CN115772521A

CN115772521A - Gene line, RNA delivery system and application thereof

Info

Publication number: CN115772521A
Application number: CN202210974237.4A
Authority: CN
Inventors: 张辰宇; 陈熹; 詹守斌; 周圣凯; 徐蕊; 许烨
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2021-08-13
Filing date: 2022-08-15
Publication date: 2023-03-10

Abstract

The application provides a gene circuit, an RNA delivery system and application thereof. The gene circuit comprises at least one RNA segment capable of interfering gene expression and/or at least one targeting gene which codes protein or peptide segment with targeting function, the targeting gene is inserted into a gene sequence coding CD63 protein, the gene circuit is a sequence capable of being enriched in host organ tissues and self-assembled to form a composite structure, and the gene circuit realizes the treatment of diseases by inhibiting the expression of the gene through the RNA segment. The delivery system includes the gene line as described above and a delivery vector capable of delivering the gene line to an organ tissue of a host. The gene circuit provided by the application has both a targeting function and a treatment function, can quickly and accurately reach a target organ and a target tissue to play a treatment role, and is high in efficiency and good in effect; the RNA delivery system provided by the application has the advantages of fully verified safety and reliability, good drug property, strong universality, and excellent economic benefit and application prospect.

Description

Gene line, RNA delivery system and application thereof

Technical Field

The application relates to the technical field of biomedicine, in particular to a gene line, an RNA delivery system and application thereof.

Background

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but in clinical practice a number of problems have been encountered, the progress of which has fallen far behind expectations.

It is generally considered that RNA cannot be stably present outside cells for a long period of time because RNA is degraded into fragments by RNase which is abundant outside cells, and therefore, a method for stably presenting RNA outside cells and targeting RNA into a specific tissue must be found to highlight the effect of RNAi therapy.

Many patents related to siRNA are focused on the following aspects: 1. siRNA with medical effect is designed. 2. The siRNA is chemically modified, so that the stability of the siRNA in an organism is improved, and the yield is improved. 3. Various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) are designed to improve the efficiency of siRNA delivery in vivo. Many of these patents in aspect 3 are based on the fact that researchers have recognized the lack of suitable siRNA delivery systems to deliver siRNA to target tissues safely, accurately and efficiently, which has become a central problem in RNAi therapy.

Chinese patent publication No. CN108624590a discloses a siRNA capable of inhibiting DDR2 gene expression; chinese patent with publication number CN108624591A discloses siRNA capable of silencing ARPC4 gene, and the siRNA is modified by alpha-phosphorus-selenium; chinese patent with publication number CN108546702A discloses siRNA of targeted long-chain non-coding RNA DD X11-AS 1. Chinese patent publication No. CN106177990a discloses a siRNA precursor that can be used for various tumor treatments. These patents all designed specific sirnas and aimed at certain diseases caused by genetic changes.

Chinese patent publication No. CN108250267a discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as carrier of siRNA. Chinese patent No. CN108117585a discloses a polypeptide for targeted introduction of siRNA to promote apoptosis of breast cancer cells, and the polypeptide is also used as a carrier of siRNA. Chinese patent publication No. CN108096583A discloses a nanoparticle carrier, which can contain chemotherapeutic drugs and also can be loaded with siRNA with breast cancer therapeutic effect. These patents are all inventions in the aspect of siRNA vector, but the technical scheme has a common feature that the vector and siRNA are pre-assembled in vitro and then introduced into the host. In fact, most of the delivery technologies designed today are so. However, such delivery systems have a common problem in that these artificially synthesized exogenous delivery systems are easily cleared by the host's circulatory system, may elicit an immunogenic response, and may even be toxic to specific cell types and tissues.

The research team of the present invention finds that endogenous cells can selectively encapsulate miRNAs into exosomes (exosomes) which can deliver miRNAs into recipient cells, and the secreted miRNAs can powerfully block the expression of target genes at relatively low concentrations. Exosomes are biocompatible with the host immune system and have the innate ability to protect and transport miRNA across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery. For example, chinese patent publication No. CN110699382a discloses a method for preparing exosomes for delivering siRNA, and discloses a technique for isolating exosomes from plasma and encapsulating siRNA into exosomes by electroporation.

However, such technologies for in vitro separation or preparation of exosomes usually require a large amount of exosomes obtained by cell culture and a step of siRNA encapsulation, which makes the clinical cost of large-scale application of the product very high and cannot be borne by general patients; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

The drug taking exosome as an active ingredient has not been approved by CFDA so far, and the core problem is that the consistency of exosome products cannot be ensured, and the problem directly results in that the products cannot obtain the drug production license. If the problem can be solved, the method is of no great significance for promoting RNAi therapy.

Therefore, the development of a safe, accurate and efficient gene line and RNA delivery system is a loop essential for improving the effect of RNAi therapy and promoting RNAi therapy.

In addition, in the prior research process, lamp2b is mainly used as the transmembrane protein in the system, however, lamp2b usually has certain requirements on the size of the structure connected with lamp2b due to the structural limitation, so that the search for another transmembrane protein is very necessary. Moreover, the use of lamp2b alone may sometimes have problems of poor source, high cost, etc., and in order to find a better transmembrane protein for the present technology, the present inventors have tried various transmembrane proteins and products with similar functions, and finally found that CD63 has similar effects to lamp2b in various aspects or dimensions, even better than lamp2b. The CD63 can improve the expression effect of RNA through two transmembrane domains, so that the expression effect is a very surprising achievement for the team, the discovery has extremely important significance for further research in the later period, and the diversity selection of transmembrane proteins can be increased, thereby being beneficial to subsequent research and development and commercialization.

Disclosure of Invention

In view of the above, the embodiments of the present application provide a gene circuit, an RNA delivery system and applications thereof, so as to solve the technical defects in the prior art.

The first invention of the application provides a gene circuit, the gene circuit comprises at least one RNA segment capable of interfering gene expression and/or at least one targeting gene coding protein or peptide segment with targeting function, the targeting gene is inserted into a gene sequence coding CD63 protein, the gene circuit is a sequence capable of being enriched in host organ tissues and self-assembling to form a composite structure, and the gene circuit realizes the treatment of diseases by inhibiting the expression of genes through the RNA segment.

Further, the protein or peptide segment with targeting function comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide and MSP targeting peptide.

Further, the target gene is inserted between any two adjacent bases in 20 th to 60 th nitrogen ends of a gene sequence for coding the CD63 protein, such as 25-26, 30-31, 35-36, 40-41, 45-46, 50-51, 55-56, 59-60 and the like.

Further, the targeting gene is inserted between adjacent GG (guanine) in 20 th to 60 th nitrogen terminal of the gene sequence encoding the CD63 protein.

Further, the targeting gene divides the gene sequence for coding the CD63 protein into two parts to form a nitrogen terminal sequence for coding the CD63 protein and a carbon terminal sequence for coding the CD63 protein, and the targeting gene is positioned between the nitrogen terminal sequence and the carbon terminal sequence;

furthermore, the nitrogen terminal sequence is a sequence containing seq1 or more than 70% of homology with the seq1 sequence;

seq1 sequence is: ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTAC GTTCTCCTGCTGGCCTTCTGCGCCTGTGCAGTGGGATTGATCGCCATTGGTGTAGCGGTTCAG.

The carbon terminal sequence is a sequence containing seq2 or more than 70% of homology with the seq2 sequence;

the Seq2 sequence is: GTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCT CGCTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTGGACAAATTGCAGAAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGACAGAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGGGCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTGGCTATGAAGTAATGTAG.

The above-mentioned homologous sequences include those obtained by adding one or more bases to the original sequence, subtracting one or more bases, and replacing any one or more bases.

Further, the nitrogen terminal sequence forming and encoding the CD63 protein is connected with the target gene through a linker 1;

further, the linker1 is AGATCTCTAGCCACC or a sequence obtained by adding, reducing or replacing any 1-4 bases in the sequence, such as adding, reducing or replacing 1, 2, 3 or 4 bases.

Further, the targeting gene is connected with the carbon terminal sequence of the coding CD63 protein through a linker 2;

further, the linker2 is ACCGGTGGAGCTCGAATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence, such as adding, reducing or replacing 1, 2, 3, 4, 5 or 6 bases.

Further, the RNA segment comprises one, two or more RNA sequences of medical significance and capable of being expressed, the RNA sequences being siRNA sequences, shRNA sequences or miRNA sequences.

Further, the gene circuit also comprises a promoter; the types of the gene line include: promoter-RNA fragments, promoter-targeted genes, promoter-targeted gene-RNA fragments;

the gene circuit comprises at least one RNA segment capable of interfering gene expression and at least one targeting gene with targeting function, wherein the RNA segment and the targeting label are positioned in the same gene circuit or different gene circuits.

Further, the gene circuit also comprises a flanking sequence, a loop sequence and a compensation sequence which can enable the gene circuit to be folded into a correct structure and expressed, wherein the flanking sequence comprises a 5 'flanking sequence and a 3' flanking sequence, and the compensation sequence cannot be expressed in a target receptor.

Further, the kinds of the gene line include: 5 '-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3 'flanking sequence, 5' -promoter-nitrogen end sequence coding CD63 protein-linker 1-target gene-linker 2-carbon end sequence coding CD63 protein-5 'flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

Further, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having greater than 80% homology thereto;

the loop sequence is gttttggccactgactgac or a sequence with homology of more than 80 percent;

the 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with homology of more than 80 percent;

the compensation sequence is a reverse complementary sequence of the RNA fragment with any 1-5 base deleted.

More preferably, the complementing sequence is the reverse complement of the RNA fragment, and any 1-3 consecutive bases in the complementing sequence are deleted.

Most preferably, the complementing sequence is the reverse complement of the RNA fragment, and the 9 th and/or 10 th base is deleted.

Further, the RNA sequence is 15-25 nucleotides in length.

Optionally, the RNA sequence is 15-25 nucleotides in length. For example, the RNA sequence may be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides in length. Preferably, the RNA sequence is 18-22 nucleotides in length.

Optionally, the RNA sequence is selected from any one or several of: siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-alpha gene, siRNA of integrin-alpha gene, siRNA of B7 gene, siRNA of TGF-beta 1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, antisense strand of miRNA-21, antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrk 2 gene, siRNA of alpha-synuclein gene, or RNA sequence having more than 80% homology with the above sequences, or nucleic acid molecule encoding the above RNA sequences. It should be noted that the RNA sequence in the "nucleic acid molecule encoding the RNA sequence" also includes RNA sequences having a homology of more than 80% for each RNA.

Further, the RNA fragment comprises an RNA sequence body and a modified RNA sequence obtained by ribose modification of the RNA sequence body. That is, the RNA fragment may consist of only at least one RNA sequence entity, may consist of only at least one modified RNA sequence, or may consist of both the RNA sequence entity and the modified RNA sequence. Preferably, the ribose modification is a 2' fluoropyrimidine modification.

Further, the organ tissue is a liver, and the composite structure is an exosome.

Furthermore, an intermediate sequence fragment is arranged between the promoter and the nitrogen terminal sequence for coding the CD63 protein, the length of the intermediate sequence fragment is 60-150bp, preferably 80-120bp, more preferably 90-110bp (such as 95, 100, 105 and the like), and the sequence only has certain requirements on the length and has no requirements on specific base arrangement.

It is another aspect of the present invention to provide an RNA delivery system comprising the gene line of any one of the above paragraphs and a delivery vector capable of delivering the gene line to an organ tissue of a host.

Further, the delivery vector containing the gene circuit can be enriched in the organ tissues of the host and self-assembled in the organ tissues of the host to form a composite structure, the targeting label is positioned on the surface of the composite structure, and the composite structure searches for and binds to the target tissues through the targeting label to deliver the RNA fragments into the target tissues.

Further, the delivery vector carries one, two or more gene lines, and all the gene lines carried by the delivery vector at least comprise one RNA fragment and one target gene.

Further, in the case where the delivery vector carries two or more of the gene lines, adjacent ones of the gene lines are connected by a sequence consisting of sequences 1 to 3 (sequence 1 to sequence 2 to sequence 3);

wherein, the sequence 1 is CAGATC, the sequence 2 is a sequence consisting of 5-80 bases, and the sequence 3 is TGGATC. Preferably, the sequence 2 is a sequence consisting of 10 to 50 bases, and more preferably, the sequence 2 is a sequence consisting of 20 to 40 bases.

Further, in the case where the delivery vector carries two or more of the gene lines, adjacent ones of the gene lines are connected to each other through sequence 4 or a sequence having a homology of more than 80% to sequence 4;

wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Further, the delivery vector is a viral vector or a non-viral vector; wherein, the virus vector comprises an adeno-associated virus vector, an adenovirus vector and a retrovirus vector, and the non-virus vector comprises a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector and a multifunctional envelope type nano vector.

Preferably, the delivery vector is an adeno-associated viral vector or a plasmid vector. Wherein the adeno-associated viral vector is preferably adeno-associated viral vector type 5 (AAV 5), adeno-associated viral vector type 8 (AAV 8) or adeno-associated viral vector type 9 (AAV 9).

Further, the delivery system is a delivery system for use in mammals including humans.

The last invention of this application is to provide a use of the RNA delivery system according to any of the above paragraphs in medicine.

Optionally, the administration mode of the drug comprises oral administration, inhalation, subcutaneous injection, intramuscular injection and intravenous injection. That is, the drug can be delivered to the target tissue by the RNA delivery system as described in any of the above paragraphs after entering the body by oral administration, inhalation, subcutaneous injection, intramuscular injection or intravenous injection, and then exert a therapeutic effect.

Further, the drug is a drug for treating cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type II diabetes, huntington's disease, parkinson's disease, myasthenia gravis, alzheimer's disease, or graft-versus-host disease.

The dosage form of the medicine can be tablets, capsules, powder, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes and the like.

Further, the siRNA of each gene is an RNA sequence having a function of suppressing the expression of the gene, and the number of RNA sequences having a function of suppressing the expression of each gene is large, and cannot be listed here, and only sequences having excellent effects are exemplified below.

The siRNA of the EGFR gene comprises UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences which can inhibit the expression of the EGFR gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the KRAS gene comprises UGAUUUAGUAUUAUUUAUGGC, AAUUUGUUCUCUAUAAUGGUG, UAAUUUGUUCUCUAUAAUGGU, UUAUGUUUUCGAAUUUCUCGA, UGUAUUUACAUAAUUACACAC, other sequences which can inhibit the expression of the KRAS gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of VEGFR gene includes AUUUGAAGAGUUGUAUUAGCC, UAAUAGACUGGUAACUUUCAU, ACAACUAUGUACAUAAUAGAC, UUUAAGACAAGCUUUUCUCCA, AACAAAAGGUUUUUCAUGGAC, other sequence capable of inhibiting VEGFR gene expression and sequence with homology greater than 80%.

The siRNA of mTOR gene includes AGAUAGUUGGCAAAUCUGCCA, ACUAUUUCAUCCAUAUAAGGU, AAAAUGUUGUCAAAGAAGGGU, AAAAAUGUUGUCAAAGAAGGG, UGAUUUCUUCCAUUUCUUCUC, other sequences for inhibiting mTOR gene expression, and sequences with homology of more than 80%.

The siRNA of TNF-alpha gene comprises AAAACAUAAUCAAAAGAAGGC, UAAAAAACAUAAUCAAAAGAA, AAUAAUAAAUAAUCACAAGUG, UUUUCACGGAAAACAUGUCUG, AAACAUAAUCAAAAGAAGGCA, other sequences which can inhibit the expression of TNF-alpha gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the integrin-alpha gene comprises AUAAUCAUCUCCAUUAAUGUC, AAACAAUUCCUUUUUUAUCUU, AUUAAAACAGGAAACUUUGAG, AUAAUGAAGGAUAUACAACAG, UUCUUUAUUCAUAAAAGUCUC, other sequences which can inhibit the expression of the integrin-alpha gene and sequences with homology of more than 80 percent with the sequences.

siRNA of B7 gene, UUUUUCUUGGGGUAAUCUUCUGAG, AGAAAUUCCAUUUCUUCUU, AUUUCAAGUCAGAUACUA, ACAAUUCCAUUAUGAG, AUUAUUGAGUAAGUAUUCCU, other sequences capable of inhibiting B7 gene expression and sequences with homology more than 80% with the sequences.

The siRNA of the TGF-beta 1 gene comprises ACGGAAAUAACCUAGAUGGGC, UGAACUUGUCAUAGAUUUCGU, UUGAAGAACAUAUAUAUGCUG, UCUAACUACAGUAGUGUUCCC, UCUCAGACUCUGGGGCCUCAG, other sequences which can inhibit the expression of the TGF-beta 1 gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the H2-K gene comprises AAAAACAAAUCAAUCAAACAA, UCAAAAAAACAAAUCAAUCAA, UAUGAGAAGACAUUGUCUGUC, AACAAUCAAGGUUACAUUCAA, ACAAAACCUCUAAGCAUUCUC, other sequences which can inhibit the expression of the H2-K gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the H2-D gene comprises AAUCUCGGAGAGACAUUUCAG, AAUGUUGUGUAAAGAGAACUG, AACAUCAGACAAUGUUGUGUA, UGUUAACAAUCAAGGUCACUU, AACAAAAAAACCUCUAAGCAU, other sequences which can inhibit the expression of the H2-D gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the H2-L gene comprises GAUCCGCUCCCAAUACUCCGG, AUCUGCGUGAUCCGCUCCCAA, UCGGAGAGACAUUUCAGAGCU, UCUCGGAGAGACAUUUCAGAG, AAUCUCGGAGAGACAUUUCAG, other sequences which can inhibit the expression of the H2-L gene and sequences with homology of more than 80 percent with the sequences.

HLA gene siRNA, AUCUGGAUGGUGUGUGAGAACCG, UGUCACUGCUGCCUGAG, UCACAAAGGGGAGGCAGAA, UUGCAAGAAACAGUGCAGGGU, ACACACGAACACACACAGACACAGCAUGCA, other sequences capable of inhibiting HLA gene expression and sequences with homology of more than 80 percent with the sequences.

The siRNA of GDF15 gene includes UAUAAAUACAGCUGUUUGGGC, AGACUUAUAUAAAUACAGCUG, AAUUAAUAAUAAAUAACAGAC, AUCUGAGAGCCAUUCACCGUC, UGCAACUCCAGCUGGGGCCGU, other sequence capable of inhibiting GDF15 gene expression and sequence with homology greater than 80%.

The siRNA of the TNC gene comprises UAUGAAAUGUAAAAAAAGGGA, AAUCAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, AGAAGUAAAAAACUAUUGCGA, other sequences which can inhibit the expression of the TNC gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of PTP1B gene comprises UGAUAUAGUCAUUAUCUUCUU, UCCAUUUUUAUCAAACUAGCG, AUUGUUUAAAUAAAUAUGGAG, AAUUUUAAUACAUUAUUGGUU, UUUAUUAUUGUACUUUUUGAU, other sequences which can inhibit the expression of PTP1B gene, and sequences with homology of more than 80% with the sequences.

The siRNA of the mHTT gene comprises UAUGUUUUCACAUAUUGUCAG, AUUUAGUAGCCAACUAUAGAA, AUGUUUUUCAAUAAAUGUGCC, UAUGAAUAGCAUUCUUAUCUG, UAUUUGUUCCUCUUAAUACAA, other sequences which can inhibit the expression of the mHTT gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the Lrrk2 gene comprises AUUAACAUGAAAAUAUCACUU, UUAACAAUAUCAUAUAAUCUU, AUCUUUAAAAUUUGUUAACGC, UUGAUUUAAGAAAAUAGUCUC, UUUGAUAACAGUAUUUUUCUG, other sequences which can inhibit the expression of the Lrrk2 gene and sequences with homology of more than 80 percent with the sequences.

The siRNA of the alpha-synuclein gene comprises AUAUAUUAACAAAUUUCACAA, AAGUAUUAUAUAUAUUAACAA, AUAACUUUAUAUUUUUGUCCU, UAACUAAAAAAUUAUUUCGAG, UCGAAUAUUAUUUAUUGUCAG, other sequences which can inhibit the expression of the alpha-synuclein gene and sequences with homology of more than 80 percent with the sequences.

The "sequence having a homology of more than 80" may be 85%, 88%, 90%, 95%, 98%, or the like.

The technical effects of this application do:

the gene circuit provided by the application can only comprise the RNA fragment, can only comprise the targeting label, and can also be a combination of the RNA fragment and the targeting label. In the case that the gene line only comprises RNA fragments, the gene line can play a role of inhibiting gene expression when entering into the body, thereby inhibiting the formation and development of diseases; in the case where the gene line includes only the targeting tag, it has an excellent targeting function, and can be used in combination with a gene line including only an RNA fragment, causing the RNA fragment to rapidly reach a target organ and a target tissue to act; under the condition that the gene circuit is the combination of the RNA segment and the targeting label, the gene circuit has both the targeting function and the treatment function, can quickly and accurately reach a target organ and a target tissue to play a treatment role, has high efficiency and good effect, and is suitable for large-scale popularization and application. Particularly, the CD63 transmembrane protein is innovatively added into the targeting tag, and can be perfectly matched with targeting peptides/targeting proteins targeting various tissues to form fusion protein, so that the targeting accuracy is improved, the action rate and efficiency of a gene line are improved, and the action stability is ensured.

The gene circuit can be enriched in organ tissues of hosts such as liver and the like, and the gene circuit can be assembled to form a compound structure such as exosome and the like, and then the compound structure such as exosome and the like is assembled to realize disease treatment under the guidance of the gene circuit, so that the effect is good, and toxic and side effects in the prior art are avoided.

The RNA delivery system provided by the application attaches the gene line to the delivery carrier, is sent into the body and can be excellently enriched in host organ tissues to form a composite structure in a self-assembly manner, and the RNA segment which finally exerts the effect is wrapped and conveyed by the composite structure, so that no immune reaction exists, and the RNA delivery system is healthy and safe. The delivery system can deliver various small-molecule RNAs and has strong universality. And the preparation of the delivery carrier attached with the gene line has lower preparation cost than that of exosome or substances such as protein, polypeptide and the like, the process is simpler, the uniform quality standard is easy to determine, the use stability is improved, and the economic benefit is high.

In addition, the RNA delivery systems provided herein are capable of self-assembly with an AGO in vivo ₂ Tightly combined and enriched into a composite structure (exosome), not only can prevent the exosome from being degraded prematurely and maintain the stability of the exosome in circulation, but also is beneficial to the absorption of receptor cells, the intracytoplasmic release and the escape of lysosomes, and the required dosage is low.

The RNA delivery system provided by the application is applied to medicines, namely a medicine delivery platform is provided, the platform can form the research and development basis of more RNA medicines, and the RNA delivery system has a great pushing effect on the research and development and use of the RNA medicines.

Drawings

FIG. 1 is a schematic diagram showing the results of measuring the expression level of a gene circuit of a CD63 protein containing a PTP targeting gene inserted therein according to an embodiment of the present application; wherein, FIG. 1A is a graph showing the results of detecting the expression level of siRNA in a PDAC (pancreatic ductal adenocarcinoma) sample and a normal sample; FIG. 1B is a diagram showing the results of KRASmRNA expression level detection.

FIG. 2 is a diagram showing the result of measuring the siRNA expression level of the gene circuit of CD63 protein containing RVG targeting gene inserted in one embodiment of the present application.

FIG. 3 is a diagram showing the effect of the insertion position of a base sequence module on siRNA expression in one embodiment of the present application.

FIG. 4 is a diagram showing the effect of Linker sequence changes on siRNA expression in one embodiment of the present application.

FIG. 5 is a diagram showing the construction and characterization of a gene circuit according to an embodiment of the present application; wherein, fig. 5a is a schematic diagram of assembling basic elements of a gene loop, fig. 5b is a diagram of identifying the stem-loop structure effect of a promoter and a siRNA expression element, fig. 5c is a diagram of identifying the siRNA expression effect of the gene loop in vitro, fig. 5d is a diagram of identifying the siRNA in vitro inhibitory gene expression effect expressed by the gene loop, fig. 5e is a diagram of identifying the WB of the expression effect of the gene loop in vitro inhibitory gene expression, fig. 5f is a diagram of verifying the pulldown of a targeting peptide assembled on the surface of an in vitro expression exosome, fig. 5g is a statistical diagram of the siRNA expression effect of the gene loop in vivo, fig. 5h is a diagram of verifying the pulldown of the targeting peptide assembled on the surface of the in vitro expression exosome, fig. 5i is a diagram of identifying the expression effect of the gene loop in tandem si in vitro inhibitory gene expression, and fig. 5j is a diagram of the effect of gradient inhibition of the target gene loop assembly exosome on a target gene.

FIG. 6 is a graph showing the effect on siRNA, protein or mRNA expression with or without a loop sequence in the presence of an inserted RVG targeting gene in one embodiment of the present application; wherein, fig. 6A is the detection result of EGFR siRNA expression content, fig. 6B is the detection result of EGFR protein expression content, and fig. 6C is the detection result of EGFR mRNA expression content.

FIG. 7 is a graph showing the effect of RNA sequence length on protein or mRNA expression in one embodiment of the present application; wherein, FIG. 7A shows the results of detecting the expression levels of EGFR proteins and 7B shows the results of detecting the expression levels of EGFR mRNAs at sequence lengths of 18, 20 and 22, respectively.

FIG. 8 is a graph showing the effect of sequence 4 or a sequence 4 homologue on siRNA expression for ligation between adjacent gene lines in an embodiment of the present application; wherein, fig. 8A is the detection result of the expression content of EGFR siRNA when the linker sequence is sequence 4, fig. 8B is the detection result of the expression content of EGFR siRNA when the linker sequence is homologous sequence 4-1, and fig. 8C is the detection result of the expression content of EGFR siRNA when the linker sequence is homologous sequence 4-2.

Detailed Description

The following description of specific embodiments of the present application refers to the accompanying drawings.

First, terms, test methods, and the like according to the present invention will be explained.

Hematoxylin-eosin staining (HE staining) is short for hematoxylin-eosin staining. HE staining is one of the most basic and widely used technical methods in histology, pathology teaching and scientific research.

The hematoxylin staining solution is alkaline, and can stain basophilic structures (such as ribosome, nucleus, ribonucleic acid in cytoplasm and the like) of tissues into bluish purple; eosin is an acid dye that stains tissue eosinophils (e.g., intracellular and intercellular proteins, including lewy bodies, alcosomes, and most of the cytoplasm) pink, making the morphology of the entire tissue clearly visible.

The HE staining method comprises the following specific steps: fixing and slicing sample tissues; deparaffinizing the tissue sample; hydrating the tissue sample; staining tissue sections with hematoxylin, differentiating and turning blue; eosin staining and dehydrating the tissue section; air-drying the tissue sample slice and sealing; finally, the film was observed under a microscope and photographed.

Masson staining gives collagen fibers either a blue (stained with aniline blue) or green (stained with brilliant green) color and muscle fibers a red (stained with acid fuchsin and ponceau red) color, depending on the size of the anionic dye molecules and the permeability of the tissue. Fixed tissue is stained with a series of anionic water-soluble dyes, either sequentially or in combination, and it is found that red blood cells are stained with the smallest anionic dye, muscle fibers and cytoplasm are stained with the medium-sized anionic dye, and collagen fibers are stained with the larger anionic dye. This demonstrates that the permeability of erythrocytes to anionic dyes is minimal, the muscle fibers are inferior to the cytoplasm, and collagen fibers have the greatest permeability. Type I and type III collagens are green (GBM, TBM, mesangial matrix and renal interstitium are green), and the eosinophilic proteins, tubule cytoplasm, and erythrocytes are red.

The Masson staining method comprises the following specific steps:

fixing the tissue in Bouin's fluid, flushing with running water for one night, and conventionally dehydrating and embedding; slicing and dewaxing to water (dewaxing in xylene for 10min × 3 times, blotting liquid with absorbent paper, 100% ethanol for 5min × 2 times, blotting liquid with absorbent paper, 95% ethanol for 5min × 2 times, blotting liquid with absorbent paper, flowing for 2min, blotting water with absorbent paper); weiger's ferrohematoxylin staining for 5-10min; slightly washing with running water; differentiating with 0.5% hydrochloric acid alcohol for 15s; washing with running water for 3min; dyeing the ponceau acid fuchsin liquid for 8min; slightly washing with distilled water; treating with 1% phosphomolybdic acid aqueous solution for about 5min; directly re-dyeing with aniline blue solution or brilliant green solution for 5min without washing with water; treating with 1% glacial acetic acid for 1min; dehydrating with 95% ethanol for 5min × 2 times, and drying with absorbent paper; 100% ethanol for 5min × 2 times, and drying the liquid with absorbent paper; transparent in xylene for 5min × 2 times, and sucking the liquid with absorbent paper; and (5) sealing the neutral gum.

The Western immunoblotting (Western Blot) is carried out by transferring the protein to a membrane and detecting the protein with an antibody.

WesternBlot uses polyacrylamide gel electrophoresis, and the test substance is a protein, "probe" is an antibody, "and" color development "is with the labeled secondary antibody. Transferring the protein sample separated by PAGE to a solid phase carrier (such as nitrocellulose film), adsorbing the protein by the solid phase carrier in a non-covalent bond form, keeping the type and biological activity of the electrophoretically separated polypeptide unchanged, taking the protein or polypeptide on the solid phase carrier as an antigen, carrying out immunoreaction with a corresponding antibody, then reacting with an enzyme or isotope labeled second antibody, and carrying out substrate chromogenic or autoradiography to detect the protein component expressed by the specific target gene separated by electrophoresis. The method mainly comprises the following steps: protein extraction, protein quantification, glue preparation and electrophoresis, membrane conversion, immune labeling and development.

Immunohistochemistry, which is the principle of antigen-antibody reaction, i.e., the specific binding of antigen and antibody, determines the antigens (polypeptides and proteins) in tissue cells by developing color-developing agents (fluorescein, enzyme, metal ions, isotopes) of labeled antibodies through chemical reaction, and performs localized, qualitative and relatively quantitative studies on the antigens, is called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochemistry).

The main steps of immunohistochemistry include: soaking the slices, airing overnight, dewaxing xylene, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each), double-distilling with water, dropping 3% hydrogen peroxide solution to remove catalase, washing with water, repairing antigen, dropping 5% BSA, sealing for 1h, diluting primary antibody, washing with PBS buffer solution, incubating secondary antibody, washing with PBS buffer solution, developing with developing solution, washing with water, dyeing with hematoxylin, dehydrating with gradient ethanol, and sealing with neutral gum.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Also, the reagents, materials and procedures used herein are those that are widely used in the corresponding fields.

Example 1: the RNA delivery system of the present application has the effect of inhibiting lung cancer cells

1. In the delivery system, the promoter, the nitrogen terminal sequence encoding the CD63 protein, the linker1, the targeting gene, the linker2, the carbon terminal sequence encoding the CD63 protein, the 5 'flanking sequence, the RNA fragment, the loop sequence, the compensation sequence, the 3' flanking sequence and other sequences are all protected and mentioned in the present application and are not described in detail herein.

The vector used is a plasmid.

Experiment 1: the RNA used was EGFR siRNA.

The results show that the system has obvious treatment effect on the lung cancer with EGFR mutation.

2. The RNA used was KRAS siRNA, the others being the same as in "1".

The result shows that the system has obvious treatment effect on KRAS mutant lung cancer tumors.

Example 2: the RNA delivery system of the present application has the effect of treating pulmonary fibrosis

In the delivery system, the promoter, the nitrogen terminal sequence encoding the CD63 protein, the linker1, the targeting gene, the linker2, the carbon terminal sequence encoding the CD63 protein, the 5 'flanking sequence, the RNA fragment, the loop sequence, the compensation sequence, the 3' flanking sequence and other sequences are all protected and mentioned in the present application and are not described in detail herein.

The RNA is TGF-beta 1siRNA and/or miR-21antisense

The results show that pulmonary fibrosis is obviously reduced or eliminated, and the system in the application has obvious effect of inhibiting pulmonary fibrosis.

Example 3: the RNA delivery system of the present application has the effect of inhibiting renal cancer

In the delivery system, the promoter, the nitrogen terminal sequence encoding the CD63 protein, the linker1, the targeting gene, the linker2, the carbon terminal sequence encoding the CD63 protein, the 5 'flanking sequence, the RNA segment, the loop sequence, the compensation sequence, the 3' flanking sequence and the like are all protected and mentioned in the present application, and are not described in detail herein.

The RNA used was VEGFR and/or mTOR siRNAs.

The results show that the system in the application has obvious effect of inhibiting kidney cancer.

Example 4: the RNA delivery system of the present application has an inhibitory effect on glioblastoma

The RNA used was EGFR and/or TNC siRNAs.

The results show that the system of the present application has a significant effect of inhibiting glioblastoma.

Example 5: the RNA delivery system of the present application has an obesity-inhibiting effect

The RNA used was PTP1B siRNA.

The results show that the system in this application has a significant effect in inhibiting obesity.

Example 6: the RNA delivery system of the present application has an effect of inhibiting Huntington's disease

The RNA used was mHTT siRNA.

The results show that the system in this application has a significant effect in inhibiting huntington's disease.

Example 7: the RNA delivery system has the function of inhibiting Parkinson's disease

The RNA used was Lrrk2 siRNA.

The results show that the system in the application has obvious effect of inhibiting the Parkinson disease.

Example 8: the RNA delivery system of the present application has the effect of inhibiting colitis

The RNA used was TNF-alpha, integrin-alpha and dB7 siRNAs.

The results show that the system in this application has a significant colitis inhibiting effect.

Example 9:

a gene circuit comprises at least one RNA segment capable of interfering gene expression and/or at least one targeting gene coding a protein or peptide segment with targeting function, wherein the targeting gene is inserted into a gene sequence coding CD63 protein, the gene circuit is a sequence capable of being enriched in host organ tissues and self-assembling to form a composite structure, and the gene circuit realizes the treatment of diseases by inhibiting the expression of the gene through the RNA segment.

The protein or peptide segment with targeting function comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide and MSP targeting peptide.

The results of the detection of the siRNA expression level and KRASmRNA expression level after the PTP targeting gene is inserted into the CD63 protein are shown in FIG. 1, and the results of the detection of the siRNA expression level after the RVG targeting gene is inserted into the CD63 protein are shown in FIG. 2.

The target gene is inserted between any two adjacent bases in 20 th to 60 th of the nitrogen end of the gene sequence for coding the CD63 protein, such as 25-26, 30-31, 35-36, 40-41, 45-46, 50-51, 55-56, 59-60 and the like.

The targeting gene is inserted between adjacent GG (guanine) in 20 th to 60 th nitrogen terminal of the gene sequence encoding the CD63 protein.

The effect of the base sequence module insertion position on antigen expression is shown in FIG. 3. As can be seen from the results of FIG. 3, the insertion positions of the base sequence modules within the range defined in this example can be effectively expressed in the 30 th to 45 th positions of the nitrogen terminal of CD63 (32 aa, 34aa, 36aa and 40aa are selected for detection), and the effect is not very different, wherein the optimal siRNA expression level is 36aa.

The gene sequence for coding the CD63 protein is divided into two parts by the target gene to form a nitrogen terminal sequence for coding the CD63 protein and a carbon terminal sequence for coding the CD63 protein, and the target gene is positioned between the nitrogen terminal sequence and the carbon terminal sequence;

the nitrogen terminal sequence is a sequence containing seq1 or more than 70% of homology with the seq1 sequence;

seq1 sequence is: ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCTGTGCAGTGGGATTGATCGCCATTGGTGTAGCGGTTCAG.

the Seq2 sequence is: GTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCTCGCTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTGGACAAATTGCAGAAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGACAGAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGGGCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTGGCTATGAAGTAATGTAG.

The nitrogen terminal sequence of the coded CD63 protein is connected with the target gene through a linker 1;

linker1 is AGATCTCTAGCCACC or a sequence obtained by adding, reducing or replacing any 1-4 bases in the sequence, such as adding, reducing or replacing 1, 2, 3 or 4 bases.

The target gene is connected with the carbon terminal sequence of the coding CD63 protein through a linker 2;

the linker2 is ACCGGTGGAGCTCGAATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence, such as adding, reducing or replacing 1, 2, 3, 4, 5 or 6 bases and the like.

The results of the effect of Linker sequence changes on siRNA expression are shown in FIG. 4.

The RNA segment comprises one, two or more RNA sequences of medical significance and capable of being expressed, said RNA sequences being siRNA sequences, shRNA sequences or miRNA sequences.

The gene circuit further comprises a promoter; the types of the gene line include: promoter-RNA fragments, promoter-targeted genes, promoter-targeted gene-RNA fragments;

the gene circuit comprises at least one RNA segment capable of interfering the expression of the gene and at least one targeting gene with a targeting function, wherein the RNA segment and the targeting label are positioned in the same gene circuit or in different gene circuits.

The gene circuit also includes flanking sequences, loop sequences, and compensating sequences, which enable the gene circuit to fold into the correct structure and to be expressed, the flanking sequences including 5 'flanking sequences and 3' flanking sequences, and the compensating sequences are not expressed in the target receptor.

The types of gene lines include: 5 '-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3 'flanking sequence, 5' -promoter-nitrogen terminal sequence encoding CD63 protein-linker 1-targeting gene-linker 2-carbon terminal sequence encoding CD63 protein-5 'flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

The results of the effect of the RNA fragments and promoters on siRNA expression are shown in FIG. 5.

The 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with homology of more than 80 percent;

the complementary sequence is a reverse complementary sequence of the RNA fragment with any 1-5 base deleted.

The results of the effect on siRNA, protein or mRNA expression with or without the loop sequence inserted into the RVG targeting gene are shown in FIG. 6.

More preferably, the complementary sequence is the reverse complement of the RNA fragment, and any 1-3 consecutive bases in the complementary sequence are deleted.

The complementary sequence is the reverse complementary sequence of the RNA segment, and the 9 th and/or 10 th base in the complementary sequence is deleted.

The length of the RNA sequence is 15-25 nucleotides.

The length of the RNA sequence is 15-25 nucleotides. For example, the RNA sequence may be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides in length. Preferably, the RNA sequence is 18-22 nucleotides in length.

The results of the effect of RNA sequence length on protein or mRNA expression are shown in FIG. 7.

The RNA sequence is selected from any one or more of the following: siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-alpha gene, siRNA of integrin-alpha gene, siRNA of B7 gene, siRNA of TGF-beta 1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, antisense strand of miRNA-21, antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrk 2 gene, siRNA of alpha-synuclein gene, or RNA sequence having more than 80% homology with the above sequences, or nucleic acid molecule encoding the above RNA sequences. Here, the RNA sequence of the "nucleic acid molecule encoding the RNA sequence" also includes RNA sequences having a homology of more than 80% for each RNA.

The RNA fragment comprises an RNA sequence body and a modified RNA sequence obtained by modifying ribose of the RNA sequence body. That is, the RNA fragment may consist of only at least one RNA sequence entity, may consist of only at least one modified RNA sequence, or may consist of both the RNA sequence entity and the modified RNA sequence. Preferably, the ribose modification is a 2' fluoropyrimidine modification.

The organ tissue is liver, and the composite structure is exosome.

An intermediate sequence fragment is arranged between the promoter and the nitrogen terminal sequence for coding the CD63 protein, the length of the intermediate sequence fragment is 60-150bp, preferably 80-120bp, more preferably 90-110bp (such as 95, 100, 105 and the like), and the sequence only has certain requirements on the length and has no requirements on specific base arrangement.

The present application also provides an RNA delivery system comprising the genetic circuit of any one of the above paragraphs and a delivery vector capable of delivering the genetic circuit to an organ tissue of a host that is enriched.

The delivery vector containing the gene circuit can be enriched in the organ tissues of the host and self-assembled in the organ tissues of the host to form a composite structure, the targeting label is positioned on the surface of the composite structure, and the composite structure searches for and binds the target tissues through the targeting label and sends the RNA fragments into the target tissues.

The delivery vector carries one, two or more gene lines, and all the gene lines carried by the delivery vector at least comprise one RNA fragment and one targeting gene.

In the case where the delivery vector carries two or more of the gene lines, adjacent ones of the gene lines are connected by a sequence consisting of sequences 1 to 3 (sequence 1-sequence 2-sequence 3);

In the case where the delivery vector carries two or more of the gene lines, adjacent ones of the gene lines are linked by sequence 4 or a sequence having a homology of greater than 80% to sequence 4;

wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

The effect of sequence 4 or sequence 4 homologous sequence for ligation between adjacent gene lines on siRNA expression is shown in FIG. 8.

The delivery vector is a viral vector or a non-viral vector; wherein, the virus vector comprises an adeno-associated virus vector, an adenovirus vector and a retrovirus vector, and the non-virus vector comprises a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector and a multifunctional envelope type nano vector.

The delivery vector is an adeno-associated viral vector or a plasmid vector. Wherein the adeno-associated viral vector is preferably adeno-associated viral vector type 5 (AAV 5), adeno-associated viral vector type 8 (AAV 8) or adeno-associated viral vector type 9 (AAV 9).

The delivery system is a delivery system for use in mammals including humans.

The present application also provides a use of an RNA delivery system as described in any of the preceding paragraphs in medicine.

The administration mode of the medicine comprises oral administration, inhalation, subcutaneous injection, intramuscular injection and intravenous injection. That is, the drug can be delivered to the target tissue by the RNA delivery system as described in any of the above paragraphs after entering the body by oral administration, inhalation, subcutaneous injection, intramuscular injection or intravenous injection, and then exert a therapeutic effect.

The medicine is used for treating cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type II diabetes, huntington disease, parkinson disease, myasthenia gravis, alzheimer disease or graft-versus-host disease.

siRNA of each gene is an RNA sequence having a function of suppressing the expression of the gene, and the number of RNA sequences having a function of suppressing the expression of each gene is large, and cannot be listed here, and only sequences having excellent effects are exemplified below.

The siRNA of mTOR gene includes AGAUAGUUGGCAAAUCUGCCA, ACUAUUUCAUCCAUAUAAGGU, AAAAUGUUGUCAAAGAAGGGU, AAAAAUGUUGUCAAAGAAGGG, UGAUUUCUUCCAUUUCUUCUC, other sequences that inhibit the expression of mTOR gene, and sequences with homology of more than 80%.

HLA gene siRNA, AUCUGGAUGGUGUGAGAACCG, UGUCACUGCUGCCUGAG, UCACAAGGGAAGGGCAGGAA, UUGCAGAACAAGUCAGGGU, ACACACGACACACACAGACAUGCA, other sequences capable of inhibiting HLA gene expression and sequences with homology of more than 80 percent with the sequences.

In addition, the application also has the effect of obviously inhibiting type II diabetes, myasthenia gravis, alzheimer's disease, cardiovascular diseases caused by obesity, graft-versus-host disease and related diseases thereof. The cancer can also be used for treating gastric cancer, liver cancer, brain cancer, leukemia, intestinal cancer, skin cancer, lymph cancer, breast cancer, bladder cancer, esophageal cancer, head and neck squamous carcinoma, hemangioma, melanoma, etc., which can be supplemented later in experimental verification.

In the present application, the homologous sequences all include sequences obtained by adding one or more bases to the original sequence, reducing one or more bases, and replacing any one or more bases.

In this document, "upper", "lower", "front", "rear", "left", "right", and the like are used only to indicate relative positional relationships between relevant portions, and do not limit absolute positions of the relevant portions.

In this document, "first", "second", and the like are used only for distinguishing one from another, and do not indicate the degree and order of importance, and the premise that each other exists, and the like.

In this context, "equal", "same", etc. are not strictly mathematical and/or geometric limitations, but also include tolerances as would be understood by a person skilled in the art and allowed for manufacturing or use, etc.

Unless otherwise indicated, numerical ranges herein include not only the entire range within its two endpoints, but also several sub-ranges subsumed therein.

The preferred embodiments and examples of the present application have been described in detail with reference to the accompanying drawings, but the present application is not limited to the embodiments and examples described above, and various changes can be made within the knowledge of those skilled in the art without departing from the concept of the present application.

Claims

1. A gene circuit, characterized in that the gene circuit comprises at least one RNA segment capable of interfering gene expression and/or at least one targeting gene coding protein or peptide segment with targeting function, the targeting gene is inserted into a gene sequence coding CD63 protein, the gene circuit is a sequence capable of enriching in host organ tissues and self-assembling to form a composite structure, and the gene circuit realizes the treatment of diseases by inhibiting the expression of genes through the RNA segment.

2. The gene circuit of claim 1, wherein the protein or peptide fragment with targeting function comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide.

3. The gene circuit of claim 1, wherein the targeting gene is inserted between any two adjacent bases in the 20 th to 60 th nitrogen terminal of the gene sequence encoding the CD63 protein.

4. The gene circuit of claim 3 wherein the targeting gene is inserted between adjacent GG (guanine) in the 20 th to 60 th nitrogen terminal of the gene sequence encoding the CD63 protein.

5. The gene circuit of claim 3, wherein the targeting gene divides the gene sequence encoding the CD63 protein into two parts, forming a nitrogen terminal sequence encoding the CD63 protein and a carbon terminal sequence encoding the CD63 protein, the targeting gene being located between the nitrogen terminal sequence and the carbon terminal sequence;

preferably, the nitrogen terminal sequence is a sequence containing seq1 or more than 70% homologous with the seq1 sequence;

6. The gene circuit of claim 5, wherein the nitrogen terminal sequence forming the encoded CD63 protein is connected with the target gene through linker 1;

preferably, the linker1 is AGATCTCTAGCCACC or a sequence obtained by adding, reducing or replacing any 1-4 bases in the sequence.

7. The gene circuit according to claim 5, wherein the targeting gene is connected with the carbon terminal sequence encoding the CD63 protein through a linker 2;

preferably, the linker2 is ACCGGTGGAGCTCGAATCAGATCT or a sequence obtained by adding, reducing or replacing any 1-6 bases in the sequence.

8. The genetic circuit of claim 1 wherein the RNA segments comprise one, two or more RNA sequences of medical significance and capable of being expressed, said RNA sequences being siRNA sequences, shRNA sequences or miRNA sequences.

9. The genetic circuit of claim 8 further comprising a promoter; the types of the gene line include: promoter-RNA fragments, promoter-targeted genes, promoter-targeted gene-RNA fragments;

10. The genetic circuit of claim 9 further comprising flanking sequences, loop sequences, compensation sequences, which enable the gene circuit to be folded into the correct configuration and expressed, said flanking sequences comprising a 5 'flanking sequence and a 3' flanking sequence;

the types of the gene line include: 5 '-promoter-5' flanking sequence-RNA fragment-loop sequence-compensating sequence-3 'flanking sequence, 5' -promoter-nitrogen end sequence coding CD63 protein-linker 1-target gene-linker 2-carbon end sequence coding CD63 protein-5 'flanking sequence-RNA fragment-loop sequence-compensating sequence-3' flanking sequence.

11. The genetic circuit of claim 10 wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence having greater than 80% homology thereto;

12. The genetic circuit of claim 8 wherein the RNA sequence is 15 to 25 nucleotides in length.

13. The genetic circuit of claim 12 wherein the RNA sequence is selected from any one or more of: siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-alpha gene, siRNA of integrin-alpha gene, siRNA of B7 gene, siRNA of TGF-beta 1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, antisense strand of miRNA-21, antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrk 2 gene, siRNA of alpha-synuclein gene, RNA sequence having more than 80% homology with the above sequences, or nucleic acid molecule encoding the above RNA sequences.

14. The genetic circuit of claim 8 wherein said RNA fragments comprise an RNA sequence entity and a modified RNA sequence that is ribomodified from said RNA sequence entity;

preferably, the ribose modification is a 2' fluoropyrimidine modification.

15. The gene circuit of claim 1 wherein the organ tissue is liver and the complex structure is an exosome.

16. An RNA delivery system comprising the genetic circuit of any one of claims 1-11 and a delivery vector capable of delivering the genetic circuit to an organ tissue of a host.

17. The RNA delivery system of claim 16, wherein the delivery vector comprising the gene circuit is capable of enriching in and self-assembling in the organ tissue of the host to form a complex structure, wherein the targeting tag is located on the surface of the complex structure, and wherein the complex structure seeks for and binds to the target tissue via the targeting tag to deliver the RNA fragments to the target tissue.

18. The RNA delivery system of claim 16, wherein the delivery vector carries one, two or more of the genetic circuits, all of which carry at least one RNA fragment and one targeting gene.

19. The RNA delivery system of claim 18, wherein in the case where the delivery vector carries two or more of the genetic circuits, adjacent ones of the genetic circuits are connected by a sequence consisting of sequences 1-3;

wherein, the sequence 1 is CAGATC, the sequence 2 is a sequence consisting of 5-80 bases, and the sequence 3 is TGGATC.

20. The RNA delivery system of claim 19, wherein in the case where the delivery vector carries two or more of said genetic circuits, adjacent ones of said genetic circuits are linked by sequence 4 or a sequence having greater than 80% homology to sequence 4;

wherein the sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

21. The RNA delivery system of claim 16, wherein the delivery vector is a viral vector or a non-viral vector;

wherein, the virus vector comprises an adeno-associated virus vector, an adenovirus vector and a retrovirus vector, and the non-virus vector comprises a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector and a multifunctional envelope type nano vector.

22. The RNA delivery system of claim 16, wherein the delivery system is a delivery system for use in a mammal, including a human.

23. Use of the RNA delivery system of any one of claims 16-22 in medicine.

24. The use of claim 23, wherein the medicament is administered orally, by inhalation, subcutaneously, intramuscularly or intravenously.

25. The use of claim 24, wherein the medicament is a medicament for the treatment of cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type ii diabetes, huntington's disease, parkinson's disease, myasthenia gravis, alzheimer's disease, or graft versus host disease.