previously. Captured RNA was treated with 10. mu. LDEPC-H2And O is eluted at 94 ℃ for 2min, and the eluted RNA and the supernatant RNA are respectively subjected to reverse transcription. The fractions GFP were then quantified by qRT-PCR to calculate the recovery of GFP after m6A-RIP, and the sensitivity and stability of the method were determined.
The results of the assay are shown in FIG. 3, and the in vitro synthesis of m6A modified transcripts and transcripts without m6A modification confirmed the high sensitivity and stability of the method.
2. Biological repeated detection is carried out on the high-throughput detection method of the trace m6A provided by the embodiment of the invention;
the biological repeated test result is shown in fig. 5, and after 2 times of tests, R is 0.93, which indicates that the method has high repeatability.
Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> Wuhan university
Construction method and kit for <120> trace m6A detection library and high-throughput detection method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 57
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aagcagtggt atcaacgcag agtacttttt tttttttttt tttttttttt tttttvn 57
<210> 2
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagcagtggt atcaacgcag agtacatrgr gg 32
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aagcagtggt atcaacgcag agt 23

Claims (10)

1. A method for constructing a detection library of trace m6A, wherein the method comprises the following steps:
extracting total RNA in a cell sample to obtain a total RNA product;
co-immunoprecipitating the total RNA product with an m6A antibody to obtain an m6A modified RNA product;
carrying out reverse transcription on the m6A modified RNA product by using reverse transcriptase, oligo dT30 and a TSO primer to obtain a first strand cDNA product; wherein the nucleotide sequence of oligo dT30 is shown in SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2 is shown in the specification;
performing PCR amplification and purification on the first strand product of the cDNA by using an ISPCR primer to obtain full-length transcriptome cDNA; wherein the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3 is shown in the specification;
and constructing a library of the full-length transcriptome cDNA to obtain a detection library of trace m 6A.
2. The method for constructing a detection library of trace m6A, wherein the co-immunoprecipitating the total RNA product with m6A antibody to obtain m6A modified RNA product comprises:
and adding the total RNA product into a precipitation buffer solution containing an anti-m 6A-antibody and protein A/G-magnetic beads, uniformly mixing, incubating, performing magnetic separation, removing supernatant, and washing with a buffer solution containing an RNase inhibitor to obtain an m6A modified RNA product.
3. The method for constructing a detection library of trace m6A, wherein the step of reverse transcribing the m6A modified RNA product with reverse transcriptase, oligo dT30 and TSO primer to obtain a first strand cDNA product comprises:
adding the m6A modified RNA product into oligo dT30 and dNTP for first-step incubation and centrifugation, then adding reverse transcriptase, reverse transcriptase buffer solution, TSO primer and RNase inhibitor, mixing uniformly and carrying out second-step incubation to obtain a first strand cDNA product.
4. The method for constructing a detection library of trace m6A, wherein the first incubation condition is: incubating at 72 + -2 deg.C for 3 + -1 min; the conditions of the second incubation are: incubating at 42 + -2 deg.C for 90 + -2 min, and incubating at 70 + -2 deg.C for 15 + -2 min.
5. The method for constructing a detection library of trace M6A according to claim 3, wherein 1 μ L of 10 μ M oligo dT30 and 1 μ L of 10 μ M dNTP are added to each (0.001-0.004) μ g of the M6A modified RNA product; to this second incubation was added 0.5. mu.L reverse transcriptase, 5. mu.L reverse transcriptase buffer, 1. mu.L, 10. mu.M TSO primer and 0.5. mu.L LRNA enzyme inhibitor.
6. The method for constructing a detection library of m6A in trace amount according to claim 1, wherein the step of performing PCR amplification and purification on the first strand cDNA product using ISPCR primers to obtain full-length transcriptome cDNA comprises:
adding 0.5 mu L of the first strand cDNA product into 10 mu M ISPCR primer and 20 mu LKAPA HiFi HotStart ReadyMix (2 x), mixing uniformly, performing PCR amplification, and then purifying to obtain full-length transcriptome cDNA, wherein the conditions of the PCR amplification are as follows: 3min at 98 ℃; the following steps were performed for 18 cycles: 20s at 98 ℃, 15s at 67 ℃ and 3min at 72 ℃; 5min at 72 ℃; then, the mixture was kept at 4 ℃.
7. A library of assays for traces of m6A obtained by the method of any one of claims 1 to 6.
8. A high throughput method for detecting m6A, wherein the method comprises: performing high-throughput sequencing on the detection library of the m6 trace 6A as claimed in claim 7 to obtain a detection result of m6 trace 6A.
9. The kit for constructing the detection library of the trace m6A is characterized by comprising reverse transcriptase, oligo dT30, TSO primer and ISPCR primer, wherein the nucleotide sequence of oligo dT30 is shown as SEQ ID NO: 1, and the nucleotide sequence of the TSO primer is shown as SEQ ID NO: 2, the nucleotide sequence of the ISPCR primer is shown as SEQ ID NO: 3, respectively.
10. Use of the method for constructing the assay library for m6 Trace 6A according to claim 1, the assay library for m6 Trace 6A according to claim 7, the high throughput assay method for m6 Trace 6A according to claim 8, or the kit for constructing the assay library for m6 Trace 6A according to claim 9 in the m6 Trace 6A assay.
CN202110543274.5A 2021-05-19 2021-05-19 Construction method and kit for detection library of trace m6A and high-throughput detection method Withdrawn CN113308514A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110543274.5A CN113308514A (en) 2021-05-19 2021-05-19 Construction method and kit for detection library of trace m6A and high-throughput detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110543274.5A CN113308514A (en) 2021-05-19 2021-05-19 Construction method and kit for detection library of trace m6A and high-throughput detection method

Publications (1)

Publication Number Publication Date
CN113308514A true CN113308514A (en) 2021-08-27

Family

ID=77373530

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110543274.5A Withdrawn CN113308514A (en) 2021-05-19 2021-05-19 Construction method and kit for detection library of trace m6A and high-throughput detection method

Country Status (1)

Country Link
CN (1) CN113308514A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113774121A (en) * 2021-09-13 2021-12-10 武汉大学 Low sample size m based on RNA connection label6A high throughput sequencing method
CN114250267A (en) * 2021-12-13 2022-03-29 南京诺唯赞生物科技股份有限公司 Method for constructing sequencing library of RNA (ribonucleic acid) containing modification sites
WO2023202030A1 (en) * 2022-04-20 2023-10-26 深圳大学 Method for constructing high-throughput sequencing library of small rna

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106047997A (en) * 2016-05-27 2016-10-26 浙江大学 MRNA methylation high-throughput test method
CN110499356A (en) * 2019-09-05 2019-11-26 中国科学院遗传与发育生物学研究所 A kind of construction method of the sequencing library of RNA with poly(A) tail in sample to be tested
CN110904192A (en) * 2018-12-28 2020-03-24 广州表观生物科技有限公司 Ultra-micro RNA methylation m6A detection method and application thereof
CN111088322A (en) * 2018-10-23 2020-05-01 深圳华大基因科技服务有限公司 Method and kit for determining RNA containing poly (A)
CN111560423A (en) * 2020-06-05 2020-08-21 中山大学孙逸仙纪念医院 Method for detecting RNA m6A with high-throughput and high-sensitivity single-base resolution and application thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106047997A (en) * 2016-05-27 2016-10-26 浙江大学 MRNA methylation high-throughput test method
CN111088322A (en) * 2018-10-23 2020-05-01 深圳华大基因科技服务有限公司 Method and kit for determining RNA containing poly (A)
CN110904192A (en) * 2018-12-28 2020-03-24 广州表观生物科技有限公司 Ultra-micro RNA methylation m6A detection method and application thereof
CN110499356A (en) * 2019-09-05 2019-11-26 中国科学院遗传与发育生物学研究所 A kind of construction method of the sequencing library of RNA with poly(A) tail in sample to be tested
CN111560423A (en) * 2020-06-05 2020-08-21 中山大学孙逸仙纪念医院 Method for detecting RNA m6A with high-throughput and high-sensitivity single-base resolution and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SIMONE PICELLI: "Full-length RNA-seq from single cells using Smart-seq2", 《NATURE PROTOCOL》 *
YI-LAN WENG: "Epitranscriptomic m6A Regulation of Axon Regeneration in the Adult Mammalian Nervous System", 《NEURON》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113774121A (en) * 2021-09-13 2021-12-10 武汉大学 Low sample size m based on RNA connection label6A high throughput sequencing method
CN113774121B (en) * 2021-09-13 2024-02-20 武汉大学 Low sample size m based on RNA (ribonucleic acid) connection tag 6 A high throughput sequencing method
CN114250267A (en) * 2021-12-13 2022-03-29 南京诺唯赞生物科技股份有限公司 Method for constructing sequencing library of RNA (ribonucleic acid) containing modification sites
WO2023202030A1 (en) * 2022-04-20 2023-10-26 深圳大学 Method for constructing high-throughput sequencing library of small rna

Similar Documents

Publication Publication Date Title
US10400279B2 (en) Method for constructing a sequencing library based on a single-stranded DNA molecule and application thereof
CN113308514A (en) Construction method and kit for detection library of trace m6A and high-throughput detection method
CN111808854B (en) Balanced joint with molecular bar code and method for quickly constructing transcriptome library
CN110129415B (en) NGS library-building molecular joint and preparation method and application thereof
WO2015021990A1 (en) Rna probing method and reagents
Tan et al. Capture and identification of miRNA targets by biotin pulldown and RNA-seq
CN107893260B (en) Method and kit for constructing transcriptome sequencing library by efficiently removing ribosomal RNA
CN113061648B (en) Method for constructing micro sample m6A modification detection library by aid of Tn5 transposase and application of method
CN110157785B (en) Single cell RNA sequencing library construction method
CN112680797B (en) Sequencing library for removing high-abundance RNA and construction method thereof
US20220033809A1 (en) Method and kit for construction of rna library
CN111549025B (en) Strand displacement primer and cell transcriptome library construction method
CN109750086B (en) Method for constructing single-chain circular library
CN114774527A (en) High-throughput single-cell transcriptome sequencing method and application thereof
CN114507711A (en) Single cell transcriptome sequencing method and application thereof
EP2940136A1 (en) Method for isolating poly(A) nucleic acids
CN110951827B (en) Rapid construction method and application of transcriptome sequencing library
CN113215234A (en) Method LACE-seq for identifying RNA binding protein target site, kit and application
CN109234813B (en) Method for constructing chain specific RNA library and application
CN110241211B (en) Molecular combination marker for diagnosing colorectal cancer and detection kit
CN111560423A (en) Method for detecting RNA m6A with high-throughput and high-sensitivity single-base resolution and application thereof
WO2023202030A1 (en) Method for constructing high-throughput sequencing library of small rna
CN111518870A (en) Reverse transcription primer pool and kit for removing ribosomal RNA and method for removing ribosomal RNA
CN108342385A (en) A kind of connector and the method that sequencing library is built by way of high efficiency cyclisation
CN111118126A (en) mRNA detection method based on high-throughput sequencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WW01 Invention patent application withdrawn after publication

Application publication date: 20210827

WW01 Invention patent application withdrawn after publication