CN115772224A - Goat antibody for resisting mouse IgG2a and application thereof - Google Patents

Abstract

The invention relates to a goat antibody resisting mouse IgG2a and application thereof. The antibody has at least one of a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2, and a light chain CDR3. The antibody can be used for preparing a mouse IgG2a secondary antibody. The goat antibody of the target mouse IgG2a is obtained by a phage display technology, can specifically recognize the IgG2a of the mouse with high affinity, is weakly combined with mouse IgG1 and IgG3, has no cross reaction with Human IgG, and has important application value.

Description

Goat antibody for resisting mouse IgG2a and application thereof

Technical Field

The invention relates to a goat antibody resisting mouse IgG2a and application thereof, belonging to the technical field of biology.

Technical Field

The antibody from the mouse as the primary source is called the primary antibody, and the secondary antibody is an antibody that binds to the primary antibody, i.e., the antibody, whose primary function is to detect the presence of the antibody and amplify the signal of the primary antibody. The secondary antibody plays a great role in indirect enzyme-linked immunosorbent assay, immunochromatography and other experiments. The traditional preparation of the secondary antibody utilizes the property that the antibody is macromolecular protein with antigenicity to immunize a heterogeneous animal, and the immune globulin aiming at the antibody generated by the immune system of the heterogeneous animal has the defects of long preparation period and complex operation. The antibody library technology is a technology for cloning all antibody variable region genes of a certain animal into a plasmid or a phage for expression, and screening clones carrying specific antibody genes by using different antigens or antibodies so as to obtain corresponding specific antibodies. The antibody library technology not only can simulate the process of generating antibodies by the immune system of animals, but also has a plurality of unique advantages, the antibody library technology does not need immunization, and theoretically, 10 ^～10 The library may contain all antibodies. The specific antibody can be directly screened from the antibody library of the non-immune animal by using the antigen or the antibody, and the antibody aiming at the self-antigen of the species can be screened.

Disclosure of Invention

The main purposes of the invention are: provides a goat antibody which is anti-mouse IgG2a and has no cross with human IgG, and also provides the application of the antibody.

The technical scheme for solving the technical problems of the invention is as follows:

a goat antibody to mouse IgG2a, selected from any one of:

i) The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody of the anti-mouse IgG2a are respectively shown as the amino acid sequences of 31 th to 35 th, 50 th to 64 th and 98 th to 107 th positions of SEQ ID NO.2, and the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are respectively shown as the amino acid sequences of 24 th to 34 th, 50 th to 56 th and 89 th to 97 th positions of SEQ ID NO. 4;

or ii) the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody of the anti-mouse IgG2a are respectively shown as the amino acid sequences at positions 31-35, 50-64 and 98-113 of SEQ ID NO.6, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are respectively shown as the amino acid sequences at positions 24-39, 55-61 and 94-102 of SEQ ID NO.8.

Preferably, the heavy chain amino acid sequence of the goat anti-mouse IgG2a antibody is as shown in SEQ ID NO:2, and the light chain amino acid sequence is shown as SEQ ID NO:4 is shown in the specification; or the heavy chain amino acid sequence is shown as SEQ ID NO:6 is shown in the specification; the light chain amino acid sequence is shown as SEQ ID NO: shown in fig. 8.

Nucleic acid encoding a goat antibody against mouse IgG2a as described herein.

Preferably, the heavy chain DNA sequence of the goat anti-mouse IgG2a antibody is as shown in SEQ ID NO:1, and the light chain DNA sequence is shown as SEQ ID NO:3 is shown in the figure; or the heavy chain DNA sequence is shown as SEQ ID NO:5, and the light chain DNA sequence is shown as SEQ ID NO: shown at 7.

The nucleotide sequence of the antibody of the present invention can be easily mutated by a person of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more than 75% identity with the nucleotide sequence of the antibody of the present invention are derived from and identical to the nucleotide sequence of the present invention.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more identity to the nucleotide sequence of the present invention encoding the protein represented by SEQ ID No. 1. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences. The above-mentioned identity of 75% or more may be 75%, 80%, 85%, 90% or 95% or more.

An expression vector comprising said nucleic acid. Various carriers known in the art may be used. For example, an expression vector can be formed by selecting a commercially available vector and then operably linking a nucleotide sequence encoding the antibody of the present invention to an expression control sequence.

As a preferred embodiment of the present invention, the expression vector is pcDNA3.4.

A host cell comprising the expression vector of the invention. Host cells useful in the present invention include prokaryotic and eukaryotic cells. Examples of commonly used prokaryotic host cells include E.coli, bacillus subtilis, and the like. Host cells for expressing the antibody include Escherichia coli, yeast cells, insect cells, COS cells, CHO cells, etc.

Preferably, the host cell is a eukaryotic cell, and the host cell is HEK-293 cell or CHO cell.

A labeled goat antibody resisting mouse IgG2a is provided, wherein the antibody is the goat antibody resisting mouse IgG2a, and the label is horseradish peroxidase.

The invention relates to application of a goat antibody resisting mouse IgG2a in preparation of a mouse IgG2a secondary antibody.

The invention has the following beneficial effects:

the goat antibody of the targeted mouse IgG2a is obtained by a phage display technology, and the antibody can specifically recognize the mouse IgG2a with high affinity and has no cross with human IgG. The antibody can be used for preparing a mouse IgG2a secondary antibody and has important application value.

Drawings

FIG. 1is a graph showing the single clone enrichment ratio analysis in example 1.

FIG. 2 is a schematic diagram of the mammalian system expression plasmid of example 2.

Wherein, the plasmids Unique1-H and Unique1-L are respectively heavy chain and light chain plasmids which are required by the goat antibody Unique1 expressed by the mammal system, and the plasmids Unique7-H and Unique7-L are respectively heavy chain and light chain plasmids which are required by the goat antibody Unique7 expressed by the mammal system.

FIG. 3 is a polyacrylamide gel electrophoresis image of goat antibodies expressed by the lactation system of example 2.

1: unique1 mammalian system expression antibodies

2: unique7 mammalian system expression antibodies

FIG. 4 is a graph showing the results of the binding ELISA of the goat antibody Unique1 expressed in the lactation system in example 3.

FIG. 5 is a graph showing the results of the binding ELISA of the goat antibody Unique7 expressed in the lactation system in example 3.

FIG. 6 is a graph showing the results of detection of a mammalian system-expressed secondary mouse IgG2a (Unique 1) antibody labeled with HRP by ELISA in example 4.

Wherein, the E1isa curves of Mouse IgG1, mouse IgG3 and Human IgG are superposed

FIG. 7 is a graph showing the results of detection of a secondary mouse IgG2a (Unique 7) antibody expressed by HRP-labeled mammalian system by ELISA in example 4.

Wherein, the E1isa curves of Mouse IgG1, mouse IgG3 and Human IgG are superposed

Detailed Description

The present invention will be described in further detail with reference to examples. The invention is not limited to the examples given. The methods used are conventional methods unless otherwise specified, and the reagents and materials used are commercially available products unless otherwise specified.

Example 1 screening of goat antibodies against mouse IgG2a

The Mouse IgG2a is used as a positive screening antigen, the Human IgG is used as a negative screening antigen, and a phage display technology is applied to obtain a goat antibody phage library (the size of the library is 1.3x10) ¹⁰ ) Goat antibodies were medium-screened against mouse IgG2a and not crossed with human IgG.

Using solid phase panning, human IgG was coated onto ELISA plates at 100uL/well overnight at 4 ℃. PBST was washed three times, 200uL of casein was added to each well, and blocked for 2 hours at 37 ℃. The PBST three times after washing with phage display library (about 1x 10) ¹² CFU), incubation for 1 hour at 37 ℃, unbound phage were collected and negative screening was repeated three times to remove phage bound to Human IgG. Adding phage after negative screening to the sealed phageELISA plates coated with Mouse IgG2a were incubated at 37 ℃ for 1 hour. Unbound phage were aspirated and washed 10 times with PBST. 100uL of glycine-hydrochloric acid solution is added into each hole, the reaction is carried out for 7 minutes at 37 ℃, the plate holes are lightly blown to elute the adsorbed phage, and then Tris-HCl solution is added to neutralize the phage to be neutral. The eluted phage was infected with TG1 cells in the logarithmic growth phase, and the recovered phage was amplified for the next round of panning.

After three rounds of panning, phage-ELISA was used to verify whether specific enrichment occurred. Mouse IgG2a was coated onto ELISA plates and coated overnight at 4 ℃. PBST was washed three times and blocked with 3% casein at 37 ℃ for 2 hours. PBST 5 times after washing with three rounds of panning phage display library, the first hole about 1x10 ¹² CFU, 4-fold gradient dilution, end Kong Kongbai, bind at 37 ℃ for 1 hour. After PBST was washed 5 times, secondary HRP-labeled mouse anti-M13 antibody was added and incubated at 37 ℃ for 1 hour. After PBST is washed for 5 times, TMB developing solution is added for developing for 5-10 minutes in a dark place at room temperature, finally, 2M sulfuric acid is used for stopping developing, and an enzyme-linked immunosorbent assay (ELISA) instrument is used for reading the light absorption value under the wavelength of 450nm and making a Phage-ELISA combination curve.

ELISA detection results show that the affinity of the phage group to mouse IgG2a is increased in turn by taking the helper phage as a negative control after three rounds of enrichment, and the affinity of the phage group to Human IgG is decreased in turn by taking the helper phage as a negative control after three rounds of enrichment.

And (3) performing antigen binding analysis on the third round of enriched phage monoclonal, wherein the specific process is as follows:

TG1 cells were infected with the third round of enriched phage pool and 792 single clones were randomly picked from them, and phages were amplified and recovered. Mouse IgG2a was coated onto ELISA plates and coated overnight at 4 ℃. PBST was washed three times and blocked with 3% casein at 37 ℃ for 2 hours. 792 amplified monoclonal phages were incubated with 3% casein in PBST solution at 1:1 for 1 hour at room temperature, the incubated phages were added to the blocked microplate and incubated for 1 hour at 37 ℃. After PBST was washed 5 times, secondary HRP-labeled mouse anti-M13 antibody was added and incubated at 37 ℃ for 1 hour. After PBST is washed for 5 times, TMB is added for color development in a dark place at room temperature for 5-10 minutes, finally the color development is stopped by 2M sulfuric acid, the light absorption value under the wavelength of 450nm is read by an enzyme-linked immunosorbent assay, and the positive clone is obtained when the light absorption value is more than twice of that of a negative control (helper phage). The binding ability of 792 monoclonal phages to Mouse IgG2a and Human IgG was analyzed, and 25 of the 792 monoclonal phages bound Mouse IgG2a and did not bind Human IgG.

Sequencing analysis of these 25 positive clones yielded 7 Unique sequences, with Unique1 and Unique7 being dominant enrichment clones (as shown in FIG. 1).

The DNA sequence of the heavy chain of the antibody of the Unique 1is SEQ ID NO.1, and the amino acid sequence is SEQ ID NO.2.

In the amino acid sequence, amino acid residues 31-35 (i.e., NYGVG) are heavy chain CDR1, amino acid residues 50-64 (i.e., TIRRGGGTVYNPALQ) are heavy chain CDR2, and amino acid residues 98-107 (i.e., LRVDWFSIDA) are heavy chain CDR3.

The DNA sequence of the antibody light chain of the Unique 1is SEQ ID NO.3, and the amino acid sequence is SEQ ID NO.4.

In the amino acid sequence, amino acid residues 24-34 (i.e., RTSQSVRNYLN) are heavy chain CDR1, amino acid residues 50-56 (i.e., YATRLYT) are heavy chain CDR2, and amino acid residues 89-97 (i.e., LQDYSIPLA) are heavy chain CDR3.

The DNA sequence of the heavy chain of the antibody of the Unique7 is SEQ ID NO.5, and the amino acid sequence is SEQ ID NO.6.

In the amino acid sequence, amino acid residues 31-35 (i.e., DYVG) are heavy chain CDR1, amino acid residues 50-64 (i.e., VIWSSGNTDYKSALK) are heavy chain CDR2, and amino acid residues 98-113 (i.e., ISGWDYGSGSGYYINR) are heavy chain CDR3.

The DNA sequence of the antibody light chain of the Unique7 is SEQ ID NO.7, and the amino acid sequence is SEQ ID NO.8.

In the amino acid sequence, amino acid residues 24-39 (i.e., KSSQSLVHSDGKTYLN) are heavy chain CDR1, amino acid residues 55-61 (i.e., EVSKRYS) are heavy chain CDR2, and amino acid residues 94-102 (i.e., FQGTELPYA) are heavy chain CDR3.

Example 2: goat antibody mammal system expression and purification of anti-mouse IgG2a

Using the positive clones Unique1 and Unique7 obtained in example 1 as templates, a large amount of heavy chain variable region DNA fragments and light chains were amplified by Polymerase Chain Reaction (PCR) techniqueAnd (3) a variable region DNA fragment, wherein the upstream and downstream primer sequences for amplifying the Unique1 heavy chain variable region DNA fragment are Unique1-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGAGACTGCAGGAAAGCGGC and Unique1-HR: GACCGATGGGCCCTTGGTGCTAGCGGAGGACACTGTCACCAGCAGGCC, the upstream and downstream primer sequences for amplifying the DNA fragment of the variable region of the Unique1 light chain are Unique1-LF: GTCCTCCTGACTGGGGTGAGGGCCGACATTCAGGTGACCCAGAGCCCC and Unique1-LR: GACAGATGGTGCAGCCACCGTACGTTTGATTTCCACCCGGGTGCCTCC, the upstream and downstream primer sequences for amplifying the Unique7 heavy chain variable region DNA fragment are Unique7-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGCAGCTGCAGGAGTCGGGA and Unique7-HR: GACCGATGGGCCCTTGGTGCTAGCTGAGGAGACTGTGACCAGGAGCCC, the upstream and downstream primer sequences for amplifying the DNA fragment of the light chain variable region of Unique7 are Unique7-LF: GTCCTCCTGACTGGGGTGAGGGCCGATGTTGTGCTGACCCAAACTCCA and Unique7-LR: GACAGATGGTGCAGCCACCGTACGTTTGATCTCCACTCTGGTCCCACC. The heavy chain variable region DNA fragment and the light chain variable region DNA fragment amplified by the positive clone Unique1 are respectively recombined into PCDNA3.4 by using a DNA recombination technology, the restriction enzyme cutting site is HindIII/BamHI to construct plasmids Unique1-H and Unique1-L in the figure 2, the heavy chain variable region DNA fragment and the light chain variable region DNA fragment amplified by the positive clone Unique7 are respectively recombined into PCDNA3.4 by using the DNA recombination technology, the restriction enzyme cutting site is HindIII/BamHI to construct plasmids Unique7-H and Unique7-L in the figure 2. And (3) transfecting the HEK-293 cell with the successfully constructed recombinant vector by using a liposome transfection method. HEK-293 cells in logarithmic growth phase are inoculated into a 6-well plate, and the cell density is 1.5 multiplied by 10 ⁶ cell/mL，37℃、CO ₂ And culturing the cells in a microplate oscillator in an incubator for 1-3h, and then carrying out transfection. Adding the liposome-carrier mixed solution into the cell pores, culturing for 2, 4 and 6 days, supplementing materials and supplementing liquid, and collecting and purifying on day 7. The column was equilibrated with a flow rate of 20mL of 1xPBS,1mL/min, loading at a flow rate of 1mL/min, washing at a flow rate of 20mL of 1xPBS,1mL/min, eluting with a citric acid buffer solution (pH 3.4), at a flow rate of 1mL/min, and collecting in separate tubes at an amount of about 500uL per tube. 10 tubes were collected together and absorbance values at 280nm were read using a NanoDrop instrument. And (4) sucking the high-concentration protein into a dialysis bag and putting the dialysis bag into a beaker of 1XPBS for dialysis. The SDS-PAGE results under reducing conditions of the purified antibody were collected as shown in FIG. 3.

Example 3 binding of goat antibodies expressed in a Mammalian System ELSIA

Goat antibodies expressed in the lactation system were verified by ELISA. Goat antibodies expressing anti-Mouse IgG2a in the mammalian system of example 2 were diluted and coated on ELISA plates, overnight at 4 ℃ and blocked with 3% casein at 37 ℃ for 1 hour, biotin-labeled Mouse IgG1, mouse IgG2a and Mouse IgG3 were diluted to give the first well concentration, diluted with 4-fold gradient, blank at the end, incubated at 37 ℃ for 1 hour, washed with PBST for 5 times and then blotted dry, and SA-HRP was used as a secondary antibody, incubated at 37 ℃ for 1 hour, washed with PBST for 5 times and then blotted dry. Adding 100uL TMB into each well, reacting for 5-10min at room temperature in dark, stopping color development with 2M sulfuric acid, and reading the light absorption value at 450nm wavelength with a microplate reader.

As a result, as shown in FIGS. 4 and 5, the goat antibodies Unique1 and Unique7 expressed in the mammalian system both showed high affinity binding to Mouse IgG2a, weak binding to Mouse IgG1 and Mouse IgG3, and no binding to Human IgG.

Example 4 preparation of HRP-labeled mouse IgG2a Secondary antibody Using anti-mouse IgG2a goat antibody expressed in the suckling System

The anti-mouse IgG2a goat antibody expressed in the lactation system was labeled according to the instruction of the antibody-HRP labeling kit (manufactured by Guangzhou Huayin pharmaceutical science and technology Co., ltd.), specifically, the kit was removed from the refrigerator 30 minutes before the experiment and was allowed to equilibrate to room temperature (18-25 ℃). 1500mL each of CB (50 mM carbonate buffer, pH9.6, 25 ℃) and PBS (10 mM phosphate, 0.9% NaCl buffer, pH 7.2, 25 ℃) were prepared. 5mg/mL of a solution of goat antibody against mouse IgG2a expressed in the mammalian system was dialyzed overnight at 4 ℃ against 50mM CB (pH 9.6) and the solution was changed 2 to 3 times. Adding 0.4mL of ultrapure water into an HRP tube under the condition of keeping out of the sun, fully and uniformly mixing, adding 1mL of ultrapure water into a sodium periodate (NaIO 3) tube, and fully and uniformly mixing. And adding 45uL of the dissolved NaIO3 solution into the dissolved HRP solution while uniformly mixing, and standing at room temperature in the dark for reaction for 20min. Adding 40uL of ethylene glycol into the solution, mixing uniformly, and standing at room temperature in the dark for 30min. And adding the oxidized HRP solution into an anti-mouse IgG2a goat antibody solution expressed by a lactation system, fully and uniformly mixing, and dialyzing and crosslinking at room temperature for 2.5 hours. The cross-linked dialysate was 50mM CB (pH 9.6) buffer. 0.5mL of ultrapure water is added into a sodium borohydride (NaBH 4) tube, and the mixture is inverted for several times and mixed evenly. And taking the crosslinked antibody-HRP solution out of the dialysis bag, placing the solution in a brown glass bottle, adding 80uL of NaBH4 solution, placing the solution at 4 ℃ in a dark place for reaction for 2 hours, and gently shaking the solution once every 30 minutes. The reduced antibody-HRP solution was dialyzed overnight (18 hours or more) at 4 ℃ in 10mM PBS (pH 7.2). The liquid is changed for 3 to 4 times, and the time interval of the first liquid change is 2 hours. The labeled antibody-HRP solution is harvested and ready for use (equal amounts of glycerol or other protein protecting agent may be added).

The ELISA plates were coated with Mouse IgG1, mouse IgG2a, mouse IgG3 and Human-IgG, respectively, 2.5ug/mL in the first well, four-fold gradient dilution, blank in the last well, and overnight at 4 ℃. Washing with PBST for 3-5 times the next day, adding 200uL 3% casein to each well after drying, blocking for 1h at 37 ℃, washing with PBST for 3-5 times, adding 100uL HRP-labeled goat antibody (1 mg/mL, 1.

As shown in FIGS. 6 and 7, the goat anti-Mouse IgG2a antibody expressed by the HRP-labeled mammalian system bound to Mouse IgG2a, but did not bind to Mouse IgG1, mouse IgG3, and Human IgG, and was used as a secondary Mouse IgG2a antibody.

Claims (10)

1. A goat antibody against mouse IgG2a, wherein the antibody is selected from any one of:

i) The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody of the anti-mouse IgG2a are respectively shown as the amino acid sequences of 31 th to 35 th, 50 th to 64 th and 98 th to 107 th positions of SEQ ID NO.2, and the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are respectively shown as the amino acid sequences of 24 th to 34 th, 50 th to 56 th and 89 th to 97 th positions of SEQ ID NO. 4;

or ii) the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody of the anti-mouse IgG2a are respectively shown as the amino acid sequences at 31-35, 50-64 and 98-113 positions of SEQ ID NO.6, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are respectively shown as the amino acid sequences at 24-39, 55-61 and 94-102 positions of SEQ ID NO.8.

2. The anti-mouse IgG2a goat antibody according to claim 1, wherein said anti-mouse IgG2a goat antibody heavy chain amino acid sequence is set forth in SEQ ID NO:2, and the light chain amino acid sequence is shown as SEQ ID NO:4 is shown in the specification; or the heavy chain amino acid sequence is as shown in SEQ ID NO:6 is shown in the specification; the light chain amino acid sequence is shown as SEQ ID NO: shown in fig. 8.

3. Nucleic acid encoding the goat antibody against mouse IgG2a according to claim 1 or 2.

4. The nucleic acid of claim 3, wherein the DNA sequence of the heavy chain of the goat anti-mouse IgG2a antibody is as set forth in SEQ ID NO:1, and the light chain DNA sequence is shown as SEQ ID NO:3 is shown in the specification; or the heavy chain DNA sequence is shown as SEQ ID NO:5, and the light chain DNA sequence is shown as SEQ ID NO: shown in fig. 7.

5. An expression vector comprising the nucleic acid of claim 3 or 4.

6. The vector of claim 5, wherein the expression vector is pcDNA3.4.

7. A host cell comprising the expression vector of claim 6.

8. The host cell of claim 7, wherein the expression host cell is a 293 cell or a CHO cell.

9. A labeled goat antibody against mouse IgG2a, wherein the antibody is the goat antibody against mouse IgG2a of claim 1 or 2, and the label is horseradish peroxidase.

10. Use of the goat anti-mouse IgG2a antibody of claim 1 or 2 in the preparation of a mouse IgG2a secondary antibody.

Images