CN115717155B - Recombinant expression vector for replication type virus detection and application thereof - Google Patents
Recombinant expression vector for replication type virus detection and application thereof Download PDFInfo
- Publication number
- CN115717155B CN115717155B CN202210891936.2A CN202210891936A CN115717155B CN 115717155 B CN115717155 B CN 115717155B CN 202210891936 A CN202210891936 A CN 202210891936A CN 115717155 B CN115717155 B CN 115717155B
- Authority
- CN
- China
- Prior art keywords
- virus
- detection
- replication
- expression vector
- recombinant expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 89
- 241000700605 Viruses Species 0.000 title claims abstract description 67
- 239000013604 expression vector Substances 0.000 title claims abstract description 33
- 238000003259 recombinant expression Methods 0.000 title claims abstract description 32
- 230000010076 replication Effects 0.000 title claims abstract description 22
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 33
- 108091006027 G proteins Proteins 0.000 claims abstract description 10
- 102000030782 GTP binding Human genes 0.000 claims abstract description 10
- 108091000058 GTP-Binding Proteins 0.000 claims abstract description 10
- 102000034287 fluorescent proteins Human genes 0.000 claims abstract description 8
- 108091006047 fluorescent proteins Proteins 0.000 claims abstract description 8
- 238000000034 method Methods 0.000 claims description 30
- 239000000523 sample Substances 0.000 claims description 29
- 241001068263 Replication competent viruses Species 0.000 claims description 26
- 239000013641 positive control Substances 0.000 claims description 20
- 239000013598 vector Substances 0.000 claims description 11
- 150000007523 nucleic acids Chemical group 0.000 claims description 10
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 8
- 241001529453 unidentified herpesvirus Species 0.000 claims description 8
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 239000000126 substance Substances 0.000 claims 2
- 230000002349 favourable effect Effects 0.000 abstract description 6
- 239000013603 viral vector Substances 0.000 abstract description 6
- 239000013558 reference substance Substances 0.000 abstract description 5
- 230000035945 sensitivity Effects 0.000 abstract description 4
- 210000004027 cell Anatomy 0.000 description 53
- 101000817067 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / BCRC 11384 / JCM 1318 / LMG 3730 / NCIMB 10025) Uncharacterized protein Cgl2226/cg2444 Proteins 0.000 description 24
- 101000738354 Homo sapiens CD9 antigen Proteins 0.000 description 24
- 101000957364 Mus musculus Cytochrome P450 2B10 Proteins 0.000 description 24
- 101000584469 Rice tungro bacilliform virus (isolate Philippines) Protein P1 Proteins 0.000 description 24
- 101000878575 Trypanosoma cruzi Flagellar calcium-binding protein Proteins 0.000 description 24
- 239000013612 plasmid Substances 0.000 description 23
- 239000000047 product Substances 0.000 description 19
- 238000001179 sorption measurement Methods 0.000 description 19
- 239000012634 fragment Substances 0.000 description 17
- 239000000243 solution Substances 0.000 description 16
- 239000007788 liquid Substances 0.000 description 15
- 238000003752 polymerase chain reaction Methods 0.000 description 15
- 239000006228 supernatant Substances 0.000 description 14
- 108010043121 Green Fluorescent Proteins Proteins 0.000 description 13
- 102000004144 Green Fluorescent Proteins Human genes 0.000 description 13
- 239000005090 green fluorescent protein Substances 0.000 description 13
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 12
- 238000002156 mixing Methods 0.000 description 12
- 108010048367 enhanced green fluorescent protein Proteins 0.000 description 11
- 108700001624 vesicular stomatitis virus G Proteins 0.000 description 11
- 230000014509 gene expression Effects 0.000 description 10
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 9
- 239000002699 waste material Substances 0.000 description 9
- 238000002965 ELISA Methods 0.000 description 8
- 230000003321 amplification Effects 0.000 description 8
- 238000003199 nucleic acid amplification method Methods 0.000 description 8
- 239000002244 precipitate Substances 0.000 description 8
- 238000010790 dilution Methods 0.000 description 7
- 239000012895 dilution Substances 0.000 description 7
- 102000004190 Enzymes Human genes 0.000 description 6
- 108090000790 Enzymes Proteins 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 6
- 239000000203 mixture Substances 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 6
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 6
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 5
- 241000713666 Lentivirus Species 0.000 description 5
- 238000011529 RT qPCR Methods 0.000 description 5
- 238000012360 testing method Methods 0.000 description 5
- 241000725303 Human immunodeficiency virus Species 0.000 description 4
- 102100034349 Integrase Human genes 0.000 description 4
- 238000004113 cell culture Methods 0.000 description 4
- 238000001035 drying Methods 0.000 description 4
- 238000004806 packaging method and process Methods 0.000 description 4
- 238000002360 preparation method Methods 0.000 description 4
- 238000003753 real-time PCR Methods 0.000 description 4
- 230000002441 reversible effect Effects 0.000 description 4
- 238000007789 sealing Methods 0.000 description 4
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 3
- 210000001744 T-lymphocyte Anatomy 0.000 description 3
- 238000003556 assay Methods 0.000 description 3
- 230000001580 bacterial effect Effects 0.000 description 3
- 239000007853 buffer solution Substances 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 239000012228 culture supernatant Substances 0.000 description 3
- 239000003085 diluting agent Substances 0.000 description 3
- 239000000706 filtrate Substances 0.000 description 3
- 239000000499 gel Substances 0.000 description 3
- 239000001963 growth medium Substances 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 230000036961 partial effect Effects 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000001890 transfection Methods 0.000 description 3
- 238000012546 transfer Methods 0.000 description 3
- 230000003612 virological effect Effects 0.000 description 3
- 241000894006 Bacteria Species 0.000 description 2
- 239000006144 Dulbecco’s modified Eagle's medium Substances 0.000 description 2
- 101710177291 Gag polyprotein Proteins 0.000 description 2
- 241001663880 Gammaretrovirus Species 0.000 description 2
- 241000713772 Human immunodeficiency virus 1 Species 0.000 description 2
- 101710125418 Major capsid protein Proteins 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 238000002835 absorbance Methods 0.000 description 2
- 239000002250 absorbent Substances 0.000 description 2
- 230000002745 absorbent Effects 0.000 description 2
- 239000000654 additive Substances 0.000 description 2
- 230000000996 additive effect Effects 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 230000002238 attenuated effect Effects 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 210000004369 blood Anatomy 0.000 description 2
- 239000008280 blood Substances 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 235000019441 ethanol Nutrition 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 239000006260 foam Substances 0.000 description 2
- 239000003292 glue Substances 0.000 description 2
- 238000000338 in vitro Methods 0.000 description 2
- 238000012423 maintenance Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 239000002184 metal Substances 0.000 description 2
- 229910052751 metal Inorganic materials 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 238000004064 recycling Methods 0.000 description 2
- 239000013049 sediment Substances 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 230000001131 transforming effect Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 102100024222 B-lymphocyte antigen CD19 Human genes 0.000 description 1
- 101710205625 Capsid protein p24 Proteins 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 101710091045 Envelope protein Proteins 0.000 description 1
- 101000980825 Homo sapiens B-lymphocyte antigen CD19 Proteins 0.000 description 1
- 102000003960 Ligases Human genes 0.000 description 1
- 108090000364 Ligases Proteins 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 101710177166 Phosphoprotein Proteins 0.000 description 1
- 101710188315 Protein X Proteins 0.000 description 1
- 102000018120 Recombinases Human genes 0.000 description 1
- 108010091086 Recombinases Proteins 0.000 description 1
- 101710149279 Small delta antigen Proteins 0.000 description 1
- 241001052560 Thallis Species 0.000 description 1
- 239000007984 Tris EDTA buffer Substances 0.000 description 1
- 102100022563 Tubulin polymerization-promoting protein Human genes 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 210000000577 adipose tissue Anatomy 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 238000010009 beating Methods 0.000 description 1
- 108091005948 blue fluorescent proteins Proteins 0.000 description 1
- 210000001185 bone marrow Anatomy 0.000 description 1
- 210000005252 bulbus oculi Anatomy 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 238000005520 cutting process Methods 0.000 description 1
- 210000003074 dental pulp Anatomy 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000006185 dispersion Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 210000000981 epithelium Anatomy 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 238000000799 fluorescence microscopy Methods 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 238000001215 fluorescent labelling Methods 0.000 description 1
- 238000009169 immunotherapy Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000000977 initiatory effect Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 230000000670 limiting effect Effects 0.000 description 1
- 239000002609 medium Substances 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 210000002826 placenta Anatomy 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 108010054624 red fluorescent protein Proteins 0.000 description 1
- 230000002829 reductive effect Effects 0.000 description 1
- 230000001172 regenerating effect Effects 0.000 description 1
- 238000002976 reverse transcriptase assay Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000012487 rinsing solution Substances 0.000 description 1
- 239000012488 sample solution Substances 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 210000001082 somatic cell Anatomy 0.000 description 1
- 230000010473 stable expression Effects 0.000 description 1
- 210000000130 stem cell Anatomy 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 239000012089 stop solution Substances 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000001502 supplementing effect Effects 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
- 238000010361 transduction Methods 0.000 description 1
- 230000026683 transduction Effects 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 210000003954 umbilical cord Anatomy 0.000 description 1
- 241001430294 unidentified retrovirus Species 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
- 108091005957 yellow fluorescent proteins Proteins 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant expression vector for replication virus detection and application thereof. The recombinant expression vector comprises a viral vector containing a coding gene of fluorescent protein and a part of coding gene of herpesstomatitis virus G protein. The recombinant expression vector for detecting the replication type virus with a specific structure is designed, is favorable for rapid detection, can be further used for preparing the replication type virus, is used as a positive reference substance for RCL detection, is favorable for improving detection efficiency, sensitivity, accuracy and convenience, can be suitable for various detection methods, and has more reliable detection results and higher safety.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a recombinant expression vector for replication virus detection and application thereof.
Background
In recent years, clinical studies on tumor immunotherapy and regenerative medicine products have been in progress, and a plurality of clinical trials of CAR-T/TCR-T cell products and stem cell/somatic cell products have been reported, involving a variety of cell types, and tissue sources including blood, epithelial tissue, bone marrow, adipose tissue, muscle tissue, eyeball, umbilical cord, placenta, dental pulp, etc.
The production process of the CAR-T cells mainly comprises the steps of peripheral blood separation of a patient, activation and enrichment of the T cells, transfer of the CAR into the T cells, in-vitro expansion of the CAR-T cells and finally forming a preparation. Because of high transduction efficiency, stable expression of target genes and long duration, lentiviruses and gamma-retroviruses become the most commonly used expression vectors in the process of transferring CAR coding genes into T cells at present, the generation of replication-competent lentivirus (RCL) is the most serious risk factor in the process of producing and using lentiviruses and gamma-retroviruses, so far, no report of detecting RCL in lentiviruses and related cell products applied to human bodies exists, and the possibility of occurrence of RCL is reduced by a virus packaging system adopted at present in theory, but the RCL is not completely excluded, so the RCL is still an important safety risk concern.
Based on the mechanism by which RCL is produced, a variety of markers have been discovered that may be indicative of RCL. For example, the homology of the packaging plasmid and the transfer plasmid gag initiation region sequences is high, and thus the two plasmid fragments may recombine to produce RCL; in addition, the amplified RCL with VSV-G as the envelope protein may migrate the VSV-G sequence into the genome of the indicator cell (see: security, L., et al, certification assays for HIV-1-based vectors frequent passage of gag sequences without evidence of replication-proposed viruses. Mol Ther,2003.8 (5): p.830-9.), the replication competent virus has reverse transcriptase activity, and the detection of PERT (Product enhanced reverse transcriptase) may also be indicative of RCL, but it is generally believed that the detection of gag Gene-encoded p24 protein and the indicator cell psi-gag and VSV-G sequences may reflect the presence of RCL, taking into account the fact that the indicator cell itself expresses reverse transcriptase (see: security, L., et al, product-enhanced reverse transcriptase assay for replication-competent retrovirus and lentivirus detection. Hum Gene Ther,2005.16 (10): p.1227-36.).
For clinical grade lentiviral vectors, common detection methods are cell culture and direct qPCR. The FDA guidelines require that the sample size of the corresponding viral supernatant should ensure at least a 95% detection probability, assuming that 1 RCL is included in the patient's clinical dose. The direct qPCR method is used for detecting the marker sequence (psi-gag, VSV-G) of the RCL in the sample to be detected through RT-PCR amplification, does not involve the amplification process of the RCL in cells, and has short time consumption and relatively simple detection method, but has obvious defects that the method often has pollution of residual plasmid DNA in vitro packaged viral vectors to cause false positive results. In addition, the mechanism of recombinant production of RCL is complex, and the generated RCL may not have PCR primer-matched sequences due to the diversity of virus packaging systems, so that false negative results are also difficult to avoid.
In cell culture to detect RCL, the test object is incubated with a cell line (typically C8166) susceptible to HIV-1 and capable of amplifying virus in large amounts, and the cells are passaged 5 times or more and cultured for at least 3 weeks (amplification period). Culture supernatants were collected after 3 weeks, inoculated into wild-type C8166 cells, and cultured for 7 days, and then RCL markers were detected (indication period). The cell culture method is more sensitive and the probability of false negative results is low, but the method requires the use of positive control strains. Since the structure of RCL is unknown, it is challenging to select which strain to use as a positive control in the assay. Foreign studies have indicated that the use of HIV attenuated strains lacking a helper gene can be used as positive controls for RCL detection (e.g., R8.71 virus).
In summary, current RCL positive controls have the following problems: (1) inconvenient rapid detection, and low quantitative sensitivity; (2) The adopted attenuated strain positive control is inconsistent with the transfer sequence in the third/fourth generation packaging system, and has systematic difference and easy false negative, so that an effective positive control is provided, the detection efficiency and accuracy are improved, the method is applicable to various detection methods, and the method has important significance in the field of RCL detection.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides a recombinant expression vector for detecting replication-competent viruses and application thereof, and the invention designs the recombinant expression vector for detecting replication-competent viruses, which can be used for preparing replication-competent viruses, is used as a positive reference substance for RCL detection, is beneficial to improving detection efficiency, accuracy and convenience, is applicable to various detection methods, and has more reliable detection results and higher safety.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a recombinant expression vector for replication competent virus detection, the recombinant expression vector comprising a viral vector comprising a gene encoding a fluorescent protein and a gene encoding a herpesstomatitis virus G protein.
In the invention, the coding gene of fluorescent protein and the coding gene (VSVg) of vesicular stomatitis virus G protein (VSV-G) are inserted into the virus vector (VSVg can be selected), so that the method is favorable for rapid detection, can be further used for preparing replication type viruses, is favorable for improving detection efficiency, accuracy and convenience as a positive reference substance for RCL detection, is suitable for various detection methods, and has more reliable detection results and higher safety.
In the present invention, fluorescent proteins commonly used in the art for fluorescent labeling are suitable for the present invention, and are not particularly limited.
Preferably, the fluorescent protein may be selected from any one or a combination of at least two of green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and blue fluorescent protein.
In the present invention, viral vectors commonly used in the art are suitable for the present invention, and are not particularly limited.
Preferably, the viral vector may be selected from HIV vectors.
Preferably, the viral vector may be selected from the group consisting of pNL 4-3-luci-R-E-plasmids.
Preferably, the nucleic acid sequence of the coding gene of the green fluorescent protein may include a sequence shown in SEQ ID NO. 1.
SEQ ID NO.1：
atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagaagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggctaacttcaaggttcgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtga。
In the invention, the coding gene of the herpesvirus G protein with specific sequences disclosed or the genes obtained by carrying out modification such as truncation or addition of sequences on the basis of the coding gene are suitable for the invention, and the partial sequences selected from the coding gene of the herpesvirus G protein can be used for implementing the scheme of the invention, and the length of the partial sequences can be 120-200 bp, for example 121bp, 130bp, 160bp, 164bp, 170bp, 180bp, 190bp or 195bp.
Preferably, the nucleic acid sequence of the gene encoding the herpesvirus G protein may comprise the sequence shown in SEQ ID No. 2.
SEQ ID NO.2：
atgaagtgccttttgtacttagcctttttattcattggggtgaattgcaagttcaccatagtttttccacacaaccaaaaaggaaactggaaaaatgttccttctaattaccattattgcccgtcaagctcagatttaaattggcataatgacttaataggcacagccttacaagtcaaaatgcccaagagtcacaaggctattcaagcagacggttggatgtgtcatgcttccaaatgggtcactacttgtgatttccgctggtatggaccgaagtatataacacattccatccgatccttcactccatctgtagaacaatgcaaggaaagcattgaacaaacgaaacaaggaacttggctgaatccaggcttccctcctcaaagttgtggatatgcaactgtgacggatgccgaagcagtgattgtccaggtgactcctcaccatgtgctggttgatgaatacacaggagaatgggttgattcacagttcatcaacggaaaatgcagcaattacatatgccccactgtccataactctacaacctggcattctgactataaggtcaaagggctatgtgattctaacctcatttccatggacatcaccttcttctcagaggacggagagctatcatccctgggaaaggagggcacagggttcagaagtaactactttgcttatgaaactggaggcaaggcctgcaaaatgcaatactgcaagcattggggagtcagactcccatcaggtgtctggttcgagatggctgataaggatctctttgctgcagccagattccctgaatgcccagaagggtcaagtatctctgctccatctcagacctcagtggatgtaagtctaattcaggacgttgagaggatcttggattattccctctgccaagaaacctggagcaaaatcagagcgggtcttccaatctctccagtggatctcagctatcttgctcctaaaaacccaggaaccggtcctgctttcaccataatcaatggtaccctaaaatactttgagaccagatacatcagagtcgatattgctgctccaatcctctcaagaatggtcggaatgatcagtggaactaccacagaaagggaactgtgggatgactgggcaccatatgaagacgtggaaattggacccaatggagttctgaggaccagttcaggatataagtttcctttatacatgattggacatggtatgttggactccgatcttcatcttagctcaaaggctcaggtgttcgaacatcctcacattcaagacgctgcttcgcaacttcctgatgatgagagtttattttttggtgatactgggctatccaaaaatccaatcgagcttgtagaaggttggttcagtagttggaaaagctctattgcctcttttttctttatcatagggttaatcattggactattcttggttctccgagttggtatccatctttgcattaaattaaagcacaccaagaaaagacagatttatacagacatagagatgaaccgacttggaaagtaa。
In one embodiment of the present invention, primer c (EGFP-VSV-F) may be used: cgagctgtacaagtgatgcaaggaaagcattg and primer d (VSV-UC 19-R): caggtcgactctagaggatccctcgaggaggagtcacctggac the coding gene part sequence of the herpesvirus G protein is obtained by PCR amplification with SEQ ID NO.2 as a template.
In a second aspect, the present invention provides a recombinant cell comprising a recombinant expression vector according to the first aspect for replication competent virus detection.
Preferably, the recombinant cells are prepared by introducing the recombinant expression vector for replication competent virus detection into a host cell.
In a third aspect, the present invention provides a recombinant virus comprising the recombinant expression vector for replication competent virus detection of the first aspect.
In a fourth aspect, the present invention provides the use of a recombinant expression vector for replication competent virus detection according to the first aspect, a recombinant cell according to the second aspect or a recombinant virus according to the third aspect in the preparation of a replication competent virus detection product.
In a fifth aspect, the present invention provides a replication competent virus detection kit comprising any one or a combination of at least two of the recombinant expression vector for replication competent virus detection according to the first aspect, the recombinant cell according to the second aspect or the recombinant virus according to the third aspect.
Preferably, the kit further comprises a primer probe combination.
Preferably, the primer probe combination comprises a primer group 1, a primer group 2 and a probe.
Preferably, the nucleic acid sequence of the primer set 1 comprises the sequences shown in SEQ ID NO.3 and SEQ ID NO. 4.
Preferably, the nucleic acid sequence of the primer set 2 comprises the sequences shown in SEQ ID NO.5 and SEQ ID NO. 6.
Preferably, the nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO. 7.
SEQ ID NO.3：CAGGACTCGGCTTGCTGAA。
SEQ ID NO.4：GGTGATATGGCCTGATGTACCA。
SEQ ID NO.5：TGCAAGGAAAGCATTGAACAA。
SEQ ID NO.6：GAGGAGTCACCTGGACAATCACT。
SEQ ID NO.7：AGGAACTTGGCTGAATCCAGGCTTCC。
In a sixth aspect, the present invention provides a recombinant expression vector for use in the detection of replication competent viruses according to the first aspect, a recombinant cell according to the second aspect or a recombinant virus according to the third aspect for use in the detection of replication competent viruses.
In a seventh aspect, the present invention provides a method of detecting a replication-competent virus, the method comprising:
preparing a virus by using the recombinant expression vector for replication type virus detection according to the first aspect, and detecting the replication type virus by using the virus as a positive control.
The recombinant expression vector for detecting replication-competent viruses can be further used for preparing replication-competent viruses, and the viruses have wide applicability and can be applied to various RCL detection methods, including GFP (green fluorescent protein) observation method, P24 rapid detection method, P24ELISA (enzyme-Linked immuno sorbent assay) detection method, psi-gag gene PCR (polymerase chain reaction) detection method, VSVg gene QPCR (quantitative polymerase chain reaction) detection method and the like.
Compared with the prior art, the invention has the following beneficial effects:
the invention designs a recombinant expression vector with a specific structure for detecting replication viruses, and inserts a coding gene of fluorescent protein and a partial coding gene (VSVg) of vesicular stomatitis virus G protein (VSV-G) into the virus vector, thereby facilitating rapid detection, being further applicable to preparing replication viruses, being used as a positive reference substance for RCL detection, facilitating improvement of detection efficiency, sensitivity, accuracy and convenience, being applicable to various detection methods, and having more reliable detection results and higher safety.
Drawings
FIG. 1 is a graph showing the results of fluorescence microscopy of positive control virus-infected cells C8166 in example 5;
FIG. 2 is a graph showing the result of the colloidal gold assay in example 6;
FIG. 3 is a graph showing the results of PCR amplification in example 9.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
Example 1
This example constructs a recombinant expression vector (designated as pNL4-3-EGFP-partVSVg plasmid) for replication virus detection.
1. Construction of pUC19-EGFP-partVSVg plasmid
Primer:
primer a (UC 19-EGFP-F): aaaacgacggccagtgaattcgcggccgcatggtgagcaagggcg.
Primer b (EGFP-R): tcacttgtacagctcgtccat.
Primer c (EGFP-VSV-F): cgagctgtacaagtgatgcaaggaaagcattg.
Primer d (VSV-UC 19-R): caggtcgactctagaggatccctcgaggaggagtcacctggac.
(1) The pUC19 plasmid adopts EcoRI/BamHI double enzyme gel to recycle the skeleton to about 2665bp;
(2) EGFP fragment preparation: using the plasmid containing EGFP as a template (SEQ ID NO. 1), amplifying EGFP fragments by using a primer a and a primer b through PCR, and recycling the EGFP fragments by using glue;
(3) VSVg fragment preparation: taking a plasmid containing a VSVg gene as a template (SEQ ID NO. 2), amplifying a VSVg fragment of 164bp by using a primer c and a primer d, and recycling the VSVg fragment by using glue;
(4) Recombining the vector, the EGFP fragment and the VSVg fragment by using recombinase;
(5) Transforming stbl3 competent cells with the recombinant product;
(6) And (3) identification: selecting positive monoclonal bacteria, and carrying out PCR (polymerase chain reaction) verification on GPF-VSVg fragments by using a primer a and a primer d, wherein the size of the fragments is about 897bp;
(7) Sequencing and identification:
sequencing primer:
M13R：caggaaacagctatgacc；
EGFP-R：tcacttgtacagctcgtccat；
after the identification, the plasmid was small-extracted and used for the subsequent experiments.
2. Construction of pNL4-3-EGFP-partVSVg plasmid
(1) The pNL 4-3-luci-R-E-plasmid is cut by adopting NotI/XhoI double enzyme, and the recovered skeleton is about 14740bp (fragment part is 1656bp, and the vector can be observed and identified simultaneously);
(2) pUC19-EGFP-partVSVg plasmid is subjected to NotI/XhoI double enzyme gel cutting, and the fragment is recovered to about 850bp;
(3) Taking 96ng of the framework and 50ng of fragments, connecting by using T4 ligase, uniformly mixing and then standing at 4 ℃ overnight;
(4) Transforming stbl3 competent cells;
(5) Performing PCR (polymerase chain reaction) verification on the GPF-part VSVg fragment by using a primer a and a primer d, wherein the size of the GPF-part VSVg fragment is about 897bp;
(6) Sequencing by selecting and identifying the correct clone from the company Jin Weizhi, suzhou, with the sequencing primers NL4-3-EGFP-seq-F (200623) and NL4-3-EGFP-seq-R (200623);
(7) Plasmid big lifter
The pSIN-HD CD19 CAR (kanaR) plasmid was prepared according to the description of the Tiangen plasmid big extraction kit, and the specific steps are as follows:
1) Column balance: adding 3mL of balance liquid BL into the adsorption column CP6 (the adsorption column is placed into a 50mL collecting pipe), centrifuging for 2min at 8000r, pouring out waste liquid in the collecting pipe, and putting the adsorption column back into the collecting pipe (firstly, performing current treatment);
2) Adding 120mL of the bacterial liquid cultured overnight in a 40 mL/tube into a 50mL centrifuge tube, centrifuging at 8000rpm at 25 ℃ for 3min to collect bacteria, absorbing the supernatant as much as possible, and reversely buckling on clean absorbent paper so as to remove water drops on the wall;
3) 8mL of solution P1 (RNaseA is added before use) is added into a centrifuge tube with bacterial sediment, and bacterial sediment is thoroughly suspended by a inching vibration instrument;
4) Adding 8mL of solution P2 into the centrifuge tube, immediately and gently turning up and down for 6-8 times to fully crack thalli, and standing at 25 ℃ for 5min;
5) Adding 8mL of solution P4 into a centrifuge tube, immediately and gently turning up and down for 7 times, fully mixing until white dispersion flocculent precipitate appears in the solution, standing for 10min at 25 ℃, centrifuging for 10min at 8000rpm to separate the white precipitate from the bottom of the tube, carefully pouring all the solution into a filter CS1 (avoiding pouring a large amount of precipitate into a filter with two plugs), slowly pushing a push handle for filtration, and collecting filtrate in a 50mL clean centrifuge tube;
6) Adding 6mL of isopropanol into the filtrate, uniformly mixing the filtrate upside down, transferring the mixture into an equilibrated adsorption column CP6, and placing the adsorption column into a 50mL collecting pipe;
7) Centrifuging at 25deg.C at 8000rpm for 2min, pouring out the waste liquid in the collecting tube, and putting the adsorbing column CP6 back into the collecting tube;
8) Adding 10mL of rinsing solution PW with absolute ethyl alcohol added into the adsorption column CP6, centrifuging at 8000rpm for 2min, pouring out waste liquid in a collecting pipe, and putting the adsorption column CP6 back into the collecting pipe again;
9) Repeating the operation step 8);
10 3mL of absolute ethyl alcohol is added into the adsorption column CP6, the centrifugation is carried out for 2min at 8000rpm at 25 ℃, and the waste liquid in the collection tube is poured out;
11 Placing the adsorption column CP6 back into the collecting pipe again, centrifuging at 8000rpm for 5min, and removing residual rinse liquid;
12 Placing the adsorption column CP6 into a clean 50mL centrifuge tube, suspending and dripping 2mL of elution buffer solution TB into the middle part of the adsorption film, placing for 5min at 25 ℃, and centrifuging for 2min at 8000rpm at 25 ℃;
13 2.84mL of isopropyl alcohol and 0.84mL of 5M NaCl were added to a 50mL centrifuge tube containing the centrifuged liquid, mixed well, left at 25℃for 5min, centrifuged at 8000rpm for 10min, and the supernatant was carefully discarded;
14 1mL of 70% ethanol is added to wash the precipitate, the precipitate is centrifuged at 8000rpm at 25 ℃ for 5min, and the ethanol is carefully discarded;
15 Repeating operation 14);
16 Drying the precipitate at 25deg.C for about 30min, adding 300 μl ddH 2 O, making the precipitate completely dissolved, transferring the precipitate into a 1.5mL centrifuge tube for storage;
17 Enzyme-labeled instrument for detecting concentration.
3. Sequencing and identifying pNL4-3-EGFP-partVSVg plasmid, wherein the position of the inserted fragment EGFP-VSVg on the vector is 10298-11138, and sequencing and sequence alignment are consistent.
Example 2
This example uses the pNL4-3-EGFP-partVSVg plasmid prepared in example 1 to prepare a virus (HIV-1-HD EGFP).
Day before transfection, 2X 10 6 293T cells of (E) are inoculated intoIn T25 flasks, the cell supernatant was discarded 1h prior to transfection, 8mL of 293T cell maintenance fluid was added and placed in an incubator, and each T25 flask was configured with the transfection system as follows: adding 10 mu g of pNL4-3-EGFP-partVSVg plasmid into 150 mu L of serum-free DMEM medium, uniformly mixing and marking as A solution; adding 30 mug PEI into 150 mug serum-free DMEM culture medium, uniformly mixing, marking as solution B, standing for 5min, adding solution B into solution A, uniformly mixing, standing for 20min, adding into a T25 culture flask, placing into a culture box, discarding the culture medium after 5h, adding 10ml of PBS for cleaning once, adding 293T cell maintenance solution, placing into the culture box, collecting virus supernatant the next day, and storing at 4 ℃; on the third day, the viral supernatant was collected and combined with the first viral supernatant, FBS was added to a final concentration of 10% and filtered through a 0.45 μm filter and split into 2mL frozen vials at 1mL per branch.
Example 3
This example measures the virus titer prepared in example 2.
Taking out HIV-1-HD EGFP virus (prepared in example 2), labeling EP tube according to 1E-1,1E-2,1E-3,1E-4,1E-5, adding 450 μl of 1640 culture medium containing 10% FBS, mixing HIV-1-HD EGFP virus with a pipette, adding 50 μl of EP tube labeled 1E-1, and mixing; the mixture was diluted 10-fold in sequence to 1E-5 dilution, the density of the C8166 cells was adjusted to 1E5/mL, the mixture was added to a 48-well plate at 450. Mu.L/well, 50. Mu.L of the mixture was taken out from the EP tube labeled 1E-1 to 1E-5 and added to the microwell of the 48-well plate, to which 450. Mu. L C8166 cells were added in advance, and 6 duplicate wells were added for each concentration, and the results are shown in Table 1.
TABLE 1
| Compound hole 1 | Multiple hole 2 | Multiple hole 3 | Multiple holes 4 | Multiple hole 5 | Multiple hole 6 | Number of positive wells | |
| 1E-1 | + | + | + | + | + | + | 6/6 |
| 1E-2 | + | + | + | + | + | + | 6/6 |
| 1E-3 | + | + | + | + | + | + | 6/6 |
| 1E-4 | + | + | + | + | - | + | 5/6 |
| 1E-5 | - | + | - | - | - | - | 1/6 |
The calculation formula is as follows: TCID50 (IU/mL) = (5/6)/(1E-4)/0.05= 1.67E5 (IU/mL) of positive well number of B concentration/dilution of positive well number of a concentration/volume of B (B concentration: concentration next to maximum dilution of holocene, a concentration: concentration of maximum dilution of holocene).
Example 4
The present embodiment provides a workflow for RCL detection, including:
(1) Taking the viruses prepared in the example 2 as positive control viruses, respectively taking positive control viruses 5CCID and 50CCID to incubate with susceptible indicator cells C8166, taking uninfected C8166 cells as negative control, carrying out cell passage when a cell culture solution starts to turn yellow, respectively taking supernatants at the 2 nd generation, the 4 th generation and the 6 th generation (amplification period), detecting P24 protein by using colloidal gold and an ELISA method, taking EGFP under a C8116 cytoscope, detecting psi-gag by using a PCR method and detecting VSVgVg expression by using a QPCR method;
(2) Taking the cell supernatant which is passaged to the sixth generation, re-inoculating to new C8166 cells, transferring the cells to the second generation (indication period), sampling and detecting;
(3) If the C8166 cells added with the positive virus control die due to the massive expansion of the virus, the culture supernatant is transfected with new C8166 cells until the 6 th generation, and the supernatant is transfected with new C8166 cells.
Example 5
This example detects EGFP expression.
The results of taking C8166 cells in the amplification stage and the indication stage of 5CCID positive control virus infection, observing EGFP expression condition under a fluorescent screen and photographing are shown in the figure 1, wherein the C8166 cells in the amplification stage and the indication stage obviously express GFP, which shows that the positive control virus prepared by the invention can be rapidly detected and identified.
Example 6
The invention adopts a colloidal gold method to detect the P24 protein.
Taking out the slow virus vector (HIV P24) from the package, rapidly detecting the card (BF06202-1000, botelong, suzhou), sucking 100 μl of culture supernatant by a pipette, adding into a sample hole, standing for 10min, and judging the result: 1. the control line (C) and the detection line (T) in the detection window are both developed to be positive; 2. the quality control line (C) develops color, and the detection line (T) does not develop color and is negative; 3. the quality control line (C) does not develop color, and is invalid in detection; as a result, as shown in FIG. 2, the positive control viruses of 5CCID and 50CCID in example 4 infected C8166 cells were cultured, and the expression of P24 was clearly detected both in the expansion phase and in the index phase.
Example 7
In this example, the P24 protein was detected by ELISA.
The expression level of P24 in the supernatant was detected using an Abcam HIV 1P 24ELISA kit (cat# ab 218268) as follows:
(1) Preparing a 1.5mL centrifuge tube rack, placing a plurality of 1.5mL centrifuge tubes, diluting the Sample solution to be tested into the standard curve range by using Sample DiluentNS diluent according to the requirement, and marking;
(2) The standard dry powders were diluted with Sample Diluent NS to 300pg/mL, 150pg/mL, 75pg/mL, 37.5pg/mL, 18.75pg/mL, 9.38pg/mL, 4.69pg/mL, respectively, and the dilutions were chosen as 0pg/mL. Appropriate amounts of 10 XCaptureAntibody and 10 XDetector Antibody were mixed and diluted with Antibody Diluent Antibody reagent 5 BI;
(3) Calculating the number of the required enzyme-labeled coated plates according to the number of the test products and the standard products, and adding 0pg/mL, 4.69pg/mL, 9.38pg/mL, 18.75pg/mL, 37.5pg/mL, 75pg/mL, 150pg/mL, 300pg/mL of the P24 protein standard product and the diluted test products into the micropores of the enzyme-labeled plates according to 50 mu L/hole (2 holes are repeated for each standard product and 2 holes are repeated for the test products) in sequence;
(4) Add Antibody Cocktail: add Antibody Cocktail already configured: 50 mu L/hole, gently shaking and mixing, and sealing plate;
(5) Sealing the micropore plate by using a sealing plate film, and incubating for 1h at 25 ℃;
(6) Carefully uncovering the sealing plate membrane, forcefully spin-drying the waste liquid in the plate holes, adding washing liquid at 350 mu L/hole, standing for 15s, and spin-drying;
(7) Repeating the above operation for 3 times, and drying the waste liquid by beating with absorbent paper;
(8) 100 mu L of color reagent TMB is added into each hole, and the mixture is placed at 25 ℃ and developed for 10min in a dark place;
(9) 100. Mu.L of stop solution was added to each well to terminate the reaction. At this time, the wells containing P24 protein were changed from blue to yellow, and the absorbance (OD 450 nm) of the samples was measured with a microplate reader at a wavelength of 450nm within 15 min.
As shown in Table 2, the concentrations of P24 in the supernatant of C8166 cells were greater than 300pg/mL in the positive control virus-infected groups of 5CCID and 50CCID in example 4.
TABLE 2
Example 8
The present example extracts the genome of C8166 cells.
The genome of C8166 cells was extracted using the Tiangen blood/tissue/cell genome extraction kit (cat# DP 304-02) as follows:
(1) Taking 1mL of collected cells 12,00 Xg, centrifuging for 5min, and discarding the supernatant;
(2) Opening a constant-temperature oscillating water tank for metal bath, setting the temperature to 70 ℃ for subsequent experiments;
(3) Adding 200 mu L/tube of GA buffer solution, oscillating until the cells are uniformly distributed and are in a single state;
(4) Adding 20 mu L of protease K/tube, and shaking and mixing for 15s;
(5) Adding 200 mu L/pipe of GB buffer solution, shaking and uniformly mixing for 15s, moving a 1.5mL centrifuge tube onto a foam plate, and placing the foam plate in a 70+1 ℃ metal bath constant-temperature shaking water tank for 10min;
(6) Adding 200 mu L/pipe of absolute ethyl alcohol, shaking and mixing for 15s;
(7) Placing an adsorption column CB3 into a collecting pipe, marking a cover by using a marker pen, transferring the obtained solution into the adsorption column, centrifuging for 1min at 12,000Xg, and discarding the waste liquid;
(8) Adding 500 mu L GD buffer solution into an adsorption column respectively, centrifuging for 1min at 12,000Xg, and discarding waste liquid;
(9) Adding 600 mu LPW rinse solution into the adsorption column, centrifuging for 1min at 12,000Xg, and discarding the waste liquid;
(10) Repeating the steps;
(11) Centrifuging the collecting tube placed in the adsorption column again at 12,000Xg for 1min, placing the adsorption column in a clean 1.5mL centrifuge tube, and standing at 25deg.C for 8min;
(12) 100 mu L of TE buffer is added to the middle part of the adsorption film, the solution is placed at 25 ℃ for 8min, and centrifuged for 2min at 12,000Xg, the adsorption column is discarded, namely, the solution is collected into a new 1.5mL centrifuge tube, and the absorbance at the wavelength of 260nm is detected for quantification.
Example 9
The present example uses PCR to detect the psi-gag gene copy number.
(1) Referring to the method described in example 8, the genome of the C8166 cells infected in example 4 was extracted as a template for PCR amplification, the reaction system was as shown in Table 3, the forward primer was GrecF1 (CAGGACTCGGCTTGCTGAA), the reverse primer was GrecR1 (GGTGATATGGCCTGATGTACCA), and a plasmid containing psi-gag was used as a positive control.
TABLE 3 Table 3
| Additive component | Volume (mu L) |
| 2×Hieff PCR Master Mix | 25 |
| Forward primer | 1.0 |
| Reverse primer | 1.0 |
| Template | 2 |
| Water for PCR reaction | 21 |
(2) After the sample was applied, the sample was run on a PCR instrument as follows: denaturation at 94℃for 5min, then denaturation at 94℃for 30s, annealing at 60℃for 30s, and extension at 72℃for 40s, followed by a total of 35 cycles; extending at 72℃for 10min.
(3) The PCR products were electrophoresed on a 1% agarose gel, and after the completion, the agarose gel was subjected to photographic analysis by a gel imager.
As shown in FIG. 3, lanes 1, 10, 11 and 15 are markers, lane 2 is a blank, lanes 5 and 6 are the detection of passage 2 of positive viruses of 5CCID and 50CCID, lanes 7 and 9 are the detection of passage 4 of positive viruses of 5CCID and 50CCID, lanes 8 and 12 are the detection of passage 6 of positive viruses of 5CCID and 50CCID, and lanes 13 and 14 are the detection of passage 2 of positive viruses of 5CCID and 50 CCID. It can be seen that the psi-gag gene was detected in the genome after infection of C8166 cells with positive control viruses of 5CCID and 50CCID in example 4, either during the amplification stage or during the indicated stage.
Example 10
In this example, the QPCR method was used to detect the VSVg gene.
The VSVg gene in the genome of the infected C8166 cells of example 4 was detected using a TAKARA Premix Ex Taq (Probe qPCR) kit (cat# RR 390A) as follows:
(1) VSVg plasmid standard dilution
(1) Taking out a standard product for gradient dilution, preparing a 1.5mL centrifuge tube rack, placing 8 1.5mL centrifuge tubes, marking the centrifuge tubes as A1E+11, A1E+10, A1E+09, A1E+08, A1E+07, A1E+06 and A1E+05 in sequence, and adding 72 mu L of sterilization injection water or ultrapure water into the centrifuge tubes A1E+11, A1E+10, A1E+09, A1E+08, A1E+07, A1E+06 and A1E+05;
(2) to A1E+11 tubes were added 8. Mu.L of 10 strength 12 copy/mL of plasmid standard containing VSVg and shake 15s; then 8 μl was aspirated from the a1e+11 tubes and added to the a1e+10 tubes, and the above procedure was repeated until a1e+05 tubes;
(2) The VSV-G detection qPCR reaction system is shown in Table 4, the reaction procedure is shown in Table 5, and the forward primer is VSVF1 (TGCAAGGAAAGCATTGAACAA); the reverse primer is VSVR1 (GAGGAGTCACCTGGACAATCACT); the probe is VSVP (6 FAM-AGGAACTTGGCTGAATCCAGGCTTCC-TAMRA);
TABLE 4 Table 4
| Additive component | Volume (mu L) |
| Premix Ex Taq(Probe qPCR) | 10 |
| Forward direction guideArticle (B) | 0.4 |
| Reverse primer | 0.4 |
| Probe with a probe tip | 0.8 |
| Template | 2 |
| Water for PCR reaction | 6.4 |
TABLE 5
As shown in Table 6, the C8166 cells infected with the positive control virus of example 4 had higher copy number of VSVg in the genome in both the amplification stage and the indication stage>10 7 cobites/. Mu.g genome).
TABLE 6
Example 11
The present example analyzes the limit of detection of infection.
Taking 1CCID positive virus to infect C8166 cells, infecting 24 samples, and after infection, carrying out CO 2 Culturing in an incubator for 2 to 5 days, supplementing liquid according to the growth condition of cells, and periodically observing the fluorescent expression condition of the cells. After the culture period is finished, C8166 cell fluorescence expression is checked, supernatant is taken to detect P24 protein expression by a colloidal gold method and an ELISA method, and genome is extracted to detect psi-gag and VSV-G expression.
If the psi-gag, VSV-G, GFP, P24 colloidal gold and P24ELISA5 of the same sample are positive, judging that the sample is positive; considering that GFP and P24 are both detection of protein expression levels, if GFP, P24 colloidal gold and P24ELISA3 of the same sample are positive, the sample can be judged to be positive; since the detection limit of the P24ELISA was 4.688pg/mL, when the 2 items of GFP and P24 colloidal gold were negative, the result of the P24ELISA was positive, and the sample was also judged to be positive.
At least 95% of the CCID required 1 was detectable and the validation data is shown in Table 7.
TABLE 7
* The positive result of 1CCID is 23/24, which is judged by two detection items of GFP and P24 colloidal gold; the positive result of 1CCID is 24/24 as judged by P24ELISA test.
Judging by using two detection items of GFP and P24 colloidal gold, wherein the positive result of 1CCID is 23/24, and the detection limit is 1CCID; the positive result of 1CCID is 24/24 and the detection limit is 1CCID according to the judgment of P24ELISA detection item. Since the detection limit of the P24 colloidal gold is 1ng/mL and the detection limit of the ELISA method of the P24 is 4.688pg/mL, whether the sample is positive or not can be judged by using the GFP and P24 colloidal gold experimental results, and if the GFP and P24 colloidal gold results are negative, whether the sample is positive or not can be finally judged by using the ELISA result of the P24. If the ELISA result of P24 is positive, the sample is judged to be positive, and if the ELISA result of P24 is negative, the sample is judged to be negative.
In summary, the recombinant expression vector for detecting the replication-competent viruses with a specific structure is designed, so that the recombinant expression vector is favorable for rapid detection, can be further used for preparing replication-competent viruses, is favorable for improving detection efficiency, sensitivity, accuracy and convenience as a positive reference substance for RCL detection, can be suitable for various detection methods, and has more reliable detection results and higher safety.
The applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.
Claims (5)
1. The application of the recombinant expression vector, the recombinant cell or the recombinant virus for the replication type virus detection in preparing a positive control substance for the replication type virus detection;
the recombinant expression vector for replication type virus detection is a virus vector containing a coding gene of fluorescent protein and a coding gene of herpesvirus G protein;
the recombinant cell contains the recombinant expression vector for replication type virus detection;
the recombinant virus contains the recombinant expression vector for replication type virus detection;
the encoding gene of the herpesvirus G protein is as follows: primer c: cgagctgtacaagtgatgcaaggaaagcattg and primer d: caggtcgactctagaggatccctcgaggaggagtcacctggac, PCR amplification is carried out by taking the nucleic acid sequence SEQ ID NO.2 as a template.
2. A replication competent virus detection kit comprising any one or a combination of at least two of the recombinant expression vectors, recombinant cells or recombinant viruses for replication competent virus detection as defined in claim 1.
3. The replication competent virus detection kit of claim 2, characterized in that the kit further comprises a primer probe combination;
the primer probe combination consists of a primer group 1, a primer group 2 and a probe;
the nucleic acid sequences of the primer group 1 are shown as SEQ ID NO.3 and SEQ ID NO. 4;
the nucleic acid sequences of the primer group 2 are shown as SEQ ID NO.5 and SEQ ID NO. 6;
the nucleic acid sequence of the probe is shown as SEQ ID NO. 7.
4. The recombinant expression vector, recombinant cells or recombinant viruses used for the replication type virus detection are used as positive control substances in the replication type virus detection;
the recombinant expression vector for replication type virus detection is a virus vector containing a coding gene of fluorescent protein and a coding gene of herpesvirus G protein;
the recombinant cell contains the recombinant expression vector for replication type virus detection;
the recombinant virus contains the recombinant expression vector for replication type virus detection;
the encoding gene of the herpesvirus G protein is as follows: primer c: cgagctgtacaagtgatgcaaggaaagcattg and primer d: caggtcgactctagaggatccctcgaggaggagtcacctggac, PCR amplification is carried out by taking the nucleic acid sequence SEQ ID NO.2 as a template.
5. A method of detecting a replication competent virus, the method comprising:
a method for detecting a replication competent virus, comprising preparing a virus using the recombinant expression vector for replication competent virus according to claim 4, and detecting the replication competent virus using the virus as a positive control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210891936.2A CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210891936.2A CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115717155A CN115717155A (en) | 2023-02-28 |
| CN115717155B true CN115717155B (en) | 2023-11-14 |
Family
ID=85253890
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210891936.2A Active CN115717155B (en) | 2022-07-27 | 2022-07-27 | Recombinant expression vector for replication type virus detection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115717155B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877474A (en) * | 2021-02-19 | 2021-06-01 | 北京鼎成肽源生物技术有限公司 | Primer group, kit and method for detecting replication type virus in gene modified cell mediated by lentivirus |
| CN113667773A (en) * | 2021-08-19 | 2021-11-19 | 南昌艾迪康医学检验实验室有限公司 | Primer, probe and kit for detecting whether RCL (Rich cell line) pollution exists in CarT cells |
| CN113789345A (en) * | 2021-08-11 | 2021-12-14 | 康美润源(北京)生物技术有限公司 | Kit for detecting replication-competent lentivirus (RCL) and application thereof |
-
2022
- 2022-07-27 CN CN202210891936.2A patent/CN115717155B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877474A (en) * | 2021-02-19 | 2021-06-01 | 北京鼎成肽源生物技术有限公司 | Primer group, kit and method for detecting replication type virus in gene modified cell mediated by lentivirus |
| CN113789345A (en) * | 2021-08-11 | 2021-12-14 | 康美润源(北京)生物技术有限公司 | Kit for detecting replication-competent lentivirus (RCL) and application thereof |
| CN113667773A (en) * | 2021-08-19 | 2021-11-19 | 南昌艾迪康医学检验实验室有限公司 | Primer, probe and kit for detecting whether RCL (Rich cell line) pollution exists in CarT cells |
Non-Patent Citations (4)
| Title |
|---|
| A VSV-G pseudotyped HIV vector mediates efficient transduction of human pulmonary artery smooth muscle cells;S L Li等;《Microbiol Immunol》;参见摘要及第1020-1022页 * |
| CAR-T细胞治疗产品中复制型病毒的风险分析及控制;吴雪伶等;《中国药事》;参见全文 * |
| Detection of Replication Competent Lentivirus Using a qPCR Assay for VSV-G;Lindsey M Skrdlant等;《Mol Ther Methods Clin Dev》;参见全文 * |
| 复制能力慢病毒检测方法的研究进展;崔靖等;《中国新药杂志》;参见全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115717155A (en) | 2023-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shioda et al. | Production of human immunodeficiency virus (HIV)-like particles from cells infected with recombinant vaccinia viruses carrying the gag gene of HIV | |
| Courcoul et al. | Peripheral blood mononuclear cells produce normal amounts of defective Vif-human immunodeficiency virus type 1 particles which are restricted for the preretrotranscription steps | |
| Marthas et al. | Titration of an SIVmac251 stock by vaginal inoculation of Indian and Chinese origin rhesus macaques: transmission efficiency, viral loads, and antibody responses | |
| CN103074446B (en) | Human immunodeficiency virus (HIV) nucleic acid detection kit | |
| Debbink et al. | Human Norovirus Detection and Production, Quantification, and Storage of Virus‐Like Particles | |
| Luan et al. | Development of a real-time quantitative RT-PCR to detect REV contamination in live vaccine | |
| Quinlivan et al. | Real‐time quantitative RT‐PCR and PCR assays for a novel European field isolate of equine infectious anaemia virus based on sequence determination of the gag gene | |
| CN111575245A (en) | Novel coronavirus pseudovirus, preparation method and application thereof | |
| CN114075553B (en) | Pseudo virus particle used for evaluating activity of neutralizing antibody of novel coronavirus and serving as nucleic acid detection standard and preparation method thereof | |
| Rein et al. | A replication-defective variant of Moloney murine leukemia virus. I. Biological characterization | |
| Porzig et al. | Cellular regulation of mammalian sarcoma virus expression: a gene regulation model for oncogenesis | |
| CN115717155B (en) | Recombinant expression vector for replication type virus detection and application thereof | |
| CN111925998A (en) | System for simulating SARS-CoV-2 infection and its preparation method and application | |
| Sakaguchi et al. | Establishment of a LacZ marker rescue assay to detect infectious RD114 virus | |
| Rulli Jr et al. | Mutant murine leukemia virus Gag proteins lacking proline at the N-terminus of the capsid domain block infectivity in virions containing wild-type Gag | |
| Nadin-Davis et al. | Detection of bovine immunodeficiency-like virus by the polymerase chain reaction | |
| Lichtensteiger et al. | Recombinant gpl35 envelope glycoproteins of caprine arthritis-encephalitis lentivirus variants inhibit homologous and heterologous variant-specific neutralizing antibodies | |
| Gutiérrez et al. | 18 Bovine Leukemia Virus | |
| US20150197803A1 (en) | Method for Detecting or Measuring the Impact of a Viral Vector Composition on Eukaryotic Cells and Biomarkers Used Thereof | |
| Soezi et al. | Toward the development of a single-round infection assay based on EGFP reporting for anti-HIV-1 drug discovery | |
| Aaronson et al. | Viral genes involved in leukemogenesis. I. Generation of recombinants between oncogenic and nononcogenic mouse type-C viruses in tissue culture. | |
| CN117230258B (en) | EB virus detection method of culture amplification combined PCR for improving sensitivity | |
| O'Neill et al. | Propagation of archetype and nonarchetype JC virus variants in human fetal brain cultures: demonstration of interference activity by archetype JC virus | |
| Renner et al. | Retroviral Capsid Core Stability Assay | |
| CN118064505A (en) | Pseudo virus of monkey immunodeficiency virus, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |