CN115725750A

CN115725750A - SNP marker related to high ammonia nitrogen resistance of litopenaeus vannamei, application and primer

Info

Publication number: CN115725750A
Application number: CN202211582596.1A
Authority: CN
Inventors: 刘建勇; 傅铄; 林松
Original assignee: Zhanjiang Guoxing Aquatic Product Technology Co ltd; Guangdong Ocean University
Current assignee: Zhanjiang Guoxing Aquatic Product Technology Co ltd; Guangdong Ocean University
Priority date: 2022-12-08
Filing date: 2022-12-08
Publication date: 2023-03-03

Abstract

The invention discloses an SNP marker related to high ammonia nitrogen resistance of litopenaeus vannamei, application and a primer thereof, belongs to the technical field of aquatic animal genetic molecular marker assisted selective breeding, and particularly relates to an SNP marker related to high ammonia nitrogen resistance of litopenaeus vannamei, application thereof and a primer for detecting the SNP marker. The SNP molecular marker is obtained by amplifying the OZF gene fragment, the 364 th base of the SNP marker from the 5' end is T or C, and the SNP marker is closely related to the high ammonia nitrogen resistance of the litopenaeus vannamei and can be effectively used for molecular marker assisted breeding of the litopenaeus vannamei. By adopting the technical scheme of the invention, the litopenaeus vannamei is selected early according to the actual breeding demand, the breeding efficiency and accuracy are effectively improved, the genetic level of the breeding population of the litopenaeus vannamei is improved, and thus the litopenaeus vannamei variety with strong stress resistance can be accurately and efficiently bred.

Description

SNP marker related to high ammonia nitrogen resistance of litopenaeus vannamei, application and primer

Technical Field

The invention belongs to the technical field of aquatic animal heredity and molecular marker assisted selective breeding, and particularly relates to an SNP marker related to high ammonia nitrogen resistance of litopenaeus vannamei, application thereof and a primer for detecting the SNP marker.

Background

Litopenaeus vannamei (Litopenaeus vannamei) is a shrimp variety originally produced on the east coast of the Pacific region, commonly called Penaeus vannamei, and introduced into China from the United states in 1988, breaks through artificial breeding technology soon, but the breeding scale is small all the time. The breeding scale of the parent shrimps without Specific Pathogen (SPF) is increased year by year until 1999. The shellfish culture medium has the characteristics of high economic value, strong vitality, wide environmental adaptation range, strong disease resistance and the like, and is the most widely cultured shellfish in China and the world at present. At present, the Litopenaeus vannamei breeding mode adopts a semi-intensive and intensive breeding mode, and a large amount of feed is generally required to be fed into a water body in the large-scale breeding mode. Under the condition, the residual bait and the excrement generated by the prawns can cause water quality deterioration and the ammonia nitrogen concentration of the water body to increase after long-term accumulation. Non-ionic ammonia (NH) ₃ ) And ionic ammonia (NH) ⁴⁺ ) Is two main existing forms of ammonia nitrogen in aquaculture water. The non-ionic ammonia has cell membrane permeability, can diffuse through the cell membrane of the aquatic animal and accumulate in the organs of the aquatic animal, so that the organs are damaged, the oxidation/oxidation resistance balance of organisms is damaged, the phenomena of oxidative stress and prawn molting frequency increase are caused, the membrane integrity is finally lost, and the immunity of prawns is reduced and even death is caused.

At present, the Litopenaeus vannamei breeding selection is generally carried out by adopting group and family breeding, but the breeding method has the defects of long period, high cost, limited utilization of genetic information and the like, and particularly has lower breeding efficiency on characters which cannot be directly measured and have low heritability. Therefore, effectively improving the germplasm resources of the litopenaeus vannamei, and cultivating a new variety of the litopenaeus vannamei with stronger tolerance to high ammonia nitrogen is particularly important for the sustainable development of the shrimp farming industry.

The new generation of marker assisted breeding (MAS) allows breeding by directly selecting individuals as parents by means of genetic markers closely linked to traits. The genetic markers refer to substances or characters which are used for distinguishing different individuals or groups and can be stably inherited, and the common molecular markers comprise first generation molecular markers RFLP, RAPD, second generation SSR, AFLP, third generation molecular marker SNP and the like, wherein the third generation molecular marker SNP refers to the heritable variation of a single base at a specific position of a genome, the occurrence frequency of any allele in a population is higher than 1%, and the variation forms comprise conversion, transversion, insertion/deletion and the like. The SNP marker has the advantages of huge number, wide distribution, codominance, high stability, easy automatic scale analysis, capability of displaying hidden polymorphism which cannot be detected by other technologies and capability of being related to gene functions, and is widely applied to molecular marker assisted breeding. Nowadays, SNP molecular marker technology has been widely used in genetic breeding of litopenaeus vannamei, and has mostly focused on the research of some important functional genes of litopenaeus vannamei, including the traits of growth, propagation, resistance to low dissolved oxygen, resistance to high nitrite, resistance to vibrio parahaemolyticus, and the like. In addition, there are reports on SNP locus analysis of immune related genes of litopenaeus vannamei. But no related report of SNP molecular markers related to high ammonia nitrogen resistance of litopenaeus vannamei is found.

Disclosure of Invention

Aiming at the technical problems in the background art, the invention aims to provide an SNP marker related to the high ammonia nitrogen resistance of the litopenaeus vannamei, application thereof and a primer pair for detecting the SNP marker, so that useful information is provided for the correlation research of the high ammonia nitrogen resistance, and the genetic improvement of the high ammonia nitrogen resistance of the litopenaeus vannamei is facilitated.

The invention is realized by the following technical scheme:

in a first aspect, the invention provides an SNP marker related to the high ammonia nitrogen resistant property of Litopenaeus vannamei, wherein the SNP marker is an SNP molecular marker obtained by amplifying an OZF gene, the SNP marker is a nucleotide sequence shown as SEQ ID NO.1 in a sequence table, and the 364 th base from the 5' end is T or C.

In a second aspect, the invention provides a primer pair for detecting the SNP marker related to the high ammonia nitrogen tolerance of the litopenaeus vannamei, wherein the primer pair is specifically a primer OZF-FP and a primer OZF-RP, and is obtained by using a sequence of zinc finger protein (OZF) gene mRNA (GenBank Accession: NO. XM-027370330.1) of the litopenaeus vannamei as a template and designing by using Primier 5.0 software.

The nucleotide sequence of the primer pair is shown as SEQ ID NO.2 and SEQ ID NO. 3:

(1)SEQ ID NO.2：CCGATTGGATGCCTTTGGA；

(2)SEQ ID NO.3：TCGTGTGAAAGTATTGTTAC。

in a third aspect, the invention provides a kit comprising the primer pair, which is used for detecting the SNP molecular marker related to the high ammonia nitrogen tolerance of the litopenaeus vannamei.

In a fourth aspect, the invention provides an application of an SNP marker related to a high ammonia nitrogen resistance property of litopenaeus vannamei, and the application of the SNP marker related to the high ammonia nitrogen resistance property of the litopenaeus vannamei in screening the litopenaeus vannamei parent shrimp with the high ammonia nitrogen resistance property comprises the following steps:

in a fifth aspect, the invention provides a method for screening SNP molecular markers related to high ammonia nitrogen resistance of litopenaeus vannamei, which comprises the following steps:

(1) Taking the genomic DNA of the litopenaeus vannamei individuals subjected to the high ammonia nitrogen stress experiment as a template, and carrying out PCR amplification on the OZF-FP and the OZF-RP by using the primers to obtain an amplified fragment, wherein the length of the amplified fragment is 710bp;

(2) Sequencing the amplified fragment obtained in the step (1) to obtain an OZF gene partial sequence, carrying out BLAST comparison on the sequence result, and screening out a base mutation site, namely an SNP site;

(3) The correlation analysis is carried out on the high ammonia nitrogen tolerance and the genotype of the litopenaeus vannamei by using the Chi's test of SPSS 24.0 software.

The method for extracting genomic DNA described in the above step (1) is not particularly limited, and may be carried out by any known method or kit for extracting genomic DNA; the conditions for PCR amplification of genomic DNA are also not particularly limited, and the conditions for PCR amplification can be optimally selected by those skilled in the art.

Direct sequencing is a detection technology with highest accuracy, strong flexibility, large flux and short detection period. The method only needs to design a pair of primers at two sides of the SNP locus, amplify the obtained product, and directly detect the SNP locus through sequencing. Therefore, the present invention preferably employs a direct sequencing method for SNP marker detection.

The invention has the beneficial effects that:

(1) The invention provides a newly discovered SNP marker related to high ammonia nitrogen stress resistance, which is obtained by candidate SNP association analysis identification on the basis of the early genome wide association analysis (GWAS) result. Statistics shows that the high ammonia nitrogen tolerance of the litopenaeus vannamei with the genotype TT or TC at the site of the SNP marker is remarkably higher than that of the litopenaeus vannamei with the genotype homozygous CC, and the high ammonia nitrogen tolerance of the litopenaeus vannamei can be effectively determined by detecting the SNP site of the litopenaeus vannamei; the SNP marker disclosed by the invention is closely related to the high ammonia nitrogen resistance of the litopenaeus vannamei, and can be effectively used for molecular marker-assisted breeding of the litopenaeus vannamei.

(2) By adopting the technical scheme, the Litopenaeus vannamei breeding material can be selected in an early stage according to actual breeding requirements, the breeding efficiency and accuracy are effectively improved, the genetic level of the Litopenaeus vannamei breeding population is improved, and the Litopenaeus vannamei variety with strong stress resistance can be accurately and efficiently bred.

(3) The method has strong practicability, no specific requirements on the methods for extracting and sequencing the genome DNA and wide applicability.

Detailed Description

The following detailed description of the embodiments of the present disclosure is provided by way of specific examples, which are intended to describe the present disclosure in detail, but not to limit the present disclosure. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present description.

The SNP locus related to the high ammonia nitrogen resistance character of the litopenaeus vannamei provided by the invention can be applied to the breeding process of the high ammonia nitrogen resistance character of the litopenaeus vannamei, and particularly, in the selective breeding process of the litopenaeus vannamei, SNP locus typing is carried out on a breeding candidate group of the litopenaeus vannamei, and then the typing information of other loci related to the stress resistance character is combined, so that an individual with the SNP locus of TT genotype or TC genotype is preferentially selected as a breeding parent of the high ammonia nitrogen resistance litopenaeus vannamei to carry out large-scale breeding, and the condition that an individual of the litopenaeus vannamei with the SNP locus of CC genotype is selected as the breeding parent to carry out large-scale breeding is avoided.

Example 1

In the embodiment, through whole genome correlation analysis of the litopenaeus vannamei, 1 site related to high ammonia nitrogen character is excavated and located in a gene zinc finger protein OZF, C/T mutation occurs, and the high ammonia nitrogen resistance of the T/C genotype litopenaeus vannamei is slightly higher than that of a T/T genotype individual and is obviously higher than that of a C/C genotype individual.

The method for screening the SNP molecular marker related to the high ammonia nitrogen resistant property of the litopenaeus vannamei comprises the following steps:

1) And (3) performing PCR amplification on the OZF-FP and the OZF-RP by using the genomic DNA of the litopenaeus vannamei individuals subjected to the high ammonia nitrogen stress experiment as a template by using primers. The primer OZF-FP and the primer OZF-RP are obtained by using a zinc finger protein (OZF) gene mRNA (Gen Bank Accession: NO. XM-027370330.1) sequence of Litopenaeus vannamei as a template and designing by using Primier 5.0 software. Obtaining an amplified fragment, wherein the length of the amplified fragment is 710bp.

(1)SEQ ID NO.2：CCGATTGGATGCCTTTGGA；

(2)SEQ ID NO.3：TCGTGTGAAAGTATTGTTAC。

2) Sequencing the amplified fragment obtained in the step (1) to obtain an OZF gene partial sequence, carrying out BLAST comparison on the sequence result, and screening out a base mutation site, namely an SNP site. The SNP marker is a nucleotide sequence shown as SEQ ID NO.1 in a sequence table, wherein the 364 th base from the 5' end is T or C.

3) The correlation analysis is carried out on the high ammonia nitrogen tolerance and the genotype of the litopenaeus vannamei by using the Chi's test of SPSS 24.0 software.

The method comprises the following steps of carrying out correlation analysis on SNP site 364C > -T in the OZF gene of the litopenaeus vannamei and the high ammonia nitrogen tolerance:

(A) Preparation of Experimental samples

150 prawns are selected from different families and put into a test pool of 3 x 3m, after temporary rearing, high ammonia nitrogen stress test is carried out at a half-lethal concentration of 48 hours. Throughout the experiment, the stress water was changed and adjusted daily. The death condition is observed for 1 time per hour, the survival time of each prawn is recorded, and the muscle tissue of each prawn is cut and stored in absolute ethyl alcohol for subsequent DNA extraction experiments. The judgment standard of prawn death is that the prawn is considered dead if the prawn lies on the side and has no tactile reaction, and the high ammonia nitrogen stress experiment is continued until all prawns die.

(B) Litopenaeus vannamei genome DNA extraction

Clipping 25mg of preserved prawn muscle tissue, placing into a sterilized centrifuge tube, adding 200 μ l of GA buffer solution and 2 sterilized steel balls, and grinding for 2 minutes by using a tissue shaking grinder. After the completion of the grinding, 20. Mu.l of Proteinase K (Proteinase K,20 mg/ml) solution was added to the specimen, and the mixture was mixed by shaking every 20 minutes in a 56 ℃ water bath for 15s at intervals. 200 mul of buffer GB was added, mixed well by inversion and incubated in a water bath at 70 ℃ for 10min. Mu.l of RNase A (10 mg/ml) was added thereto and allowed to stand at room temperature for 5min. Adding 200 μ l of anhydrous ethanol, mixing thoroughly, sucking the solution into adsorption column, centrifuging at 12,000rpm for 30sec, discarding the waste liquid in the collection tube, and replacing the adsorption column in the collection tube. Add 500. Mu.l buffer GD to the adsorption column, centrifuge at 12000rpm for 30s, discard the waste liquid in the collection tube, and replace the adsorption column back in the collection tube. Adding 600 μ l of rinsing solution PW into the adsorption column, centrifuging at 12000rpm for 30s, discarding the waste liquid in the collection tube, and replacing the adsorption column into the collection tube. This step was repeated 1 time. The adsorption column was returned to the collection tube, centrifuged at 12000rpm for 2min, and the waste liquid in the collection tube was discarded. The column was opened and left at room temperature for 5 minutes. Placing the adsorption column in a sterilized centrifuge tube, adding 60 μ l of elution buffer TE to the middle part of the adsorption membrane, standing at room temperature for 5min, and centrifuging at 12000rpm for 2min. Sucking the solution in the centrifuge tube into the adsorption column again, standing at room temperature for 2min, centrifuging at 12000rpm for 2min, discarding the adsorption column, and keeping the centrifuge tube and the solution in the centrifuge tube to obtain the extracted DNA.

DNA integrity was analyzed by electrophoresis on a 1% agarose gel. The purity and concentration of the DNA solution were determined using a Nano Drop ND-2000 nucleic acid quantification apparatus. And storing the DNA sample qualified for detection in an environment at-20 ℃ for subsequent use. The standard of the qualified DNA is that an electrophoresis detection band is complete and single, no tailing phenomenon exists, the concentration of a sample is more than 50ng/ul, and the purity (OD 260/280) of the sample is in a range of 1.6-2.0.

(C) Screening SNP sites of an OZF gene of the litopenaeus vannamei and typing a sequence site 364C >;

obtaining a zinc finger protein OZF gene (Gen Bank accession NO. XM _ 027370330.1) sequence of the Litopenaeus vannamei in an NCBI website, and designing by Premier 5.0 software to obtain specific primer pairs OZF-FP and OZF-RP. The prawn genome DNA stressed by high ammonia nitrogen is used as a template, and the primer is used for amplification under the PCR condition. The PCR reaction system is 50 μ L:25 μ L of LREMix TaqTM (LATaqTM Version2.0, taKaRa), 17.5 μ L of deionized water, 2.5 μ L of forward primer, 2.5 μ L of reverse primer, and 2.5 μ L of genomic DNA template. The PCR amplification reaction procedure was as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 45s, and extension at 72 ℃ for 1min, with the above procedure being cycled 33 times; after extension at 72 ℃ for 10min, the PCR product was shipped under refrigeration to Guangzhou Biotechnology Ltd for sequencing.

(D) Correlation analysis of C > T genotype and high ammonia nitrogen resistance property

According to the sequencing result, the number and the average survival time of the litopenaeus vannamei of each genotype of the high ammonia nitrogen stress test 364C > -T site are counted, the relevance of the high ammonia nitrogen tolerance of the site 364C > -T and the litopenaeus vannamei is analyzed by using a Chi-square test method of SPSS19.0 software, and the counting result is shown in Table 1.

The results show that: at position 364C>In T, the distribution of 3 different genotypes of TT, TC and CC has obvious relevance with high ammonia nitrogen tolerance (chi) ² =9.414, p = 0.009). The genotype polymorphism of the site has obvious influence on the high ammonia nitrogen tolerance of the litopenaeus vannamei, and the high ammonia nitrogen tolerance of TT and TC genotype individuals is superior to that of CC genotypes. Site 364C is preferentially selected in the breeding and cultivation process>T is TT type or TC type, and 364C is avoided as much as possible>And the T site is an individual with CC type.

TABLE 1 correlation analysis results of OZF single nucleotide polymorphism of gene

Although the embodiments of the present description have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations may be made in these embodiments without departing from the principles and spirit of the description, the scope of which is defined in the appended claims and their equivalents.

Claims

1. An SNP marker related to high ammonia nitrogen tolerance of litopenaeus vannamei, which is characterized in that: the SNP marker is a nucleotide sequence shown as SEQ ID NO.1 in a sequence table, wherein the 364 th base from the 5' end is T or C.

2. A primer pair for detecting the SNP marker associated with high ammonia nitrogen tolerance of litopenaeus vannamei according to claim 1, characterized in that: the nucleotide sequence of the primer pair is shown as SEQ ID NO.2 and SEQ ID NO. 3:

(1)SEQ ID NO.2：CCGATTGGATGCCTTTGGA；

(2)SEQ ID NO.3：TCGTGTGAAAGTATTGTTAC。

3. a kit comprising the primer pair of claim 2, wherein the primer pair is used for detecting the SNP marker related to the high ammonia nitrogen tolerance of litopenaeus vannamei according to claim 1.

4. The application of the SNP marker related to the high ammonia nitrogen resistant trait of litopenaeus vannamei according to claim 1.

5. An application of SNP marker related to high ammonia nitrogen resistance of Litopenaeus vannamei in screening high ammonia nitrogen resistance Litopenaeus vannamei parent.

6. The method for screening the SNP marker related to the high ammonia nitrogen resistant property of litopenaeus vannamei according to claim 1, which is characterized in that: the method comprises the following steps:

(3) And (4) carrying out correlation analysis on the high ammonia nitrogen tolerance and the genotype of the litopenaeus vannamei by using a chi-square test of SPSS 24.0 software.