CN115717155A - Recombinant expression vector for detecting replication-competent virus and application thereof - Google Patents
Recombinant expression vector for detecting replication-competent virus and application thereof Download PDFInfo
- Publication number
- CN115717155A CN115717155A CN202210891936.2A CN202210891936A CN115717155A CN 115717155 A CN115717155 A CN 115717155A CN 202210891936 A CN202210891936 A CN 202210891936A CN 115717155 A CN115717155 A CN 115717155A
- Authority
- CN
- China
- Prior art keywords
- replication
- virus
- expression vector
- recombinant expression
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241001068263 Replication competent viruses Species 0.000 title claims abstract description 39
- 239000013604 expression vector Substances 0.000 title claims abstract description 33
- 238000003259 recombinant expression Methods 0.000 title claims abstract description 32
- 238000001514 detection method Methods 0.000 claims abstract description 67
- 241000700605 Viruses Species 0.000 claims abstract description 60
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 33
- 239000013598 vector Substances 0.000 claims abstract description 13
- 108091006027 G proteins Proteins 0.000 claims abstract description 8
- 102000030782 GTP binding Human genes 0.000 claims abstract description 8
- 108091000058 GTP-Binding Proteins 0.000 claims abstract description 8
- 108091006047 fluorescent proteins Proteins 0.000 claims abstract description 8
- 102000034287 fluorescent proteins Human genes 0.000 claims abstract description 8
- 208000000440 Herpetic Stomatitis Diseases 0.000 claims abstract description 7
- 206010067152 Oral herpes Diseases 0.000 claims abstract description 7
- 239000000523 sample Substances 0.000 claims description 28
- 238000000034 method Methods 0.000 claims description 26
- 239000013612 plasmid Substances 0.000 claims description 24
- 239000013641 positive control Substances 0.000 claims description 18
- 239000005090 green fluorescent protein Substances 0.000 claims description 16
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 10
- 150000007523 nucleic acids Chemical group 0.000 claims description 10
- 239000013603 viral vector Substances 0.000 claims description 7
- 108010043121 Green Fluorescent Proteins Proteins 0.000 claims description 6
- 102000004144 Green Fluorescent Proteins Human genes 0.000 claims description 6
- 108091005948 blue fluorescent proteins Proteins 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 4
- 108010054624 red fluorescent protein Proteins 0.000 claims description 4
- 108091005957 yellow fluorescent proteins Proteins 0.000 claims description 4
- 238000003556 assay Methods 0.000 claims description 3
- 241001529453 unidentified herpesvirus Species 0.000 claims 1
- 230000010076 replication Effects 0.000 abstract description 7
- 230000002349 favourable effect Effects 0.000 abstract description 4
- 239000013558 reference substance Substances 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 4
- 210000004027 cell Anatomy 0.000 description 55
- 102100033260 2'-deoxynucleoside 5'-phosphate N-hydrolase 1 Human genes 0.000 description 27
- 239000007788 liquid Substances 0.000 description 21
- 238000001179 sorption measurement Methods 0.000 description 21
- 239000000047 product Substances 0.000 description 18
- 239000006228 supernatant Substances 0.000 description 15
- 239000000243 solution Substances 0.000 description 13
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 12
- 238000002156 mixing Methods 0.000 description 12
- 238000012360 testing method Methods 0.000 description 12
- 108700001624 vesicular stomatitis virus G Proteins 0.000 description 12
- 239000012634 fragment Substances 0.000 description 11
- 230000003321 amplification Effects 0.000 description 10
- 108010048367 enhanced green fluorescent protein Proteins 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 10
- 239000002244 precipitate Substances 0.000 description 10
- 239000002699 waste material Substances 0.000 description 10
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 9
- 238000010790 dilution Methods 0.000 description 8
- 239000012895 dilution Substances 0.000 description 8
- 239000000203 mixture Substances 0.000 description 8
- 238000002965 ELISA Methods 0.000 description 7
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 7
- 238000006243 chemical reaction Methods 0.000 description 6
- 238000011529 RT qPCR Methods 0.000 description 5
- 238000001035 drying Methods 0.000 description 5
- 239000002609 medium Substances 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 241000725303 Human immunodeficiency virus Species 0.000 description 4
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 4
- 238000004113 cell culture Methods 0.000 description 4
- 239000012228 culture supernatant Substances 0.000 description 4
- 239000003085 diluting agent Substances 0.000 description 4
- 230000010355 oscillation Effects 0.000 description 4
- 238000004806 packaging method and process Methods 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 3
- 102100034349 Integrase Human genes 0.000 description 3
- 241000713666 Lentivirus Species 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- 210000001744 T-lymphocyte Anatomy 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 239000007853 buffer solution Substances 0.000 description 3
- 238000005520 cutting process Methods 0.000 description 3
- 239000000706 filtrate Substances 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 239000002184 metal Substances 0.000 description 3
- 229910052751 metal Inorganic materials 0.000 description 3
- 238000007789 sealing Methods 0.000 description 3
- 238000001890 transfection Methods 0.000 description 3
- 238000012546 transfer Methods 0.000 description 3
- 239000006144 Dulbecco’s modified Eagle's medium Substances 0.000 description 2
- 241001663880 Gammaretrovirus Species 0.000 description 2
- 241000713772 Human immunodeficiency virus 1 Species 0.000 description 2
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 238000002835 absorbance Methods 0.000 description 2
- 239000002250 absorbent Substances 0.000 description 2
- 230000002745 absorbent Effects 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 210000004369 blood Anatomy 0.000 description 2
- 239000008280 blood Substances 0.000 description 2
- 229940121657 clinical drug Drugs 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 238000003255 drug test Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 235000019441 ethanol Nutrition 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000006260 foam Substances 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 239000003292 glue Substances 0.000 description 2
- 238000000338 in vitro Methods 0.000 description 2
- 238000012423 maintenance Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 239000012528 membrane Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 230000006798 recombination Effects 0.000 description 2
- 238000005215 recombination Methods 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 230000001131 transforming effect Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 102100024222 B-lymphocyte antigen CD19 Human genes 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 101710091045 Envelope protein Proteins 0.000 description 1
- 101710177291 Gag polyprotein Proteins 0.000 description 1
- 101000980825 Homo sapiens B-lymphocyte antigen CD19 Proteins 0.000 description 1
- 102000003960 Ligases Human genes 0.000 description 1
- 108090000364 Ligases Proteins 0.000 description 1
- 101710125418 Major capsid protein Proteins 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 101710188315 Protein X Proteins 0.000 description 1
- 102000018120 Recombinases Human genes 0.000 description 1
- 108010091086 Recombinases Proteins 0.000 description 1
- 241001052560 Thallis Species 0.000 description 1
- 239000007984 Tris EDTA buffer Substances 0.000 description 1
- 235000009754 Vitis X bourquina Nutrition 0.000 description 1
- 235000012333 Vitis X labruscana Nutrition 0.000 description 1
- 240000006365 Vitis vinifera Species 0.000 description 1
- 235000014787 Vitis vinifera Nutrition 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 210000000577 adipose tissue Anatomy 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 230000002238 attenuated effect Effects 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 210000001185 bone marrow Anatomy 0.000 description 1
- 210000005252 bulbus oculi Anatomy 0.000 description 1
- 230000030833 cell death Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000005138 cryopreservation Methods 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 210000003074 dental pulp Anatomy 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 210000000981 epithelium Anatomy 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 238000001215 fluorescent labelling Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 108700004026 gag Genes Proteins 0.000 description 1
- 101150098622 gag gene Proteins 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 238000009169 immunotherapy Methods 0.000 description 1
- 230000000977 initiatory effect Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 239000003607 modifier Substances 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 210000002826 placenta Anatomy 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 230000001172 regenerating effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000012487 rinsing solution Substances 0.000 description 1
- 239000012488 sample solution Substances 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 210000001082 somatic cell Anatomy 0.000 description 1
- 210000000130 stem cell Anatomy 0.000 description 1
- 239000012089 stop solution Substances 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000001502 supplementing effect Effects 0.000 description 1
- 238000010361 transduction Methods 0.000 description 1
- 230000026683 transduction Effects 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 210000003954 umbilical cord Anatomy 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant expression vector for detecting replication-competent viruses and application thereof. The recombinant expression vector comprises a virus vector containing a coding gene of a fluorescent protein and a partial coding gene of herpetic stomatitis virus G protein. The recombinant expression vector with a specific structure for detecting the replication type virus is designed, is favorable for quick detection, can be further used for preparing the replication type virus to serve as a positive reference substance for RCL detection, is favorable for improving the detection efficiency, the sensitivity, the accuracy and the convenience, can be suitable for various detection methods, and has more reliable detection results and higher safety.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a recombinant expression vector for detecting replication-competent viruses and application thereof.
Background
In recent years, clinical research on tumor immunotherapy and regenerative medicine products is being intensively carried out, and a plurality of CAR-T/TCR-T cell products and stem cell/somatic cell products report clinical drug tests, wherein the clinical drug tests relate to various cell types, and the tissue sources comprise blood, epithelial tissue, bone marrow, adipose tissue, muscle tissue, eyeball, umbilical cord, placenta, dental pulp and the like.
The CAR-T cell production process mainly involves peripheral blood isolation of the patient, activation and enrichment of T cells, transfer of CAR into T cells, in vitro expansion of CAR-T cells, and finally formulation. Because the transduction efficiency is high, the expression of a target gene is stable, the duration is long, lentiviruses and gamma-retroviruses become the most common expression vectors applied in the process of transferring CAR coding genes into T cells at present, and the generation of replication-competent viruses (RCLs) is the most serious risk factor in the production and application processes of lentiviruses and gamma-retroviruses, so far, no report of detecting the RCLs exists in lentivirus vectors and related cell products which are applied to human bodies, and theoretically, the probability of the occurrence of the RCLs is reduced by adopting a virus packaging system at present, but the RCLs cannot be completely eliminated, so that the RCLs still serve as important safety risk concerns.
Based on the mechanism of RCL production, a variety of markers have been discovered that may be indicative of RCL. For example, the homology between the gag initiation region sequences of the packaging plasmid and the transfer plasmid is high, and thus RCL may be produced by recombination between the two plasmids; in addition, the amplified RCL with VSV-G as envelope protein may migrate the VSV-G sequence into the genome of the indicator cell (see: satry, L., et al, verification assays for HIV-1-based vectors: front pass of gag sequences with out evaluation of replication-compliant viruses, 2003.8 (5): p.830-9.), the presence of a replication-competent virus having reverse transcriptase activity, the detection of PERT (Product enhanced reverse transcription) may also indicate RCL, but it is necessary to consider the case where the indicator cell expresses reverse transcriptase itself (see: satry, L., et al, product-enhanced reverse transcription), the presence of a Gene encoding VSV-G sequence for replication-dependent virus, and the general expression of the Gene encoding VSV sequence 122psi, and the general expression of the Gene encoding VSV-G, 1227-15-psi, and the general expression of the promoter sequence of the promoter, 12212-modified reverse transcription-modifier, and the sequence of the promoter, which is reflected in the present case of the genes indicated by RCL, SEQ ID No. 7-15, and SEQ ID No. 7-15, 7-15.
For clinical-grade lentiviral vectors, cell culture methods and direct qPCR methods are commonly used for detection. FDA guidelines require that, assuming a clinical dose of 1 RCL in a patient, the corresponding test sample size of the viral supernatant should ensure at least 95% detection probability. The direct qPCR method is used for detecting RCL marker sequences (psi-gag, VSV-G) in a sample to be detected through RT-PCR amplification, does not relate to the amplification process of RCL in cells, is short in time consumption, and is relatively simple and convenient in detection method, but the method has obvious defects, and false positive results are caused by the pollution of residual plasmid DNA in virus vectors packaged in vitro. In addition, the mechanism for generating RCL by recombination is complex, and due to the diversity of virus packaging systems, the generated RCL may not have sequences matched with PCR primers, so that false negative results are difficult to avoid.
Cell culture method for RCL detection, the test substance is incubated with a cell line susceptible to HIV-1 and capable of amplifying the virus in large amounts (usually C8166), the cells are passaged more than 5 times, and cultured for at least 3 weeks (amplification phase). Culture supernatants were collected after 3 weeks and inoculated into wild type C8166 cells for 7 days before detection of RCL markers (indicator phase). Cell culture methods are more sensitive and have a low probability of false negative results, but require the use of positive control strains. Since the structure of RCL is unknown, it is challenging to select which strain to use as a positive control when testing. Foreign studies have indicated that the use of attenuated strains of HIV lacking the auxiliary genes can be used as positive controls for RCL detection (e.g., R8.71 virus).
In summary, the current RCL positive controls have the following problems: (1) it is inconvenient to detect rapidly and the quantitative sensitivity is low; (2) The prior low virulent strain positive control is inconsistent with the transfer sequence in the third/fourth generation packaging system, and has system difference and easy occurrence of false negative, so that the effective positive control is provided, the detection efficiency and accuracy are improved, and the method is applicable to various detection methods and has important significance for the RCL detection field.
Disclosure of Invention
Aiming at the defects and actual requirements of the prior art, the invention provides a recombinant expression vector for detecting a replication-competent virus and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a recombinant expression vector for detection of a replication-competent virus, comprising a viral vector containing a gene encoding a fluorescent protein and a gene encoding a herpetic stomatitis virus G protein.
In the invention, the coding gene of the fluorescent protein and the coding gene (VSVg) of the vesicular stomatitis virus G protein (VSV-G) are inserted into the virus vector (partial sequence of the VSVg can be selected), which is beneficial to quick detection, can be further used for preparing replication type virus as a positive reference substance for RCL detection, is beneficial to improving the detection efficiency, accuracy and convenience, can be applied to various detection methods, and has more reliable detection result and higher safety.
In the present invention, the fluorescent protein for fluorescent labeling commonly used in the art is applicable to the present invention without particular limitation.
Preferably, the fluorescent protein can be selected from any one of green fluorescent protein, red fluorescent protein, yellow fluorescent protein and blue fluorescent protein or the combination of at least two of the green fluorescent protein, the red fluorescent protein, the yellow fluorescent protein and the blue fluorescent protein.
In the present invention, viral vectors commonly used in the art are all applicable to the present invention, and are not particularly limited.
Preferably, the viral vector may be selected from HIV vectors.
Preferably, the viral vector may be selected from the group consisting of pNL 4-3-luci-R-E-plasmid.
Preferably, the nucleic acid sequence of the gene encoding green fluorescent protein may include the sequence shown in SEQ ID No. 1.
SEQ ID NO.1：
atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagaagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggctaacttcaaggttcgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtga。
In the invention, the coding gene of the herpetic stomatitis virus G protein with a specific sequence disclosed or the gene obtained by carrying out truncation or sequence addition modification and the like on the basis of the coding gene is suitable for the invention, a partial sequence selected from the coding gene of the herpetic stomatitis virus G protein can be used for implementing the scheme of the invention, and the length of the partial sequence can be 120-200 bp, such as 121bp, 130bp, 160bp, 164bp, 170bp, 180bp, 190bp or 195bp.
Preferably, the nucleic acid sequence of the gene encoding the herpetic stomatitis virus G protein may include the sequence shown in SEQ ID No. 2.
SEQ ID NO.2：
atgaagtgccttttgtacttagcctttttattcattggggtgaattgcaagttcaccatagtttttccacacaaccaaaaaggaaactggaaaaatgttccttctaattaccattattgcccgtcaagctcagatttaaattggcataatgacttaataggcacagccttacaagtcaaaatgcccaagagtcacaaggctattcaagcagacggttggatgtgtcatgcttccaaatgggtcactacttgtgatttccgctggtatggaccgaagtatataacacattccatccgatccttcactccatctgtagaacaatgcaaggaaagcattgaacaaacgaaacaaggaacttggctgaatccaggcttccctcctcaaagttgtggatatgcaactgtgacggatgccgaagcagtgattgtccaggtgactcctcaccatgtgctggttgatgaatacacaggagaatgggttgattcacagttcatcaacggaaaatgcagcaattacatatgccccactgtccataactctacaacctggcattctgactataaggtcaaagggctatgtgattctaacctcatttccatggacatcaccttcttctcagaggacggagagctatcatccctgggaaaggagggcacagggttcagaagtaactactttgcttatgaaactggaggcaaggcctgcaaaatgcaatactgcaagcattggggagtcagactcccatcaggtgtctggttcgagatggctgataaggatctctttgctgcagccagattccctgaatgcccagaagggtcaagtatctctgctccatctcagacctcagtggatgtaagtctaattcaggacgttgagaggatcttggattattccctctgccaagaaacctggagcaaaatcagagcgggtcttccaatctctccagtggatctcagctatcttgctcctaaaaacccaggaaccggtcctgctttcaccataatcaatggtaccctaaaatactttgagaccagatacatcagagtcgatattgctgctccaatcctctcaagaatggtcggaatgatcagtggaactaccacagaaagggaactgtgggatgactgggcaccatatgaagacgtggaaattggacccaatggagttctgaggaccagttcaggatataagtttcctttatacatgattggacatggtatgttggactccgatcttcatcttagctcaaaggctcaggtgttcgaacatcctcacattcaagacgctgcttcgcaacttcctgatgatgagagtttattttttggtgatactgggctatccaaaaatccaatcgagcttgtagaaggttggttcagtagttggaaaagctctattgcctcttttttctttatcatagggttaatcattggactattcttggttctccgagttggtatccatctttgcattaaattaaagcacaccaagaaaagacagatttatacagacatagagatgaaccgacttggaaagtaa。
In one embodiment of the invention, primer c (EGFP-VSV-F): cgagctgtacaagtgatgcaaagcattg and primer d (VSV-UC 19-R): and carrying out PCR amplification by using the sequence SEQ ID NO.2 as a template to obtain a coding gene partial sequence of the herpetic stomatitis virus G protein.
In a second aspect, the present invention provides a recombinant cell comprising the recombinant expression vector of the first aspect for replication-competent virus detection.
Preferably, the recombinant cell is prepared by introducing the recombinant expression vector for detecting a replication-competent virus into a host cell.
In a third aspect, the present invention provides a recombinant virus comprising the recombinant expression vector of the first aspect for detection of a replication-competent virus.
In a fourth aspect, the present invention provides the use of the recombinant expression vector of the first aspect, the recombinant cell of the second aspect, or the recombinant virus of the third aspect for the detection of a replication-competent virus in the preparation of a replication-competent virus detection product.
In a fifth aspect, the present invention provides a replication competent virus detection kit comprising any one of or a combination of at least two of the recombinant expression vector of the first aspect, the recombinant cell of the second aspect, or the recombinant virus of the third aspect.
Preferably, the kit further comprises a primer probe combination.
Preferably, the primer probe combination comprises a primer group 1, a primer group 2 and a probe.
Preferably, the nucleic acid sequence of the primer set 1 comprises the sequences shown in SEQ ID NO.3 and SEQ ID NO. 4.
Preferably, the nucleic acid sequence of the primer set 2 comprises the sequences shown in SEQ ID NO.5 and SEQ ID NO. 6.
Preferably, the nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO. 7.
SEQ ID NO.3：CAGGACTCGGCTTGCTGAA。
SEQ ID NO.4：GGTGATATGGCCTGATGTACCA。
SEQ ID NO.5：TGCAAGGAAAGCATTGAACAA。
SEQ ID NO.6：GAGGAGTCACCTGGACAATCACT。
SEQ ID NO.7：AGGAACTTGGCTGAATCCAGGCTTCC。
In a sixth aspect, the present invention provides the recombinant expression vector for detecting a replication competent virus according to the first aspect, the recombinant cell according to the second aspect, or the recombinant virus according to the third aspect, for use in detecting a replication competent virus.
In a seventh aspect, the present invention provides a method for detecting a replication-competent virus, the method comprising:
preparing a virus by using the recombinant expression vector for detecting the replication-competent virus according to the first aspect, and detecting the replication-competent virus by using the virus as a positive control.
The recombinant expression vector for detecting the replication-competent virus can be further used for preparing the replication-competent virus, and the virus has wide applicability and can be applied to various RCL detection methods, including a GFP observation method, a P24 quick detection method, a P24ELISA detection method, a psi-gag gene PCR detection method, a VSVg gene QPCR detection method and the like.
Compared with the prior art, the invention has the following beneficial effects:
the recombinant expression vector with a specific structure for detecting the replication type virus is designed, and the coding gene of the fluorescent protein and a part of the coding gene (VSVg) of the vesicular stomatitis virus G protein (VSV-G) are inserted into the virus vector, so that the rapid detection is facilitated, the recombinant expression vector can be further used for preparing the replication type virus as a positive reference substance for RCL detection, the detection efficiency, the sensitivity, the accuracy and the convenience are facilitated to be improved, the recombinant expression vector can be suitable for various detection methods, the detection result is more reliable, and the safety is higher.
Drawings
FIG. 1 is a graph showing the results of fluorescence microscope observation of positive control virus-infected cells C8166 in example 5;
FIG. 2 is a graph showing the results of the colloidal gold assay in example 6;
FIG. 3 is a graph showing the results of PCR amplification in example 9.
Detailed Description
To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and that no limitation of the invention is intended.
The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
Example 1
This example constructed a recombinant expression vector (designated pNL4-3-EGFP-partVSVG plasmid) for replication-competent virus detection.
1. Construction of pUC19-EGFP-partVSVG plasmid
Primer:
primer a (UC 19-EGFP-F): aaacgacggccagtgaattcgcgcggccggcatggtgagcaagggcg.
Primer b (EGFP-R): tcacttgtacagctcgtccat.
Primer c (EGFP-VSV-F): cgagctgtacaagtgatgcaaagcattg.
Primer d (VSV-UC 19-R): caggtcgactctagagggattccctcgaggaggagtcacctggac.
(1) The pUC19 plasmid adopts EcoRI/BamHI double-enzyme cutting glue to recover about 2665bp of the skeleton;
(2) Preparation of EGFP fragment: taking a plasmid containing the EGFP as a template (SEQ ID NO. 1), amplifying an EGFP fragment by using a primer a and a primer b through PCR, and recovering the EGFP fragment by using a glue;
(3) Preparation of VSVg fragment: using plasmid containing VSVg gene as template (SEQ ID NO. 2), using primer c and primer d to PCR amplify VSVg segment 164bp, recovering VSVg segment;
(4) Recombining the vector, the EGFP fragment and the VSVg fragment by using a recombinase;
(5) Transforming stbl3 competent cells with the recombinant product;
(6) And (3) identification: selecting positive monoclonal bacteria, and performing PCR verification on a GPF-VSVg fragment with the size of about 897bp by using a primer a and a primer d;
(7) Sequencing and identifying:
sequencing primers:
M13R：caggaaacagctatgacc；
EGFP-R：tcacttgtacagctcgtccat；
after the identification is correct, the plasmid is extracted for subsequent experiments.
2. Construction of pNL4-3-EGFP-partVSVG plasmid
(1) The pNL 4-3-luci-R-E-plasmid adopts NotI/XhoI double-enzyme gel cutting, and the backbone is recovered by 14740bp (the fragment part is 1656bp, and the vector can be observed and identified at the same time);
(2) Cutting the pUC19-EGFP-partVSVG plasmid by adopting NotI/XhoI double enzyme, and recovering a fragment of about 850bp;
(3) Taking 96ng of the skeleton and 50ng of the fragment, connecting by using T4 ligase, uniformly mixing, and standing at 4 ℃ overnight;
(4) Transforming stbl3 competent cells;
(5) PCR was performed using primer a and primer d to verify the GPF-partVSVG fragment, which was about 897bp in size;
(6) Selecting and identifying correct clones, sending to Jinzhi corporation of Suzhou for sequencing, wherein the sequencing primers are NL4-3-EGFP-seq-F (200623) and NL4-3-EGFP-seq-R (200623);
(7) Plasmid major grape
The pSIN-HD CD19 CAR (kanAR) plasmid is subjected to macroextraction according to the instructions of a Tiangen plasmid macroextraction kit, and the specific steps are as follows:
1) Column balancing: adding 3mL of balance liquid BL into adsorption column CP6 (the adsorption column is placed into a 50mL collection tube), centrifuging for 2min at 8000r, pouring off waste liquid in the collection tube, and placing the adsorption column back into the collection tube (the adsorption column is used for treatment at present);
2) Adding 40 mL/tube of 120mL of overnight-cultured bacterial liquid into a 50mL centrifuge tube, centrifuging at 25 ℃ and 8000rpm for 3min to collect bacteria, sucking supernatant as much as possible, and reversing the supernatant on clean absorbent paper so as to remove water drops on the wall;
3) Adding 8mL of solution P1 (RNaseA is added before use) into the centrifuge tube with the thallus precipitate, and thoroughly suspending the bacteria precipitate by using a shaking instrument;
4) Adding 8mL of solution P2 into a centrifuge tube, immediately and gently turning up and down for 6-8 times to fully crack the thalli, and standing at 25 ℃ for 5min;
5) Adding 8mL of solution P4 into a centrifuge tube, immediately and gently turning the centrifuge tube up and down for 7 times, fully and uniformly mixing until white dispersed flocculent precipitate appears in the solution, placing the centrifuge tube at 25 ℃ for 10min, centrifuging the centrifuge tube at 8000rpm for 10min to separate the white precipitate to the bottom of the centrifuge tube, carefully pouring all the solution into a filter CS1 (avoiding pouring a large amount of precipitate to block the filter), slowly pushing a push handle for filtration, and collecting filtrate into a 50mL clean centrifuge tube;
6) Adding 6mL of isopropanol into the filtrate, reversing the filtrate from top to bottom, uniformly mixing the mixture, transferring the mixture to a balanced adsorption column CP6, and putting the adsorption column into a 50mL collecting pipe;
7) Centrifuging at 25 deg.C and 8000rpm for 2min, removing waste liquid, and replacing adsorption column CP6 in the collection tube;
8) Adding 10mL of rinsing liquid PW added with absolute ethyl alcohol into the adsorption column CP6, centrifuging at 8000rpm for 2min, pouring off waste liquid in the collection pipe, and putting the adsorption column CP6 back into the collection pipe again;
9) Repeating operation step 8);
10 3mL of absolute ethyl alcohol is added into the adsorption column CP6, the mixture is centrifuged for 2min at 25 ℃ and 8000rpm, and waste liquid in the collecting pipe is poured out;
11 The adsorption column CP6 is put back into the collecting pipe again, and centrifuged for 5min at 8000rpm to remove the residual rinsing liquid;
12 Placing the adsorption column CP6 in a clean 50mL centrifuge tube, hanging and dripping 2mL elution buffer TB into the middle part of the adsorption membrane, placing for 5min at 25 ℃, and then centrifuging for 2min at 25 ℃ and 8000 rpm;
13 2.84mL of isopropanol and 0.84mL of 5M NaCl are added into a 50mL centrifuge tube filled with centrifuged liquid, mixed uniformly, placed at 25 ℃ for 5min, centrifuged at 8000rpm for 10min, and the supernatant is carefully discarded;
14 1mL of 70% ethanol is added to wash the precipitate, the precipitate is centrifuged at 8000rpm at 25 ℃ for 5min, and the ethanol is carefully discarded;
15 ) repeat operation step 14);
16 Drying the precipitate at 25 deg.C for about 30min, adding 300. Mu.L ddH 2 O, completely dissolving the precipitate, and transferring the precipitate into a 1.5mL centrifuge tube for storage;
17 Microplate reader to measure concentration.
3. The pNL4-3-EGFP-partVSVg plasmid is sequenced and identified, the position of the insert EGFP-VSVg on the vector is 10298-11138, and the sequencing sequences are aligned in a consistent manner.
Example 2
This example prepared a virus (HIV-1-HD EGFP) using the pNL4-3-EGFP-partVSVG plasmid prepared in example 1.
One day before transfection, 2X 10 6 The 293T cells were inoculated into T25 flasks, cell supernatant was discarded 1h prior to transfection, 8mL of 293T cell maintenance solution was added, and the flasks were placed in an incubator, each T25 flask being configured with the transfection system as follows: adding 10 mu g of pNL4-3-EGFP-partVSVG plasmid into 150 mu L of serum-free DMEM medium, and uniformly mixing to mark as A liquid; adding 30 mu g of PEI into 150 mu L of serum-free DMEM medium, uniformly mixing, marking as liquid B, standing for 5min, adding the liquid B into the liquid A, uniformly mixing, standing for 20min, adding into a T25 culture bottle, placing into an incubator, removing the medium after 5h, adding 10mLDPBS for cleaning, adding 293T cell maintenance fluid, placing into the incubator, collecting the virus supernatant and storing at 4 ℃ the next day; on the third day, virus supernatants were collected and combined with the first virus supernatant, FBS was added to a final concentration of 10%, filtered through a 0.45 μ M filter and dispensed into 2mL cryopreservation tubes at 1 mL/tube.
Example 3
This example measures the virus titer prepared in example 2.
The HIV-1-HD EGFP virus (prepared in example 2) was removed, and the EP tubes were labeled with 1E-1,1E-2,1E-3,1E-4,1E-5, and 450. Mu.L of a medium 1640 containing 10% FBS was added, respectively, and the HIV-1-HDEGFP virus was mixed by a pipette, and 50. Mu.L of the medium was added to the EP tube labeled with 1E-1 and mixed; the dilution was sequentially performed by 10-fold gradient to 1E-5 dilution, the density of C8166 cells was adjusted to 1E5/mL, the cells were added to a 48-well plate at 450. Mu.L/well, 50. Mu.L of each of the cells was taken out from the EP tubes labeled 1E-1 to 1E-5 and added to the wells of the 48-well plate to which 450. Mu.L of C8166 cells had been previously added, and 6 wells were added for each concentration, and the results are shown in Table 1.
TABLE 1
| |
|
|
|
|
|
Number of positive wells | |
| 1E-1 | + | + | + | + | + | + | 6/6 |
| 1E-2 | + | + | + | + | + | + | 6/6 |
| 1E-3 | + | + | + | + | + | + | 6/6 |
| 1E-4 | + | + | + | + | - | + | 5/6 |
| 1E-5 | - | + | - | - | - | - | 1/6 |
Calculating the formula: TCID50 (IU/mL) = number of positive wells at B concentration/number of positive wells at a concentration/dilution multiple of B/volume of B (B concentration: next concentration of maximum dilution of all positive, a concentration: concentration of maximum dilution of all positive), TCID50 (IU/mL) = (5/6)/(1E-4)/0.05 =1.67e5 (IU/mL).
Example 4
The embodiment provides a workflow for RCL detection, including:
(1) The virus prepared in example 2 is used as a positive control virus, positive control viruses 5CCID and 50CCID are respectively taken to be co-incubated with susceptible indicator cells C8166, uninfected C8166 cells are used as a negative control, cell passage is carried out when cell culture solution begins to turn yellow, supernatant is taken at the 2 nd generation, the 4 th generation and the 6 th generation (amplification period) respectively, colloidal gold and ELISA methods are used for detecting P24 protein, and C8116 cells are taken to observe EGFP under a microscope, and psi-gag and QPCR methods are used for detecting VSVg expression;
(2) Inoculating the cell supernatant from the sixth generation to new C8166 cells, transferring the cells for 2 generations (indication period), and sampling for detection;
(3) If the C8166 cells added with the positive virus control cause cell death due to the massive amplification of the virus, the culture supernatant is taken to transfect new C8166 cells until the 6 th generation, and then the supernatant is taken to transfect new C8166 cells.
Example 5
This example detects EGFP expression.
As shown in example 4, C8166 cells in the amplification stage and the indication stage infected by 5CCID positive control viruses are respectively taken, the expression condition of EGFP is observed under a fluoroscope and photographed, and the result is shown in figure 1, the C8166 cells in the amplification stage and the indication stage both obviously express GFP, which indicates that the positive control viruses prepared by the invention can be rapidly detected and identified.
Example 6
The invention adopts colloidal gold method to detect P24 protein.
Taking out the slow virus vector (HIV P24) of the detection card from the package, quickly detecting the card (BF 06202-1000, bo Te Long, suzhou), sucking 100 mu L of culture supernatant by a liquid-transfering gun, adding the culture supernatant into a sample hole, standing for 10min, judging the result, and judging the result: 1. the control line (C) and the detection line (T) in the detection window are positive after developing color; 2. the quality control line (C) is colored, and the detection line (T) is negative when not colored; 3. the quality control line (C) does not develop color and is invalid in inspection; as shown in FIG. 2, the C8166 cells cultured in the group infected with the positive control viruses of 5CCID and 50CCID in example 4 were able to clearly detect the expression of P24 in both the amplification stage and the index stage.
Example 7
This example uses ELISA to detect P24 protein.
The expression level of P24 in the supernatant was determined using an Abcam HIV 1P 24ELISA kit (cat # ab 218268) as follows:
(1) Preparing a 1.5mL centrifuge tube rack, placing a plurality of centrifuge tubes of 1.5mL, diluting the Sample solution to a standard range by a Sample DiluentNS diluent according to the requirement and marking;
(2) The standard dry powder was diluted to 300pg/mL, 150pg/mL, 75pg/mL, 37.5pg/mL, 18.75pg/mL, 9.38pg/mL, 4.69pg/mL with Sample Diluent NS, respectively, and the dilution was selected as 0pg/mL. Mixing appropriate amount of 10 × CaptureAntibody and 10 × Detector Antibody, and diluting with Antibody Diluent Antibody Diluent 5 BI;
(3) Calculating the number of the required enzyme-labeled coated plates according to the number of the test products and the standard products, and sequentially adding 0pg/mL, 4.69pg/mL, 9.38pg/mL, 18.75pg/mL, 37.5pg/mL, 75pg/mL, 150pg/mL, 300pg/mL of P24 protein standard products and diluted test products into micropores of the enzyme-labeled plates according to 50 mu L/hole (2 holes are repeated for each standard product, and 2 holes are repeated for the test products);
(4) Adding an Antibody Cocktail: adding the configured Antibody Cocktail: mixing the mixture with 50 mu L/hole, gently oscillating and mixing the mixture evenly, and sealing the plate;
(5) Sealing the microporous plate by using a sealing plate film, and incubating for 1h at 25 ℃;
(6) Carefully uncovering the opening plate film, spin-drying the waste liquid in the plate hole with force, adding washing liquid into the hole with the concentration of 350 mu L/hole, and standing for 15s for spin-drying;
(7) Repeating the operation for 3 times, drying the waste liquid by spin-drying, and patting the waste liquid by absorbent paper;
(8) Adding 100 μ L color-developing agent TMB into each well, and developing at 25 deg.C in dark for 10min;
(9) The reaction was stopped by adding 100. Mu.L of stop solution to each well. At this time, the wells containing P24 protein turned from blue to yellow, and the absorbance of the sample at a wavelength of 450nm (OD 450 nm) was measured using a microplate reader within 15 min.
As shown in Table 2, in the groups infected with the positive control viruses of 5CCID and 50CCID in example 4, the concentration of P24 in the supernatant of C8166 cells was more than 300pg/mL.
TABLE 2
Example 8
This example extracts the C8166 cell genome.
The genome of C8166 cells is extracted by adopting a Tiangen blood/tissue/cell genome extraction kit (cargo number: DP 304-02) by the following method:
(1) 1mL of the collected cells was centrifuged at 12,00 Xg for 5min, and the supernatant was discarded;
(2) Opening a constant-temperature oscillation water tank metal bath, setting the temperature to be 70 ℃, and using the constant-temperature oscillation water tank metal bath for subsequent experiments;
(3) Adding 200 mu L of GA buffer solution into a tube, and oscillating until the cells are uniformly distributed and are in a single state;
(4) Adding 20 mu L of protease K into the tube, and uniformly mixing the solution for 15s by oscillation;
(5) Adding 200 mu L/tube of GB buffer solution, shaking and mixing uniformly for 15s, transferring 1.5mL of a centrifuge tube to a foam plate, and placing the foam plate in a metal bath constant-temperature shaking water tank at 70+1 ℃ for 10min;
(6) Adding 200 mu L of absolute ethyl alcohol into the tube, and uniformly mixing the mixture for 15s by oscillation;
(7) Placing adsorption column CB3 into a collecting tube, marking on a cover by using a marking pen, transferring the obtained solution into the adsorption column, centrifuging at 12,000 Xg for 1min, and discarding waste liquid;
(8) Respectively adding 500 μ L GD buffer solution into the adsorption column, centrifuging at 12,000 × g for 1min, and discarding the waste liquid;
(9) Respectively adding 600 μ LPW rinsing solution into the adsorption column, centrifuging at 12,000 × g for 1min, and discarding the waste liquid;
(10) Repeating the above steps;
(11) Centrifuging the collection tube placed in the adsorption column again at 12,000 Xg for 1min, placing the adsorption column in a clean 1.5mL centrifuge tube, and standing at 25 deg.C for 8min;
(12) Adding 100 μ L TE buffer solution into the middle part of the adsorption membrane, standing at 25 deg.C for 8min, centrifuging at 12,000 × g for 2min, discarding the adsorption column, collecting the solution into a new 1.5mL centrifuge tube, and detecting the absorbance at 260nm wavelength for quantification.
Example 9
This example uses PCR to detect the psi-gag gene copy number.
(1) The genome of the infected C8166 cell of example 4 was extracted as a template for PCR amplification according to the method described in example 8, and the reaction system is shown in Table 3, wherein the forward primer was GrecF1 (CAGGACTCGGCTTGCTGAA), the reverse primer was GrecR1 (GGTGATAGGGCCTGATGTACCA), and a plasmid containing psi-gag was used as a positive control.
TABLE 3
| Addition of Components | Volume (mu L) |
| 2×Hieff PCR Master Mix | 25 |
| Forward primer | 1.0 |
| Reverse primer | 1.0 |
| |
2 |
| Water for PCR reaction | 21 |
(2) After the sample addition, the following procedure was run on a PCR instrument: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 40s for 35 cycles; extension at 72 ℃ for 10min.
(3) The PCR products were electrophoresed on a 1% agarose gel, and after completion, the agarose gel was analyzed by photographing with a gel imager.
As a result, as shown in FIG. 3, lanes 1, 10, 11 and 15 are marker, lane 2 is blank control, lanes 5 and 6 are test results of passage 2 for positive viruses of 5CCID and 50CCID, lanes 7 and 9 are test results of passage 4 for positive viruses of 5CCID and 50CCID, lanes 8 and 12 are test results of passage 6 for positive viruses of 5CCID and 50CCID, and lanes 13 and 14 are test results of passage 2 for positive viruses of 5CCID and 50CCID, it can be seen that the-psi gag gene can be detected in the genome after infection of C8166 cells by the positive control viruses of 5CCID and 50CCID in example 4, either during the amplification stage or the indication stage.
Example 10
In this example, the VSVg gene was detected by QPCR.
The VSVg gene in the genome of the C8166 cells infected in example 4 was detected using TAKARA Premix Ex Taq (Probe qPCR) kit (cat # RR 390A) as follows:
(1) VSVg plasmid standard dilution
(1) Taking out a standard substance for gradient dilution, preparing a 1.5mL centrifuge tube rack, placing 8 centrifuge tubes of 1.5mL, sequentially marking as A1E +11, A1E +10, A1E +09, A1E +08, A1E +07, A1E +06 and A1E +05, and adding 72 mu L of sterile injection water or ultrapure water into the A1E +11, A1E +10, A1E +09, A1E +08, A1E +07, A1E +06 and A1E + 05;
(2) add 8. Mu.L of 10. Mu.L to A1E +11 tube 12 copy/mL plasmid standard containing VSVg, and shake for 15s; then sucking 8 mu L of the solution from the A1E +11 tube, adding the solution into the A1E +10 tube, and repeating the operation till the A1E +05 tube;
(2) The qPCR reaction system for VSV-G detection is shown in Table 4, the reaction procedure is shown in Table 5, and the forward primer is VSVF1 (TGCAAGGAAAGCATTGAACA); the reverse primer is VSVR1 (GAGGAGTCACCTGGACATCACTACTACTACT); the probe is VSVP (6 FAM-AGGAACTTGGCTGAACCAGGCTTC-TAMRA);
TABLE 4
| Addition of Components | Volume (mu L) |
| Premix Ex Taq(Probe qPCR) | 10 |
| Forward primer | 0.4 |
| Reverse primer | 0.4 |
| Probe needle | 0.8 |
| |
2 |
| Water for PCR reaction | 6.4 |
TABLE 5
As shown in Table 6, in example 4, the number of copies of VSVg in the genome was high in both the amplification stage and the indication stage in the C8166 cells infected with the positive control virus (VSVg)>10 7 copites/. Mu.g genome).
TABLE 6
Example 11
This example analyzes the limit of infection detection.
The positive virus of 1CCID is used for infecting C8166 cells, 24 samples are infected, and CO is added after infection 2 Culturing in an incubator for 2-5 days, supplementing liquid according to the growth condition of the cells, and regularly observing the fluorescent expression condition of the cells. And (3) checking the fluorescent expression of the C8166 cells after the culture period is finished, taking the supernatant, detecting the expression of the P24 protein by a colloidal gold method and an ELISA method, and extracting a genome to detect the psi-gag and VSV-G expression.
If the same sample psi-gag, VSV-G, GFP, P24 colloidal gold and P24ELISA5 are all positive, the sample is judged to be positive; considering that GFP and P24 are both protein expression level detection, if the GFP, P24 colloidal gold and P24ELISA3 items of the same sample are positive, the sample can also be judged to be positive; since the detection limit of P24ELISA was 4.688pg/mL, when 2 items of GFP and P24 colloidal gold were negative, the P24ELISA result was positive, and the sample was also judged to be positive.
Claim 1CCID is at least 95% detectable and the validation data is shown in Table 7.
TABLE 7
* The result shows that the positive result of 1CCID is 23/24 by two detection items of GFP and P24 colloidal gold; the positive result of 1CCID is 24/24 according to the judgment of a P24ELISA test item.
The two detection items of GFP and P24 colloidal gold are used for judgment, the positive result of 1CCID is 23/24, and the detection limit is 1CCID; the positive result of 1CCID is 24/24 and the detection limit is 1CCID according to the judgment of a P24ELISA test item. Because the detection limit of the P24 colloidal gold is 1ng/mL, and the detection limit of the ELISA method of the P24 is 4.688pg/mL, the experimental results of the GFP and the P24 colloidal gold can be used for judging whether the sample is positive, and under the condition that the results of the GFP and the P24 colloidal gold are negative, the ELISA result of the P24 is used for finally judging whether the sample is positive. If the ELISA result of P24 is positive, the sample is judged to be positive, and if the ELISA result of P24 is negative, the sample is judged to be negative.
In conclusion, the recombinant expression vector with a specific structure for detecting the replication-competent virus is designed, is favorable for quick detection, can be further used for preparing the replication-competent virus to serve as a positive reference substance for RCL detection, is favorable for improving the detection efficiency, the sensitivity, the accuracy and the convenience, can be suitable for various detection methods, and has more reliable detection results and higher safety.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modifications of the present invention, equivalent substitutions of the raw materials of the product of the present invention, and the addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
Claims (10)
1. A recombinant expression vector for detecting replication-competent viruses, wherein the recombinant expression vector comprises a viral vector containing a gene encoding a fluorescent protein and a gene encoding a G protein of herpesvirus.
2. The recombinant expression vector for detecting the replication-competent virus according to claim 1, wherein the fluorescent protein is selected from any one of green fluorescent protein, red fluorescent protein, yellow fluorescent protein and blue fluorescent protein or a combination of at least two of the green fluorescent protein, the red fluorescent protein, the yellow fluorescent protein and the blue fluorescent protein;
preferably, the viral vector is selected from the group consisting of an HIV vector;
preferably, the nucleic acid sequence of the coding gene of the herpetic stomatitis virus G protein includes the sequence shown in SEQ ID NO. 2.
3. The recombinant expression vector for replication competent virus detection according to claim 2, wherein the viral vector is selected from the group consisting of a pNL 4-3-luci-R-E-plasmid;
preferably, the nucleic acid sequence of the coding gene of the green fluorescent protein comprises a sequence shown in SEQ ID NO. 1.
4. A recombinant cell comprising the recombinant expression vector for replication competent virus detection of any one of claims 1 to 3;
preferably, the recombinant cell is prepared by introducing the recombinant expression vector for replication-competent virus detection into a host cell.
5. A recombinant virus comprising the recombinant expression vector of any one of claims 1-3 for use in replication-competent virus detection.
6. Use of the recombinant expression vector of any one of claims 1 to 3, the recombinant cell of claim 4 or the recombinant virus of claim 5 for the preparation of a replication-competent virus assay product.
7. A replication-competent virus detection kit comprising any one of the recombinant expression vector for replication-competent virus detection according to any one of claims 1 to 3, the recombinant cell according to claim 4, or the recombinant virus according to claim 5, or a combination of at least two thereof.
8. The replication competent virus detection kit of claim 7, wherein the kit further comprises a primer probe combination;
the primer probe combination comprises a primer group 1, a primer group 2 and a probe;
the nucleic acid sequence of the primer group 1 comprises sequences shown in SEQ ID NO.3 and SEQ ID NO. 4;
the nucleic acid sequence of the primer group 2 comprises sequences shown as SEQ ID NO.5 and SEQ ID NO. 6;
the nucleic acid sequence of the probe comprises a sequence shown in SEQ ID NO. 7.
9. Use of the recombinant expression vector of any one of claims 1-3 for detection of a replication competent virus, the recombinant cell of claim 4, or the recombinant virus of claim 5 for detection of a replication competent virus.
10. A method for detecting a replication-competent virus, the method comprising:
a method for detecting a replication-competent virus, comprising preparing a virus from the recombinant expression vector for detecting a replication-competent virus according to any one of claims 1 to 3, and detecting the replication-competent virus using the virus as a positive control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210891936.2A CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210891936.2A CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115717155A true CN115717155A (en) | 2023-02-28 |
| CN115717155B CN115717155B (en) | 2023-11-14 |
Family
ID=85253890
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210891936.2A Active CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115717155B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877474A (en) * | 2021-02-19 | 2021-06-01 | 北京鼎成肽源生物技术有限公司 | Primer group, kit and method for detecting replication type virus in gene modified cell mediated by lentivirus |
| CN113667773A (en) * | 2021-08-19 | 2021-11-19 | 南昌艾迪康医学检验实验室有限公司 | Primer, probe and kit for detecting whether RCL (Rich cell line) pollution exists in CarT cells |
| CN113789345A (en) * | 2021-08-11 | 2021-12-14 | 康美润源(北京)生物技术有限公司 | Kit for detecting replication-competent lentivirus (RCL) and application thereof |
-
2022
- 2022-07-27 CN CN202210891936.2A patent/CN115717155B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877474A (en) * | 2021-02-19 | 2021-06-01 | 北京鼎成肽源生物技术有限公司 | Primer group, kit and method for detecting replication type virus in gene modified cell mediated by lentivirus |
| CN113789345A (en) * | 2021-08-11 | 2021-12-14 | 康美润源(北京)生物技术有限公司 | Kit for detecting replication-competent lentivirus (RCL) and application thereof |
| CN113667773A (en) * | 2021-08-19 | 2021-11-19 | 南昌艾迪康医学检验实验室有限公司 | Primer, probe and kit for detecting whether RCL (Rich cell line) pollution exists in CarT cells |
Non-Patent Citations (4)
| Title |
|---|
| LINDSEY M SKRDLANT等: "Detection of Replication Competent Lentivirus Using a qPCR Assay for VSV-G", 《MOL THER METHODS CLIN DEV》 * |
| S L LI等: "A VSV-G pseudotyped HIV vector mediates efficient transduction of human pulmonary artery smooth muscle cells", 《MICROBIOL IMMUNOL》 * |
| 吴雪伶等: "CAR-T细胞治疗产品中复制型病毒的风险分析及控制", 《中国药事》 * |
| 崔靖等: "复制能力慢病毒检测方法的研究进展", 《中国新药杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115717155B (en) | 2023-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shioda et al. | Production of human immunodeficiency virus (HIV)-like particles from cells infected with recombinant vaccinia viruses carrying the gag gene of HIV | |
| Méric et al. | Characterization of Moloney murine leukemia virus mutants with single-amino-acid substitutions in the Cys-His box of the nucleocapsid protein | |
| Luan et al. | Development of a real-time quantitative RT-PCR to detect REV contamination in live vaccine | |
| WO2020224394A1 (en) | Fluorescent probe, primer pair, fluorescent quantitative pcr kit and detection method for detecting lentivirus | |
| Debbink et al. | Human Norovirus Detection and Production, Quantification, and Storage of Virus‐Like Particles | |
| CN111910015A (en) | Probe, primer pair, fluorescent quantitative PCR kit and method for detecting replication type lentivirus | |
| Hübner et al. | Identification and characterization of the 285L and K145R proteins of African swine fever virus | |
| Kirchherr et al. | High throughput functional analysis of HIV-1 env genes without cloning | |
| Maury | Regulation of equine infectious anemia virus expression | |
| CN114075553B (en) | Pseudo virus particle used for evaluating activity of neutralizing antibody of novel coronavirus and serving as nucleic acid detection standard and preparation method thereof | |
| CN113817753B (en) | Expression of SARS-CoV-2 fiber protein or its variant S Δ21 Construction and use of pseudotyped VSV viruses | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| Temperton et al. | Retroviral pseudotypes—from scientific tools to clinical utility | |
| CN109913423A (en) | A kind of the recombination Vero cell line and application of stable expression pig Delta coronavirus N protein | |
| EP4126036A2 (en) | Reverse genetic system for sars-cov-2 | |
| Lednicky et al. | Simian virus 40 regulatory region structural diversity and the association of viral archetypal regulatory regions with human brain tumors | |
| CN111925998A (en) | System for simulating SARS-CoV-2 infection and its preparation method and application | |
| CN115717155B (en) | Recombinant expression vector for replication type virus detection and application thereof | |
| CN114350711B (en) | Virus-like particle and construction method and application thereof | |
| Lichtensteiger et al. | Recombinant gpl35 envelope glycoproteins of caprine arthritis-encephalitis lentivirus variants inhibit homologous and heterologous variant-specific neutralizing antibodies | |
| CN106754982B (en) | Limited replication West Nile virus system for expressing green fluorescent protein and application thereof | |
| Pillai et al. | A stretch of unpaired purines in the leader region of simian immunodeficiency virus (SIV) genomic RNA is critical for its packaging into virions | |
| CN109722465B (en) | HIV drug resistance detection vector and construction method | |
| Liu et al. | Rescue and characterization of a recombinant HY12 bovine enterovirus carrying a foreign HA epitope in the 3A nonstructural protein | |
| Soezi et al. | Toward the development of a single-round infection assay based on EGFP reporting for anti-HIV-1 drug discovery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |