CN115721654B

CN115721654B - Application of veratrine in preparation of anti-coronavirus drugs

Info

Publication number: CN115721654B
Application number: CN202210791082.0A
Authority: CN
Inventors: 高祥; 孙柯; 吴俊�; 赵玉芬
Original assignee: Xiamen University
Current assignee: Xiamen University
Priority date: 2022-07-05
Filing date: 2022-07-05
Publication date: 2024-02-02
Anticipated expiration: 2042-07-05
Also published as: CN115721654A

Abstract

The invention provides application of veratrine in preparation of anti-coronavirus medicines, and belongs to the technical field of medicines. The experiment shows that veratrine can efficiently inhibit the combination of the novel coronavirus S protein and ACE2, inhibit the pseudovirus infected cells containing the novel coronavirus S protein and have low cytotoxicity, so the application of veratrine in preparing antiviral drugs is provided, and a new idea is provided for preventing and treating the novel coronavirus.

Description

Application of veratrine in preparation of anti-coronavirus drugs

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to application of veratrine in preparation of anti-coronavirus medicines.

Background

Coronaviruses belong to enveloped viruses with a positive single-stranded RNA genome. Coronaviruses are classified into four genera of alpha-CoVs, beta-CoVs, gamma-CoVs and delta-CoVs ^[1] . Severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) causes a respiratory disease called 2019 coronavirus disease (COVID-19), the transmission of which results in a pandemic, the most common clinical features include cough, fever and infectious pneumonia, severe cases presenting with acute respiratory distress syndrome, even death ^[2] . At present, no specific anti-novel coronavirus drug exists, and drug small molecules for specifically blocking the invasion of the novel coronavirus aiming at drug targets of the novel coronavirus are yet to be researched and developed.

At present, a plurality of novel crown drugs such as the viral RNA polymerase inhibitors RedeSivir, moralavir and the like, capable of inhibiting viral RNA replication as nucleoside analogues, have been marketed ^[3] The method comprises the steps of carrying out a first treatment on the surface of the Mi Feinuo the inhibition of membrane fusion of the viral envelope and the host cell plasma membrane by inhibiting clathrin-mediated endocytosis, prevents the virus from entering the host cell; nemactevir and ritonavir inhibit processing of viral RNA translated polyprotein by the primary protease 3CL protease of the novel coronavirus ^[4] . Antimalarial drugs chloroquine and hydroxychloroquine have been shown to inhibit terminal phosphorylation of ACE2 and raise pH in endosomes to inhibit membrane fusion, thereby preventing viral infection, and clinical trials are currently underway ^[5] 。

The spike glycoprotein of SARS-CoV-2 plays an important role in viral infectivityIs used. SARS-CoV-2 binds to the receptor angiotensin converting enzyme 2 (ACE 2) on host cells using the Receptor Binding Domain (RBD) of spike protein (S protein) which is probably a good target for preventing SARS-CoV-2 from entering host cells to infect host cells ^[6] Drug screening is carried out by taking S protein and ACE2 as targets, and new coronavirus infection is inhibited by blocking the combination of the S protein and the ACE2 ^[7] And the effect of inhibiting virus invasion is detected by adopting a cell experiment, so that the method is an important way for researching a novel coronavirus invasion inhibitor.

Natural products are an important source of antiviral drugs. At present, the literature reports that stephanine serving as a naturally-occurring plant alkaloid can target the invasion stage of a new coronavirus and obviously inhibit the combination of the virus and host cells ^[8] Has low toxicity in animals and no obvious side effect on human bodies. In addition, veratrine is a biological pesticide separated and extracted from plants, and has the effects of killing and stomach toxicity, and lowering blood pressure, tonifying heart, resisting thrombosis, improving brain circulation, resisting parasite infection, etc ^[9] . Veratrine has low toxicity to human and livestock, low residue, no environmental pollution and durable drug effect, and is a biological pesticide which is valued at present and has wide application prospect. However, antiviral reports of veratrine are not reported at present.

Reference to the literature

[1]Seyed Hosseini,E.；Riahi Kashani,N.；Nikzad,H.；Azadbakht,J.；Hassani Bafrani,H.；Haddad Kashani,H.The novel coronavirus Disease-2019(COVID-19):Mechanism of action,detection and recent therapeutic strategies.Virology 2020,551,1-9.DOI:10.1016/j.virol.2020.08.011.

[2]Samudrala,P.K.；Kumar,P.；Choudhary,K.；Thakur,N.；Wadekar,G.S.；Dayaramani,R.；Agrawal,M.；Alexander,A.Virology,pathogenesis,diagnosis and in-line treatment of COVID-19.Eur J Pharmacol 2020,883,173375.DOI:10.1016/j.ejphar.2020.173375From NLM Medline.

[3]Ohashi,H.；Watashi,K.；Saso,W.；Shionoya,K.；Iwanami,S.；Hirokawa,T.；Shirai,T.；Kanaya,S.；Ito,Y.；Kim,K.S.；et al.Potential anti-COVID-19agents,cepharanthine and nelfinavir,and their usage for combination treatment.iScience 2021,24(4),102367.DOI:10.1016/j.isci.2021.102367From NLM PubMed-not-MEDLINE.

[4]McKee,D.L.；Sternberg,A.；Stange,U.；Laufer,S.；Naujokat,C.Candidate drugs against SARS-CoV-2and COVID-19.Pharmacological Research 2020,157.DOI:10.1016/j.phrs.2020.104859.

[5]Wang,N.；Han,S.；Liu,R.；Meng,L.；He,H.；Zhang,Y.；Wang,C.；Lv,Y.；Wang,J.；Li,X.；et al.Chloroquine and hydroxychloroquine as ACE2blockers to inhibit viropexis of 2019-nCoV Spike pseudotyped virus.Phytomedicine 2020,79,153333.DOI:10.1016/j.phymed.2020.153333From NLM Medline.

[6]Ou,X.；Liu,Y.；Lei,X.；Li,P.；Mi,D.；Ren,L.；Guo,L.；Guo,R.；Chen,T.；Hu,J.；et al.Characterization of spike glycoprotein of SARS-CoV-2on virus entry and its immune cross-reactivity with SARS-CoV.Nat Commun 2020,11(1),1620.DOI:10.1038/s41467-020-15562-9From NLM Medline.

[7]Tai,W.；He,L.；Zhang,X.；Pu,J.；Voronin,D.；Jiang,S.；Zhou,Y.；Du,L.Characterization of the receptor-binding domain(RBD)of 2019novel coronavirus:implication for development of RBD protein as a viral attachment inhibitor and vaccine.Cell Mol Immunol 2020,17(6),613-620.DOI:10.1038/s41423-020-0400-4From NLM Medline.

[8]Fan,H.H.；Wang,L.Q.；Liu,W.L.；An,X.P.；Liu,Z.D.；He,X.Q.；Song,L.H.；Tong,Y.G.Repurposing of clinically approved drugs for treatment of coronavirus disease 2019in a 2019-novel coronavirus-related coronavirus model.Chin Med J(Engl)2020,133(9),1051-1056.DOI:10.1097/CM9.0000000000000797From NLM Medline.

[9]Kim,D.；Kwon,W.；Park,S.；Kim,W.；Park,J.K.；Han,J.E.；Cho,G.J.；Yun,S.；Han,S.H.；Kim,M.O.；et al.Anticancer effects ofveratramine via the phosphatidylinositol-3-kinase/serine-threonine kinase/mechanistic target of rapamycin and its downstream signaling pathways in human glioblastoma cell lines.Life Sci 2022,288,120170.DOI:10.1016/j.lfs.2021.120170From NLM Medline.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of veratrine in preparing anti-coronavirus drugs.

The invention provides application of veratrine or veratrine derivatives in preparation of anti-coronavirus medicines, wherein the structural formula of veratrine is shown in a formula I;

preferably, the veratrine derivative comprises veratrine hydrate or a salt form of veratrine.

Preferably, the salt form of veratrine comprises one or more of the following: veratrine acetate, veratrine formate, veratrine hydrochloride, veratrine phosphate and veratrine sulfate.

The invention provides an application of an inhibitor for blocking the combination of coronavirus S protein and ACE2 in preparing an anti-coronavirus medicament, wherein the inhibitor is veratrine or veratrine derivative, and the structural formula of veratrine is shown in a formula I;

preferably, the veratrine or veratrine derivative is combined with one or more of papain, pseudo papain, dehydropapain I and dehydropapain II for preparing the anti-coronavirus medicament.

Preferably, the coronavirus comprises the novel coronavirus SARS-COV-2.

Preferably, the anti-coronavirus comprises preventing coronavirus infection.

The invention provides an antiviral drug, which takes veratrine or veratrine derivatives as active ingredients and medically acceptable auxiliary materials;

the structural formula of veratrine is shown in formula I;

preferably, the active ingredient further comprises one or more of papain, pseudopapain, dehydropapain I and dehydropapain II.

The invention provides application of veratrine or veratrine derivatives in preparation of anti-coronavirus medicines. The invention constructs a novel coronavirus screening model to obtain novel coronavirus with S protein wrapping reporter gene Luciferase or GFP, and constructs A549 cell strain for stably expressing ACE2 protein as host cell. The invention adopts novel coronavirus to infect 549-ACE2 cell strain and simulate the virus infection process, and can effectively block the combination of S protein and ACE2 by adding veratrine, thereby blocking the infection of pseudovirus to host cells. Experimental results show that the compound veratrine has the capability of inhibiting the infection cells of the novel coronavirus and IC ₅₀ 4.46. Mu. Mol/L. Meanwhile, cytotoxicity experiments show that veratrine acts on IC of A549-ACE2 cells ₅₀ The value is 18.68 mu mol/L, and the cell administration safety is realized.

Drawings

FIG. 1 is a graph showing the statistical rate of infection of A549-ACE2 cells with novel coronaviruses with veratrine at various concentrations in example 1;

FIG. 2 is a graph showing the statistical inhibition of the novel coronavirus-infected A549-ACE2 cells by veratrine at various concentrations in example 1;

FIG. 3 shows the results of the toxic effects of veratrine at various concentrations on A549-ACE2 cells in example 2;

FIG. 4 is a graph showing the statistical rate of infection of A549-ACE2 cells with novel coronavirus at various concentrations with papain, a compound of example 3;

FIG. 5 is a graph showing the statistical inhibition of novel coronavirus infected A549-ACE2 cells by papain at various concentrations as the compound of example 3;

FIG. 6 shows the results of the toxic effects of veratrine at various concentrations on A549-ACE2 cells in example 4.

Detailed Description

in the present invention, veratrine (CAS number 8051-02-3) has a molecular formula of C ₃₆ H ₅₁ NO ₁₁ The molecular weight is 673.8. In the embodiment of the invention, the veratrine is purchased from the company of the Cinnamomum biological technology, inc. of Baobao, shanxi province.

In the present invention, the veratrine derivative preferably comprises a salt form of veratrine. The salt form of veratrine preferably comprises one or more of the following: veratrine acetate, veratrine formate, veratrine hydrochloride, veratrine phosphate and veratrine sulfate. The preparation method of the salt form of veratrine is not particularly limited, and the preparation method of the salt form of alkaloid known in the art can be adopted. The preparation method of the veratrine hydrate is not particularly limited, and the preparation method of the hydrate of the compound known in the art can be adopted.

In the present invention, the anti-coronavirus preferably includes prevention of coronavirus infection. The coronavirus preferably comprises the novel coronavirus SARS-COV-2. In an embodiment of the invention, at the cellular level, the veratrine is IC to a novel coronavirus ₅₀ 4.46. Mu. Mol/L. Cytotoxicity experiments show that the IC50 value of veratrine action A549-ACE2 cells is 18.68 mu mol/L.

In the invention, experiments prove that papain (Carpaine), pseudopapain (pseudopapaine), dehydropapain I (Dehydrocarpaine I) and dehydropapain II (Dehydrocarpaine II) (the structural formulas are shown as follows) have the capability of blocking and blocking the combination of coronavirus S protein and ACE2, and inhibit new drugsCoronavirus activity IC ₅₀ Sequentially 5.48 mu mol/L, 8.21 mu mol/L, 24.3 mu mol/L and 30.65 mu mol/L. Therefore, the veratrine or veratrine derivative is preferably used in combination with one or more of papain, pseudo papain, dehydropapain I and dehydropapain II for preparing the anti-coronavirus medicament.

In view of the fact that veratrine achieves an antiviral effect by blocking the combination of coronavirus S protein and ACE2, the invention provides application of an inhibitor for blocking the combination of coronavirus S protein and ACE2 in preparation of medicines for resisting coronaviruses, wherein the inhibitor is veratrine or veratrine derivatives, and the structural formula of veratrine is shown as formula I;

the invention provides an antiviral drug, which takes veratrine or veratrine derivatives as active ingredients and medically acceptable auxiliary materials; the structural formula of veratrine is shown in formula I;

in the present invention, the active ingredient preferably further comprises one or more of papaverine, pseudopapaverine, dehydropapaverine I and dehydropapaverine II.

In the invention, the dosage form of the medicine comprises one or more of the following components: injections, tablets, pills, capsules, suspensions and emulsions. The medicament also comprises pharmaceutically acceptable auxiliary materials. The auxiliary materials comprise one or more of the following components: diluents, disintegrants, fillers, binders, absorption promoters, surfactants, adsorption carriers, lubricants and synergists. The medicament is administered by oral, transdermal, intravenous or intramuscular injection.

The application of veratrine provided by the invention in preparing anti-coronavirus drugs is described in detail below with reference to examples, but they should not be construed as limiting the scope of the invention.

Description of experimental materials:

a new coronavirus screening model is established, and a lentivirus packaging system (pCMVdelta 8.2+pCMV3-SARS-Cov-2-S+pBOB-Luciferase/GFP) is used in 293T cells to obtain the new coronavirus with S protein for wrapping a reporter gene Luciferase or GFP. Wherein the coding sequence of the S protein is shown as SEQ ID NO. 1 (atgtttgtgttcctggtgctgctgccactggtgtccagccagtgtgtgaacctgaccaccaggacccaacttcctcctgcctacaccaactccttcaccaggggagtctactaccctgacaaggtgttcaggtcctctgtgctgcacagcacccaggacctgttcctgccattcttcagcaatgtgacctggttccatgccatccatgtgtctggcaccaatggcaccaagaggtttgacaaccctgtgctgccattcaatgatggagtctactttgccagcacagagaagagcaacatcatcaggggctggatttttggcaccaccctggacagcaagacccagtccctgctgattgtgaacaatgccaccaatgtggtgattaaggtgtgtgagttccagttctgtaatgacccattcctgggagtctactaccacaagaacaacaagtcctggatggagtctgagttcagggtctactcctctgccaacaactgtacctttgaatatgtgagccaaccattcctgatggacttggagggcaagcagggcaacttcaagaacctgagggagtttgtgttcaagaacattgatggctacttcaagatttacagcaaacacacaccaatcaacctggtgagggacctgccacagggcttctctgccttggaaccactggtggacctgccaattggcatcaacatcaccaggttccagaccctgctggctctgcacaggtcctacctgacacctggagactcctcctctggctggacagcaggagcagcagcctactatgtgggctacctccaaccaaggaccttcctgctgaaatacaatgagaatggcaccatcacagatgctgtggactgtgccctggacccactgtctgagaccaagtgtaccctgaaatccttcacagtggagaagggcatctaccagaccagcaacttcagggtccaaccaacagagagcattgtgaggtttccaaacatcaccaacctgtgtccatttggagaggtgttcaatgccaccaggtttgcctctgtctatgcctggaacaggaagaggattagcaactgtgtggctgactactctgtgctctacaactctgcctccttcagcaccttcaagtgttatggagtgagcccaaccaaactgaatgacctgtgtttcaccaatgtctatgctgactcctttgtgattaggggagatgaggtgagacagattgcccctggacaaacaggcaagattgctgactacaactacaaactgcctgatgacttcacaggctgtgtgattgcctggaacagcaacaacctggacagcaaggtgggaggcaactacaactacctctacagactgttcaggaagagcaacctgaaaccatttgagagggacatcagcacagagatttaccaggctggcagcacaccatgtaatggagtggagggcttcaactgttactttccactccaatcctatggcttccaaccaaccaatggagtgggctaccaaccatacagggtggtggtgctgtcctttgaactgctccatgcccctgccacagtgtgtggaccaaagaagagcaccaacctggtgaagaacaagtgtgtgaacttcaacttcaatggactgacaggcacaggagtgctgacagagagcaacaagaagttcctgccattccaacagtttggcagggacattgctgacaccacagatgctgtgagggacccacagaccttggagattctggacatcacaccatgttcctttggaggagtgtctgtgattacacctggcaccaacaccagcaaccaggtggctgtgctctaccaggatgtgaactgtactgaggtgcctgtggctatccatgctgaccaacttacaccaacctggagggtctacagcacaggcagcaatgtgttccagaccagggctggctgtctgattggagcagagcatgtgaacaactcctatgagtgtgacatcccaattggagcaggcatctgtgcctcctaccagacccagaccaacagcccaaggagggcaaggtctgtggcaagccagagcatcattgcctacacaatgagtctgggagcagagaactctgtggcttacagcaacaacagcattgccatcccaaccaacttcaccatctctgtgaccacagagattctgcctgtgagtatgaccaagacctctgtggactgtacaatgtatatctgtggagacagcacagagtgtagcaacctgctgctccaatatggctccttctgtacccaacttaacagggctctgacaggcattgctgtggaacaggacaagaacacccaggaggtgtttgcccaggtgaagcagatttacaagacacctccaatcaaggactttggaggcttcaacttcagccagattctgcctgacccaagcaagccaagcaagaggtccttcattgaggacctgctgttcaacaaggtgaccctggctgatgctggcttcatcaagcaatatggagactgtctgggagacattgctgccagggacctgatttgtgcccagaagttcaatggactgacagtgctgcctccactgctgacagatgagatgattgcccaatacacctctgccctgctggctggcaccatcacctctggctggacctttggagcaggagcagccctccaaatcccatttgctatgcagatggcttacaggttcaatggcattggagtgacccagaatgtgctctatgagaaccagaaactgattgccaaccagttcaactctgccattggcaagattcaggactccctgtccagcacagcctctgccctgggcaaactccaagatgtggtgaaccagaatgcccaggctctgaacaccctggtgaagcaactttccagcaactttggagccatctcctctgtgctgaatgacatcctgagcagactggacaaggtggaggctgaggtccagattgacagactgattacaggcagactccaatccctccaaacctatgtgacccaacaacttatcagggctgctgagattagggcatctgccaacctggctgccaccaagatgagtgagtgtgtgctgggacaaagcaagagggtggacttctgtggcaagggctaccacctgatgagttttccacagtctgcccctcatggagtggtgttcctgcatgtgacctatgtgcctgcccaggagaagaacttcaccacagcccctgccatctgccatgatggcaaggctcactttccaagggagggagtgtttgtgagcaatggcacccactggtttgtgacccagaggaacttctatgaaccacagattatcaccacagacaacacctttgtgtctggcaactgtgatgtggtgattggcattgtgaacaacacagtctatgacccactccaacctgaactggactccttcaaggaggaactggacaaatacttcaagaaccacaccagccctgatgtggacctgggagacatctctggcatcaatgcctctgtggtgaacatccagaaggagattgacagactgaatgaggtggctaagaacctgaatgagtccctgattgacctccaagaactgggcaaatatgaacaatacatcaagtggccatggtacatctggctgggcttcattgctggactgattgccattgtgatggtgaccataatgctgtgttgtatgacctcctgttgttcctgtctgaaaggctgttgttcctgtggctcctgttgtaagtttgatgaggatgactctgaacctgtgctgaaaggagtgaaactgcactacacctga); specific construction methods are described in the references (huj, gao q, he c, huang a, tan N, wang K.development of cell-based pseudovirus entry assay to identify potential viral entry inhibitors and neutralizing antibodies against SARS-CoV-2.Genes Dis.2020Dec;7 (4): 551-557.doi:10.1016/j.gendis.2020.07.006.Epub 2020Jul 17.PMID:32837985;PMCID:PMC7366953.Ma H,Zhu Z,Lin H,Wang S,Zhang P,Li Y,Li L,Wang J,Zhao Y,Han J.Pyroptosis of syncytia formed by fusion of SARS-CoV-2spike and ACE2-expression cells cell discover.2021 Aug 24;7 (1): 73.doi:10.1038/s41421-021-00310-0.PMID:34429403; PMCID: PMC 8384103.). A kind of electronic device: 293T cells were plated into six well plates on the first day to ensure that the cell density was about 90% when the virus was packaged the next day, the virus packaging system was as follows, the amount of DNA per well: pCMV delta 8.2 mug, pCMV 3-SARS-Cov-2-S0.5 mug, pBOB-Luciferase/GFP 2 mug, mixing with 50 mug of DMEM medium without serum and antibiotics, mixing 3 times PEI with 50 mug of DMEM medium without serum and antibiotics, mixing DNA tube and PEI tube evenly, standing for 25min, adding 293T cell of DMEM replaced by 5% serum, culturing in incubator for 8h, culturing in 30% serum medium with antibiotics continuously, filtering with 0.45um filter for 36h to obtain virus liquid, and storing in refrigerator at-80 ℃.

Example 1

Inhibition effect of veratrine compound on novel coronavirus infected A549-ACE2 cells at different concentrations

1 Experimental method

A549-ACE2 cells in logarithmic growth phase were digested from a culture dish 10cm in diameter and diluted to 10 with DMEM complete medium containing 10% fetal bovine serum according to cell density ⁵ The cells are uniformly mixed and inoculated into a 96-well plate, 100 mu L of the cell suspension is added into each well, and the mixture is put into 37 ℃ and 5 percent CO ₂ Is cultured in a cell culture incubator.

The novel crown-fake virus liquid with higher safety formed by S protein wrapping reporter gene Luciferase is obtained by using a lentivirus packaging system in 293T cells.

A549-ACE2 cells are inoculated on a 96-well plate, and after 24 hours, the medicines are added, and virus infection is carried out simultaneously, and the virus liquid and the culture medium are used for preparing the culture medium with the following weight ratio of 2:3, mixing to obtain a pseudo-virus solution, diluting veratrine with a mixed solution of a culture medium and a virus solution to a concentration of 0.2 mu M, 0.5 mu M, 1 mu M, 2 mu M, 5 mu M and 10 mu M, setting a blank group (culture medium), a negative control group (DMSO) and a positive control group (cepharanthine Ceph and chloroquine CQ) in each well of 100 mu L, and detecting fluorescence emission values at 492nm by using a fluorescence microplate reader after drug adding infection for 72 hours.

The fluorescence intensity values of each group are counted, the GraphPad Prism8 software is used, the inhibitor concentration is taken as an abscissa, the corresponding infection rate is taken as an ordinate, the result is shown in figure 1, the logarithmic value of the inhibitor concentration is taken as an abscissa, the corresponding infection rate inhibition is taken as an ordinate, the result is shown in figure 2, the inhibition capability of the compound veratrine on the novel coronavirus can be obtained, and the IC ₅₀ 4.46. Mu. Mol/L.

Example 2

Toxic effects of veratrine on A549-ACE2 cells

1 Experimental method

1.1A 549-ACE2 cells in logarithmic growth phase were digested from a culture dish 10cm in diameter and diluted to 10 ⁵ Individual/mL cell suspension is uniformly mixed and inoculated into a 96-well plate, 100 mu L volume of each well is put into 37 ℃ and 5 percent CO is added ₂ Is cultured in a cell culture incubator.

1.2 cell administration

Veratrine is dissolved in DMSO at a stock solution concentration of 10mM, and then further diluted in DMEM medium to a concentration of 1. Mu.M, 2. Mu.M, 5. Mu.M, 10. Mu.M, 20. Mu.M, 50. Mu.M, 100. Mu.L is added to each well of a 96-well plate, 3 parallel wells are arranged for each dose group, a blank group and a control group are simultaneously arranged, and the wells are placed in an incubator for culture, and cytotoxicity detection is performed 48 hours after the addition of the drugs.

1.3MTT detection of cytotoxicity of veratrine

1. After the medicines are treated for 48 hours respectively, the culture medium is discarded, 10 mu LMTT solution is added into each hole, after the culture medium is incubated for 4 hours in an incubator, the culture solution in each hole is discarded, 100 mu L of DMSO is added into each hole, the culture medium is shaken by a shaking table for 10 minutes to fully dissolve formazan crystals, and an OD value is measured at 490nm by an enzyme-labeled instrument.

2. The microplate reader reads the absorbance at 490nm (OD ₄₉₀ ). The ratio of cell survival of the experimental group (i.e., the dosing group) to the control group was calculated.

Calculation of cell viability using GraphPad Prism8 as shown in equation a and IC ₅₀ A value;

cell viability (%) = (experimental OD-blank OD)/(control OD-blank OD) ×100%

Formula A

The results are shown in FIG. 3, which shows that veratrine acts on IC of A549-ACE2 cells ₅₀ The value was 18.68. Mu. Mol/L.

Example 3

Inhibition of novel coronavirus infection A549-ACE2 cells by papain, pseudopapain, dehydropapain I or dehydropapain II at different concentrations

1 Experimental method

After the logarithmic phase of A549-ACE2 cells were digested from a culture dish having a diameter of 10cm, they were diluted to 10 with DMEM complete medium containing 10% fetal bovine serum according to cell density ⁵ Cell suspension of each mL, the cells were mixed well and inoculated into 96-well plates, 100. Mu.l each well was addedL cell suspension, adding PBS buffer solution with the same volume into the peripheral holes, gently beating the periphery of the culture plate to uniformly distribute cells, and placing into 37 ℃ and 5% CO after the cells are precipitated at the bottom of the culture plate ₂ Is cultured in a cell culture incubator.

A549-ACE2 cells are inoculated on a 96-well plate, and after 24 hours, the medicines are added, and virus infection is carried out simultaneously, and virus liquid and a culture medium are mixed according to a ratio of 2:3, mixing to obtain a pseudo-virus solution, diluting papain, pseudo papain, dehydropapain I or dehydropapain II with a mixture of a culture medium and a virus solution to a concentration of 0.2 mu M, 0.5 mu M, 1 mu M, 2 mu M, 5 mu M and 10 mu M, and setting a blank group (culture medium), a negative control group (DMSO) and a positive control group (cepharanthine and chloroquine CQ) at 100 mu L per hole, and detecting fluorescence emission values at 492nm by using a fluorescence microplate reader after drug-adding infection for 72 hours.

Counting the fluorescence intensity values of each group, and using GraphPad Prism8 software, wherein the inhibitor concentration is taken as an abscissa, and the corresponding infection rate is taken as an ordinate, and the result is shown in fig. 4; the plotted values of inhibitor concentration are plotted on the abscissa, and the corresponding inhibition infection rate is plotted on the ordinate, and the results are shown in fig. 5. The inhibitory capacity of each compound against novel coronavirus is shown in table 1.

TABLE 1 papain and analogs thereof to inhibit New coronavirus Activity

Numbering device	Compounds of formula (I)	Inhibition of novel coronavirus activity (IC) ₅₀ )
			1	Papaya alkali	5.48μmol/L
2	Pseudo papaya alkali	8.21μmol/L
			3	Dehydropapain I	24.3μmol/L
4	Dehydropapain II	30.65μmol/L

Example 4

Toxic Effect of papain on A549-ACE2 cells

1 Experimental method

1.1 digestion of logarithmic phase A549-ACE2 cells from a Petri dish 10cm in diameter, mixing well the cell suspension diluted to 105 cells/mL, inoculating into 96-well plates, 100 μl volume per well, placing into 37℃C, 5% CO ₂ Is cultured in a cell culture incubator.

1.2 cell administration

Papain was dissolved in DMSO at a stock concentration of 10mM, and then further diluted with DMEM medium to a concentration of 1 μΜ,2 μΜ,5 μΜ, 10 μΜ, 20 μΜ, 50 μΜ, 100 μΜ in 96 well plates with 100 μl added to each well, 3 parallel wells per dose group, blank and control groups were simultaneously placed, and incubated in an incubator for 48h post-dosing for cytotoxicity detection.

1.3MTT detection of cytotoxicity of papain

Cell viability and IC50 values were calculated using GraphPad Prism8, cell viability = (experimental OD-blank OD)/(control OD-blank OD) ×100%.

The results are shown in FIG. 6, which shows the IC of papain acting A549-ACE2 cells ₅₀ The value was 35.08. Mu. Mol/L.

In conclusion, veratrine can inhibit the combination of the novel coronavirus S protein and ACE2 with high efficiency, inhibit pseudovirus infected cells containing the novel coronavirus S protein and have low cytotoxicity, so that veratrine can be used for preventing and/or treating the infection of the novel coronavirus, and further can be used for preparing medicines for preventing and/or treating the infection of the novel coronavirus. Meanwhile, the compounds papain, pseudo papain, dehydropapain I or dehydropapain II have the capability of inhibiting the combination of the novel coronavirus S protein and ACE2 to different degrees, so that the compounds can be combined with veratrine to play an anti-novel coronavirus role as an active ingredient, and simultaneously, the anti-coronavirus medicine is prepared.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. The application of veratrine or veratrine derivatives in preparing anti-coronavirus medicines is provided, wherein the structural formula of veratrine is shown in formula I;

i is a kind of

The veratrine derivative is veratrine hydrate or veratrine salt form;

the coronavirus is novel coronavirus SARS-COV-2.

2. The use according to claim 1, wherein the salt form of veratrine is one or more of the following: veratrine acetate, veratrine formate, veratrine hydrochloride, veratrine phosphate and veratrine sulfate.

3. The use of claim 1, wherein said anti-coronavirus comprises preventing coronavirus infection.