CN115678805B - Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects - Google Patents
Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects Download PDFInfo
- Publication number
- CN115678805B CN115678805B CN202211364506.1A CN202211364506A CN115678805B CN 115678805 B CN115678805 B CN 115678805B CN 202211364506 A CN202211364506 A CN 202211364506A CN 115678805 B CN115678805 B CN 115678805B
- Authority
- CN
- China
- Prior art keywords
- tricholoma matsutake
- saccharomyces cerevisiae
- yeast fermentation
- yeast
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method of tricholoma matsutake yeast fermentation liquor with an anti-aging repairing effect, which comprises the following steps: s1, inoculating saccharomyces cerevisiae into an appliance filled with YPD liquid culture medium; s2, introducing air, sealing, and culturing overnight by shaking to obtain Saccharomyces cerevisiae seed liquid; s3, preparing Cheng Songrong powder from the pine mushroom fruiting bodies; s4, adding the pine mushroom fine powder into Saccharomyces cerevisiae seed liquid; s5, purifying the fermented stock solution after fermentation; the preparation method of the tricholoma matsutake yeast fermentation liquid has simple process, can effectively utilize saccharomycetes to ferment the tricholoma matsutake raw material and reprocess bioactive components, and has mild reaction conditions; the prepared tricholoma matsutake yeast fermentation liquid can effectively utilize saccharomycetes to ferment tricholoma matsutake raw materials and reprocess bioactive components, the reaction conditions are mild, and the components can be added into cosmetics to give skin regeneration activity; the Tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and has no addition, safety and no irritation.
Description
Technical Field
The invention relates to the technical field of cosmetics, in particular to a preparation method and application of tricholoma matsutake yeast fermentation liquid with repairing and anti-aging effects.
Background
With the rapid increase of cosmetic consumption in recent years, the frequency of improper use or disqualified use of products by consumers is increased, and in addition, in recent years, a plurality of factors such as climate warming, environmental pollution, pressure increase of working life and the like cause the skin horny layer of many consumers to be damaged in a dispute way, the skin barrier function is destroyed, the skin is developed into sensitive skin which is often dry and itchy, stinging, red swelling and redness, the skin is possibly difficult to cure in a serious way, and the pure natural cosmetic raw materials with the effects of resisting inflammation, oxidation, irritation, aging and the like are the primary choice for effectively relieving the skin problems.
The tricholoma matsutake, also called tricholoma matsutake, agaricus blazei, tricholoma matsutake and the like, is a rare pure natural edible fungus, is rich in nutrition, contains various proteins, amino acids, nucleotides, unsaturated fatty acids, polysaccharides, vitamins and other components, and has the effects of scavenging free radicals, resisting radiation, resisting inflammation, resisting stimulation, resisting oxidation, resisting aging, resisting cancer and the like. Some cosmetics containing tricholoma matsutake extracts are currently available on the market, but as the tricholoma matsutake extracts are generally prepared by adopting the traditional high-temperature steaming and water extraction, organic solvent extraction and other processes, not only the effective active ingredients of the tricholoma matsutake can be seriously damaged, but also a large amount of organic solvent residues can be caused; and because the tricholoma matsutake is expensive, the addition amount of most tricholoma matsutake extract products is very small, and the real effect of the tricholoma matsutake extract products is difficult to be exerted; the products with a small amount of addition are expensive, and most common consumers cannot bear the products, so that the popularization and the shelf life of the application of the products are limited.
The present invention aims to solve at least one of the technical problems in the prior art described above. Therefore, the preparation method and the application of the tricholoma matsutake yeast fermentation liquid with the repairing and anti-aging effects and the application example in cosmetics are provided, the tricholoma matsutake raw material can be effectively utilized for fermentation and reprocessing of bioactive components by using the saccharomyces cerevisiae, the reaction condition is mild, no additional chemical reagent is needed, various natural active components in the tricholoma matsutake raw material can be reserved to the maximum extent, and a large amount of active substances such as beta-glucan and protein which are special to the yeast are generated in the yeast fermentation process, so that the efficacy of the tricholoma matsutake raw material can be obviously enhanced; the cosmetic can effectively relieve sensitive skin problems such as redness, itching, stinging, red swelling, etc. by adding appropriate amount of Tricholoma matsutake yeast fermentation liquor, and repair skin barrier function to recover skin to health state.
Disclosure of Invention
In view of the above, the present invention aims to provide a preparation method and application of tricholoma matsutake yeast fermentation broth with repairing and anti-aging effects.
In order to solve the technical problems, the technical scheme of the invention is as follows: a preparation method of tricholoma matsutake yeast fermentation broth with repairing and anti-aging effects is characterized by comprising the following steps:
s1, inoculating saccharomyces cerevisiae into an appliance filled with YPD liquid culture medium, wherein the saccharomyces cerevisiae is saccharomyces cerevisiae (Saccharomyces cerevisiae, CICC 1001) of China industry microbiological culture Collection center, and the appliance comprises a test tube, a shake flask, a fermentation tank and the like;
s2, introducing air and sealing, shake culturing for 1-2 days at a temperature of 28-32 ℃ by a shaking table at 200-250 rpm, and shake culturing overnight to obtain Saccharomyces cerevisiae seed liquid;
s3, cleaning the tricholoma matsutake fruiting body, slicing, drying, sieving with a 50-mesh filter screen, crushing and sieving twice or more, and pulverizing into fine powder to obtain tricholoma matsutake powder;
s4, after the seed bacteria are cultured to the middle and later stages of the logarithmic growth phase, adding the pine mushroom fine powder into the saccharomyces cerevisiae seed liquid, and stirring and fermenting for 3-7 days at the temperature of 30 ℃;
s5, filtering, centrifuging or ultrasonically centrifuging the fermented stock solution to obtain Tricholoma matsutake yeast fermentation liquor;
and (3) filtering: filtering with gauze and 400 mesh sieve to obtain filtrate to obtain fermentation broth with high Tricholoma matsutake powder content;
and (3) centrifugal treatment: centrifuging at a high speed of 8000-10000 rpm for 20-30 min at 0-10deg.C to obtain supernatant to obtain fermentation broth with low Tricholoma matsutake powder content;
ultrasonic treatment: then ultrasonic treatment is carried out, filtration is carried out, and supernatant is remained after high-speed centrifugation treatment, thus obtaining fermentation liquor with low tricholoma matsutake powder content.
Preferably, in step S1, the preparation method of the YDPA liquid medium specifically includes:
s11, a YPD culture medium formula and preparation: weighing 20.0g Peptone,10.0g Yeast Extract, adding into about 800mL ddH2O, and stirring uniformly;
s12, respectively adding 20.0g of glucose, 3.0g of KH2PO4, 1.5g of MgSO4.7H2O and trace thiamine (Vit.B1) into 1.0L of 20% YPD culture medium obtained in the step S11, and uniformly stirring;
s13, using ddH2O to fix the volume to 1000mL, adjusting the pH to 5.8-6.0, sterilizing at 110-130 ℃ for 15-30 min under high pressure, and cooling to room temperature to obtain the YPD liquid culture medium.
Preferably, the saccharomycete is at least one of saccharomyces cerevisiae, pichia pastoris, rhodotorula rubra, candida, saccharomyces pastoris or combined rue, the liquid culture medium is YPD liquid culture medium, and the volume ratio of the saccharomycete to the liquid culture medium is 1-5:100, inoculating the yeast into the liquid culture medium under a sterile condition.
Preferably, the tricholoma matsutake powder comprises the following components in percentage by mass: 10-30% of tricholoma matsutake powder.
Preferably, the tricholoma matsutake powder is added into the saccharomyces cerevisiae seed liquid after the saccharomycetes are cultured to the logarithmic growth phase and the middle-late phase.
Preferably, the liquid medium is YPD liquid medium, and the liquid medium further comprises at least one of fructose, KH2PO4, mgSO4.7H2O, trace thiamine (Vit. B1) and agar.
Preferably, the liquid medium is autoclaved at 110-130℃for 15-25 min and cooled to room temperature or filtered through a 0.22 micron filter before being added to the apparatus.
Preferably, in step S4, the aeration-seal culture is specifically: after ventilation and sealing, shaking table shake rotation speed is 100-250 rpm at 28-32 ℃ for 7-15 days.
Preferably, the tricholoma matsutake yeast fermentation broth is obtained by filtering, centrifuging or ultrasonic centrifuging twice or more, and decolorizing and deodorizing.
Preferably, the tricholoma matsutake yeast fermentation liquid with the efficacy of repairing and resisting aging can be used as any one of additives of cosmetic essence, emulsion, toner, face cream and facial mask.
The invention has the technical effects that: (1) The preparation method of the tricholoma matsutake yeast fermentation liquid has simple process, can effectively utilize saccharomycetes to ferment the tricholoma matsutake raw material and reprocess bioactive components, has mild reaction conditions, does not need to additionally add chemical reagents, can reserve various natural active components in the tricholoma matsutake raw material to the maximum extent, can generate a large amount of active substances such as beta-glucan, protein and the like peculiar to the saccharomycetes in the yeast fermentation process, can obviously enhance the efficacy of the tricholoma matsutake raw material, has small technical difficulty, saves energy and labor, and has high production efficiency;
(2) The tricholoma matsutake yeast fermentation liquor has high protein content and strong activity, has obvious antioxidant and anti-inflammatory effects, can ensure skin regeneration activity by adding the component into cosmetics, has good hydrophilicity and lipophilicity, can increase skin luster after being used, has high efficiency, can resist oxidation, delay aging, prevent age-related skin elasticity loss, modify and improve facial contours, prevent or improve the appearance of orange peel, has antibacterial property, has a acne prevention and treatment effect on acne caused by high male hormone, can condition oily skin, helps damaged tissues heal and compact skin, and can promote the close connection between epidermis and dermis;
(3) The tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and is additive-free, safe and non-irritating.
Drawings
FIG. 1 is a flow chart showing a method for producing a fermentation broth of Tricholoma matsutake in example 1 of the present invention;
FIG. 2 is a graph showing growth curves of Saccharomyces cerevisiae in example 1 of the present invention;
FIG. 3 shows the DPPH radical scavenging rate of the Tricholoma matsutake yeast fermentation broths prepared in examples 1-3 and comparative examples 1-3 of the present invention;
FIG. 4 is a graph showing the relationship between the fermentation broth of Tricholoma matsutake yeast and HaCaT cell proliferation obtained in examples 1-3 and comparative examples 1-3;
FIG. 5 is a graph showing the relative expression levels of COX-2 gene and Tricholoma matsutake yeast fermentation broth prepared in examples 1-3 and comparative examples 1-3;
FIG. 6 is a graph showing the relative expression levels of the fermentation broth of Tricholoma matsutake and IL-1. Alpha. Gene obtained in examples 1-3 and comparative examples 1-3;
FIG. 7 is a graph showing the relative expression levels of NF-kB genes and Tricholoma matsutake yeast fermentation broths prepared in examples 1-3 and comparative examples 1-3 of the present invention.
Detailed Description
The following detailed description of the invention is provided in connection with the accompanying drawings to facilitate understanding and grasping of the technical scheme of the invention.
In this embodiment, it should be understood that the directions or positional relationships indicated by the terms "middle", "upper", "lower", "top", "right", "left", "upper", "back", "middle", etc. are based on the directions or positional relationships shown in the drawings, are merely for convenience of description of the present invention, and do not indicate or imply that the apparatus or elements referred to must have a specific direction, be configured and operated in a specific direction, and thus should not be construed as limiting the present invention.
In this embodiment, if not specifically described, the members may be connected or fixed by bolts, pins, or the like, which are commonly used in the prior art, and therefore, the details thereof will not be described in this embodiment.
Example 1
Referring to fig. 1, the embodiment provides a preparation method of tricholoma matsutake yeast fermentation broth, which comprises the following steps:
s1, inoculating saccharomyces cerevisiae into an apparatus filled with YPD liquid culture medium, wherein the yeast is at least one of saccharomyces cerevisiae, pichia pastoris, rhodotorula ruber, candida, saccharomyces pastoris or combined rue, and the apparatus comprises a test tube, a shake flask, a fermentation tank and the like;
specifically, the saccharomycete is preferably saccharomyces cerevisiae (Saccharomyces cerevisiae, CICC 1001) of China industry microbiological culture Collection center, and the inoculation volume ratio of the YPD liquid culture medium to the saccharomycete is preferably 100:1-5. Saccharomyces cerevisiae is inoculated in YPD liquid culture medium under aseptic condition, avoids introducing other strains and adding other additional chemical reagents in the inoculation process, thereby being beneficial to ensuring that the nutrient components in the Tricholoma matsutake yeast fermentation broth are clear in sources and have a good value.
S2, introducing air and sealing, shake culturing for 1-2 days at a temperature of 28-32 ℃ by a shaking table at 200-250 rpm, and shake culturing overnight to obtain Saccharomyces cerevisiae seed liquid;
specifically, after air is introduced and sealed, shaking culture is carried out for 1 day at a temperature of 30 ℃ and a shaking table at 230rpm, so that Saccharomyces cerevisiae is rapidly proliferated, 1mL of bacterial liquid is sampled every 2 hours, the absorbance at 600nm is measured after proper dilution, and then the absorbance of the yeast cells is taken as an ordinate, the growth time is taken as an abscissa, and a growth curve is drawn.
S3, cleaning the tricholoma matsutake fruiting body, slicing, drying, sieving with a 50-mesh filter screen, crushing and sieving twice or more, and pulverizing into fine powder to obtain tricholoma matsutake powder;
specifically, the pine mushroom fruiting body is dried, decontaminated and crushed into powder, then the powder passes through a 50-mesh filter screen, and the times of crushing and sieving are more than or equal to two times, so that the pine mushroom is crushed more uniformly, the utilization rate of intracellular nutrients is greatly improved, the content of extracellular active ingredients is increased, and the yield of active substances is effectively improved.
S4, adding the pine mushroom fine powder into the saccharomyces cerevisiae seed liquid according to the addition amount of 10-30% after the saccharomyces cerevisiae seed bacteria are cultured to the middle and later stages of the logarithmic growth phase, and stirring and fermenting for 3-7 days at the temperature of 28-32 ℃ and at the speed of 200-250 rpm;
specifically, selecting Saccharomyces cerevisiae seed liquid cultured to the late stage of logarithmic growth phase according to the growth curve drawn in S2, weighing 20% of Tricholoma matsutake powder, adding into the liquid, stirring and fermenting at 30deg.C for 3-7 days;
s5, treating the fermented stock solution after fermentation to obtain the tricholoma matsutake yeast fermentation liquor.
Specifically, the fermented stock solution is subjected to filtration, centrifugation or ultrasonic centrifugation. If the filtering treatment is carried out, gauze filtering and a 400-mesh screen are adopted for filtering and collecting filtrate, and the fermentation liquor with higher tricholoma matsutake powder content is obtained. If the centrifugation is carried out, the high-speed centrifugation at 8000-10000 rpm at 0-10 ℃ is carried out for 20-30 min to obtain the supernatant, and the fermentation liquor with less tricholoma matsutake powder is obtained. If the ultrasonic treatment is carried out first, then the filtration and the high-speed centrifugation are carried out, and the supernatant is left, the fermentation liquor with less tricholoma matsutake powder is obtained. In addition, the steps of activated carbon or macroporous resin for color removal and deodorization can be added according to different requirements of cosmetic manufacturers.
Therefore, the preparation method of the tricholoma matsutake yeast fermentation liquid of the embodiment utilizes the synergistic fermentation of the saccharomyces cerevisiae and the tricholoma matsutake powder, and sequentially carries out the treatment steps of high-pressure homogenization, ultrasonic crushing, high-speed centrifugation, color removal, deodorization and the like to obtain the tricholoma matsutake yeast fermentation liquid. In addition, the tricholoma matsutake yeast fermentation liquor has remarkable antioxidant and anti-inflammatory effects, can promote the proliferation and autophagy of HaCaT cells, and has extremely low or no toxicity to the HaCaT cells and Raw264.7 cells.
Further, the YDP liquid medium comprises common peptone and yeast powder, and further comprises at least one of glucose, KH2PO4, mgSO4.7H2O, trace thiamine (Vit. B1) and agar.
In this example, the preparation method of the YDPA liquid medium is as follows:
(1) YPD medium formula and preparation: weighing 20.0g Peptone,10.0g Yeast Extract, adding into about 800mL ddH2O, and stirring uniformly;
(2) Adding 20.0g g glucose, 3.0g KH2PO4, 1.5g MgSO4.7H2O and trace thiamine (Vit. B1) into 1.0L of 20% YPD medium obtained in the step (1), and uniformly stirring;
(3) And (3) fixing the volume to 1000mL by using ddH2O, regulating the pH to 5.8-6.0, sterilizing at 110-130 ℃ for 15-30 min under high pressure, and cooling to room temperature to obtain the YPD liquid culture medium. Thus, the mixed bacteria in the liquid culture medium are prevented from interfering the fermentation of the saccharomycetes by high-pressure sterilization for 15-30 min at the temperature of 110-130 ℃.
Further, the embodiment also provides a cosmetic, and the cosmetic uses the preparation method of the tricholoma matsutake yeast fermentation broth with the repairing and anti-aging effects.
Example 2
The difference between this example and example 1 is that in S3, after the Saccharomyces cerevisiae seed was cultured to the middle and late logarithmic growth phase, the fine powder of Tricholoma matsutake was added to the Saccharomyces cerevisiae seed solution in an amount of 10%, and the other parts were the same as in example 1.
Example 3
The difference between this example and example 1 is that in S3, after the Saccharomyces cerevisiae seed was cultured to the middle and late logarithmic growth phase, the fine powder of Tricholoma matsutake was added to the Saccharomyces cerevisiae seed liquid in an amount of 30%, and the other parts were the same as in example 1.
Comparative example 1
The present comparative example is different from example 1 in that step S3 is omitted, and the other parts are the same as example 1.
Comparative example 2
The present comparative example is different from example 1 in that step S4 is omitted, and the other parts are the same as example 1.
Comparative example 3
The comparative example was different from example 1 in that the fermentation broth of Tricholoma matsutake was boiled for 15 to 25 minutes, and the other parts were the same as in example 1.
Positive control group
250 mug/mL vitamin C
The following performance tests were performed on the mushroom fermentation broths in examples 1 to 3 and comparative examples 1 to 3:
(1) Protein content detection
The test method comprises the following steps: protein content was detected by BCA method under the following conditions: biyundian BCA protein concentration assay kit (P0012S).
A. Preparation of protein standards
a. 0.8ml of the protein standard preparation was added to a tube of protein standard (20 mg BSA) and after complete dissolution, 25mg/ml of protein standard solution was prepared. Can be used immediately after preparation, or can be stored at-20deg.C for a long time.
b. A proper amount of 25mg/mL protein standard was taken and diluted to a final concentration of 0.5mg/mL. For example, 20. Mu.L of 25mg/mL protein standard can be prepared by adding 980. Mu.L of diluent to prepare 0.5mg/mL protein standard. In what solution the protein sample is in, the standard is preferably diluted with what solution. However, for simplicity, the standard may also be diluted with 0.9% NaCl or PBS. The diluted 0.5mg/mL protein standard can be stored for a long period of time at-20 ℃.
B.BCA working solution preparation
And adding 1 volume of BCA reagent B (50:1) into 50 volumes of BCA reagent A according to the number of samples to prepare a proper amount of BCA working solution, and fully and uniformly mixing. For example, 5mL of BCA reagent A was added with 100. Mu.L of BCA reagent B, and mixed well to prepare 5.1mL of BCA working fluid. The BCA working solution was stable for 24 hours at room temperature.
C. Protein concentration determination
a. Standard substances are added into standard substance holes of a 96-well plate according to 0, 1, 2, 4, 8, 12, 16 and 20 mul, and standard substance diluent is added to be 20 mul, which is equivalent to the concentration of the standard substances of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4 and 0.5mg/ml respectively.
b. An appropriate volume of sample is added to the sample wells of a 96-well plate. If the sample is less than 20. Mu.l, the standard diluent is added to make up to 20. Mu.l. Note that the sample volume was recorded.
c. 200 μl BCA working fluid was added to each well and left at 37deg.C for 20-30 min.
d. Absorbance at a562, or other wavelengths between 540-595nm, was measured with a microplate reader.
e. The protein concentration of the sample was calculated from the standard curve and the sample volume used.
The test results are shown in Table 1.
TABLE 1 protein content of samples tested (mg/mL, mean.+ -. SD)
| Protein content | |
| Example 1 | 21.094±3.136 |
| Example 2 | 10.167±2.231 |
| Example 3 | 22.356±3.004 |
| Comparative example 1 | 0.318±3.136 |
| Comparative example 2 | 1.105±1.142 |
| Comparative example 3 | 8.613±3.136 |
As can be seen from Table 1, the protein content in examples 1-3 was significantly higher than that in comparative examples 1-3. Comparative example 1 omits matsutake powder, but the protein content in the fermentation broth is significantly reduced compared with example 1, indicating that the introduction of matsutake powder can significantly increase the protein content in the fermentation broth. Comparative example 2 omits the yeast fermentation, but the protein yield in the fermentation broth is obviously reduced, which indicates that the introduction of Saccharomyces cerevisiae can improve the protein biosynthesis amount of the fermentation broth. Comparative example 3 shows that the fermentation broth has a significantly lower protein content than that of example 1 by boiling for 15-25 min, which indicates that the Tricholoma matsutake yeast fermentation broth obtained by the invention is rich in various bioactive substances, and the boiling can cause protein denaturation, thereby significantly reducing the yield of the active substances in the fermentation broth.
(2) DPPH free radical scavenging Capacity experiment
The test method comprises the following steps: the Tricholoma matsutake yeast fermentation broths obtained in examples 1 to 3 and comparative examples 1 to 3 and the positive control VC were diluted with absolute ethanol to obtain a Tricholoma matsutake yeast fermentation broth solution having a concentration of 50% (v/v) as a sample. Respectively taking 400 mu L of the mixture into a 1.5ml centrifuge tube, adding 1200 mu L of 10 mu M DPPH solution, and carrying out light-shielding reaction for 30min at room temperature; 200. Mu.L of each tube was transferred to a 96-well plate, and the absorbance at 515nm was measured and recorded As. The blank control group uses absolute ethyl alcohol with the same volume to replace the tested sample, the result is recorded as A0, and the positive control group uses VC solution with the same volume and 100 mug/mL to replace the sample; the negative control group was replaced with the same volume of absolute ethanol As the DPPH solution, as0 was the result of the negative control group. The specific test results are shown in FIG. 3.
Wherein: absorbance of sample group A S The method comprises the steps of carrying out a first treatment on the surface of the The absorbance of the negative control group was A S0 The method comprises the steps of carrying out a first treatment on the surface of the Absorbance of the blank group was A 0 。
As can be seen from FIG. 2, the fermentation products of Tricholoma matsutake yeast prepared in examples 1-3 and comparative examples 1-3 all have a significant effect of scavenging DPPH free radicals as compared with the blank group. Example 2 the matsutake level was reduced from 20% to 10% compared to example 1, with a 20% reduction in DPPH radical scavenging capacity; example 3 the increase in the tricholoma matsutake level from 20% to 30% did not increase the DPPH radical scavenging ability, indicating that the tricholoma matsutake level below 20% increased with increasing concentration, with about 20% reaching a maximum. Comparative example 1 omits matsutake powder, and the DPPH free radical scavenging ability of the fermentation broth is obviously reduced compared with that of example 1, which shows that the introduction of matsutake powder can obviously improve the antioxidant ability of the fermentation broth of the fungus. Comparative example 2 omits the yeast fermentation, and the DPPH free radical scavenging capacity of the fermentation liquor is obviously reduced compared with that of example 1, which shows that the introduction of Saccharomyces cerevisiae can obviously improve the antioxidant capacity of the fermentation liquor. Comparative example 3 the fermentation broth was boiled and heated, and the DPPH radical scavenging ability of the fermentation broth was significantly reduced compared with example 1, indicating that the fermentation broth containing various active ingredients could significantly improve the oxidation resistance of the mushroom fermentation broth, resulting in a loss of activity upon heating.
(3) HaCaT cytotoxicity assay
The test method comprises the following steps: haCaT cells in logarithmic growth phase were harvested, digested with pancreatin, centrifuged (1000 rpm,5 min), counted and seeded at a density of 3X 103 cells/well in 96-well plates with 100. Mu.L of cell suspension per well. After 24h of plating, DMEM complete medium containing the tricholoma matsutake yeast fermentation products prepared in example 1 at different concentrations is added, DMEM complete medium is used as a blank control, 3 compound wells are arranged at each concentration, 10 mu L of CCK8 is added to each well after 48h, after 2h of incubation, absorbance is measured at 450nm with 630nm as a reference wavelength, and the measurement results are recorded, wherein the specific test results are shown in Table 2.
Wherein: absorbance of sample group A S,450nm -A S,630nm The method comprises the steps of carrying out a first treatment on the surface of the Absorbance of the blank group was A 0,450nm -A 0,630nm 。
Table 2 comparison of the effect of different concentrations of test samples on HaCaT cytotoxicity (mean, n=3
Note that: * Indicating a significant difference compared to the blank.
As can be seen from Table 2, the Tricholoma matsutake yeast fermentation broths prepared in examples 1-3 and comparative examples 1-3 of the present invention all have promoting effect on HaCaT cell viability at the measured volume fraction concentration (5-20%); the promotion effect is strongest at 10% volume fraction concentration, and slightly decreases at 20% volume fraction concentration. According to the judging standard of the European Union national laboratory cosmetic toxicity, the fermentation broth has very little or no toxicity to HaCaT cells in the determined concentration range.
(4) HaCaT cell proliferation assay
The test method comprises the following steps: the fungus mushroom fermentation broths obtained in examples 1 to 3 and comparative examples 1 to 3 were diluted to 10% (v/v) with DMEM basal medium, respectively, as test solutions. HaCaT cells in logarithmic growth phase were inoculated at 5X 104cells/mL, 100. Mu.L/well into 96-well cell culture plates, and cultured at 37℃in a 5% CO2 incubator for 24 hours; discarding the old culture medium, washing with PBS solution once, adding 100 μl of the test solution into each cell solution, adding a blank group of fetal bovine serum (20% FBS) into the positive control group, adding an equal volume of DMEM basal medium, and culturing at 37deg.C for 48 hr; 10 mu L of CCK8 solution is added into each hole, and incubated for 2 hours at a constant temperature and in a dark place at 37 ℃; the absorbance was measured at 450nm using 630nm as a reference wavelength, and the measurement results were recorded, and the specific test results are shown in FIG. 3.
Wherein: absorbance of sample group A S,450nm -A S,630nm The method comprises the steps of carrying out a first treatment on the surface of the Absorbance of the blank group was A 0,450nm -A 0,630nm 。
As can be seen from FIG. 3, the Tricholoma matsutake yeast fermentation broths prepared in examples 1-3 and comparative examples 1-3 at a concentration of 10% are non-toxic to HaCaT cells; has remarkable promoting effect on HaCaT cell proliferation, and the tricholoma matsutake yeast fermentation product of the embodiment 1 has the most remarkable promoting effect, and is slightly better than 20% fetal bovine serum of a positive control group.
(5) Raw264.7 cytotoxicity assay
Test materials: the fungus fermentation broths prepared in examples 1 to 3 and comparative examples 1 to 3 were DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution=89:10:1, v/v/v), pancreatin.
Test object: raw264.7 cells
The test method comprises the following steps: the results of the same HaCaT cytotoxicity assays except that the cells were replaced with raw264.7 cells and the plating density was replaced with 1 x 106cells/mL are shown in table 3.
Table 3 comparison of the effect of different concentrations of test samples on raw264.7 cytotoxicity (mean, n=3
Note that: * Indicating a significant difference compared to the blank.
As can be seen from Table 3, the mushroom fermentation broths prepared in examples 1-3 and comparative examples 1-3 of the present invention all have promotion effect on HaCaT cell viability at the measured volume fraction concentration (5-20%); the promotion effect is strongest at 10% volume fraction concentration, and slightly decreases at 20% volume fraction concentration. According to the judging standard of the European Union national laboratory cosmetic toxicity, the fermentation broth has little or no toxicity to Raw264.7 cells in the determined concentration range.
(6) Anti-inflammatory related gene expression assays
Test materials: tricholoma matsutake yeast fermentation broth prepared in examples 1-3 and comparative examples 1-3; DMEM basal medium (DMEM medium: penicillin/streptomycin solution=99:1, v: v), fetal Bovine Serum (FBS), pancreatin (0.25%, EDTA-containing), PBS solution, DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution=89:10:1, v/v/v), ELISA kit (COX-2, il-1 a, NF-kB);
the test method comprises the following steps: respectively diluting the tricholoma matsutake yeast fermentation liquor to 10% (v/v) with a DMEM basic culture medium to obtain test solutions; then the following operations are performed:
(1) plating and sample adding: taking RAW264.7 cells with good growth state, culturing for 16 hours at the density of 1X 106cells/mL, paving 6 pore plates at 2 mL/hole, replacing the cells with a culture medium with the same volume and containing samples to be tested at different concentrations, and adding LPS for induction for 6 hours after 1 hour; DMEM complete medium was used as a blank control and 80 μm dexamethasone was used as a positive control.
(2) Extracting RNA: same as in test example 5;
(3) cDNA was synthesized and PCR amplification was performed: same as in test example 5;
(4) cDNA was used for Real-Time PCR quantitative detection: except that the primers were replaced with:
COX-2:
an upstream primer: ATTCCAAACCAGCAGACTCATA, downstream primer:
CTTGAGTTTGAAGTGGTAACCG；
IL-1α:
an upstream primer: CGCTTGAGTCGGCAAAGAAAT, downstream primer: AGATGGTCAATGGCAGAACTGT;
NF-kB:
an upstream primer: TCTCAGCTGCGACCCCG, downstream primer: TGGGCTGCTCAATGATCTCC;
reference gene GAPDH:
an upstream primer: TGCACCACCAACTGCTTAGC, downstream primer: GGCATGGACTGTGGTCATGAG;
other assays with HaCaT cytotoxicity;
(5) data processing is performed by adopting a 2-delta CT method, and specific test results are shown in figures 4-6.
As can be seen from FIGS. 4 to 6, the 10% concentration of the fungus fermentation broths prepared in examples 1 to 3 and comparative examples 1 to 3 of the present invention inhibited the expression of inflammation-related genes (COX-2, IL-1. Alpha., NF-kB), and the anti-inflammatory effect of the fungus fermentation broth of example 1 was most remarkable. Therefore, the tricholoma matsutake yeast fermentation liquor can inhibit the expression of inflammation related genes, and further exert anti-inflammatory effect.
The invention has the technical effects that:
(1) The preparation method of the tricholoma matsutake yeast fermentation liquid has simple process, can effectively utilize saccharomycetes to ferment the tricholoma matsutake raw material and reprocess bioactive components, has mild reaction conditions, does not need to additionally add chemical reagents, can reserve various natural active components in the tricholoma matsutake raw material to the maximum extent, can generate a large amount of active substances such as beta-glucan, protein and the like peculiar to the saccharomycetes in the yeast fermentation process, can obviously enhance the efficacy of the tricholoma matsutake raw material, has small technical difficulty, saves energy and labor, and has high production efficiency;
(2) The tricholoma matsutake yeast fermentation liquor has high protein content and strong activity, has obvious antioxidant and anti-inflammatory effects, can ensure skin regeneration activity by adding the component into cosmetics, has good hydrophilicity and lipophilicity, can increase skin luster after being used, has high efficiency, can resist oxidation, delay aging, prevent age-related skin elasticity loss, modify and improve facial contours, prevent or improve the appearance of orange peel, has antibacterial property, has a acne prevention and treatment effect on acne caused by high male hormone, can condition oily skin, helps damaged tissues heal and compact skin, and can promote the close connection between epidermis and dermis;
(3) The tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and is additive-free, safe and non-irritating.
Of course, the above is only a typical example of the invention, and other embodiments of the invention are also possible, and all technical solutions formed by equivalent substitution or equivalent transformation fall within the scope of the invention claimed.
Claims (3)
1. A preparation method of tricholoma matsutake yeast fermentation broth with repairing and anti-aging effects is characterized by comprising the following steps:
s1, inoculating saccharomyces cerevisiae into an appliance filled with YPD liquid culture medium, wherein the saccharomyces cerevisiae is saccharomyces cerevisiae (Saccharomyces cerevisiae) CICC 1001 of China industry microbiological culture collection center, and the appliance is a test tube or a shake flask;
in step S1, the preparation method of the YPD liquid medium specifically includes:
s11, a YPD culture medium formula and preparation: 20.0g of peptone and 10.0g of peptone are weighed out
Yeast paste, 800mL ddH was added 2 In the step O, stirring uniformly;
s12, adding 20.0g of glucose and 3.0g of gKH to the YPD medium obtained in the step S11 2 PO 4 、1.5gMgSO 4 •7H 2 O, trace thiamine, and uniformly stirring;
s13, using ddH 2 O is fixed to 1000mL, the pH is regulated to 5.8-6.0, the high pressure sterilization is carried out for 15-30 min at the temperature of 110-130 ℃, and the YPD liquid culture medium is obtained after cooling to the room temperature;
s2, introducing air and sealing, shake culturing for 1-2 days at a temperature of 28-32 ℃ by a shaking table at 200-250 rpm, and shake culturing overnight to obtain Saccharomyces cerevisiae seed liquid;
s3, cleaning the tricholoma matsutake fruiting body, slicing, drying, sieving with a 50-mesh filter screen, crushing and sieving twice or more, and pulverizing into fine powder to obtain tricholoma matsutake powder;
s4, after the seed bacteria are cultured to the middle and later stages of the logarithmic growth phase, adding the tricholoma matsutake powder into the saccharomyces cerevisiae seed liquid according to the mass percentage of 10-30%, and stirring and fermenting for 3-7 days at the temperature of 30 ℃;
s5, filtering, centrifuging or ultrasonic centrifuging the fermented stock solution after fermentation to obtain Tricholoma matsutake yeast fermentation liquor,
and (3) filtering: filtering with gauze and 400 mesh sieve to obtain filtrate and fermentation broth;
and (3) centrifugal treatment: centrifuging at a high speed of 8000-10000 rpm for 20-30 min at 0-10deg.C to obtain supernatant to obtain Tricholoma matsutake powder fermentation broth;
ultrasonic treatment: then ultrasonic treatment is carried out, filtration and high-speed centrifugation are carried out, and a supernatant is left after the high-speed centrifugation, so as to obtain tricholoma matsutake powder fermentation liquor;
the volume ratio of the saccharomycete to the liquid culture medium is 1-5:100, inoculating the yeast into the liquid culture medium under a sterile condition.
2. The method for preparing tricholoma matsutake yeast fermentation broth with repairing and anti-aging effects according to claim 1, wherein the liquid culture medium is subjected to high-pressure sterilization at 110-130 ℃ for 15-25 min before being added into an appliance, and is cooled to room temperature or is filtered by a 0.22 micron filter membrane.
3. The method for preparing tricholoma matsutake yeast fermentation broth with the efficacy of repairing and resisting aging according to claim 1, wherein the tricholoma matsutake yeast fermentation broth is obtained by filtering, centrifuging or ultrasonic centrifuging for two or more times, and decolorizing and deodorizing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211364506.1A CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211364506.1A CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115678805A CN115678805A (en) | 2023-02-03 |
| CN115678805B true CN115678805B (en) | 2023-06-13 |
Family
ID=85047339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211364506.1A Active CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115678805B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
| CN117281748A (en) * | 2023-07-14 | 2023-12-26 | 广东真丽斯化妆品有限公司 | A cosmetic composition containing mushroom extract for promoting skin repair |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420337A (en) * | 2015-12-16 | 2016-03-23 | 四川省中医药科学院 | Matsutake, caterpillar fungus and lactic acid bacteria fermented product as well as derivative cosmetics, preparation method and application thereof |
| CN106085792A (en) * | 2016-06-03 | 2016-11-09 | 西藏大学农牧学院 | A kind of preparation method of tricholoma matsutake mycelium fermented type vinegar beverage |
| CN108517345B (en) * | 2018-04-20 | 2021-07-27 | 杭州优玛达生物科技有限公司 | Thermophilic thermus strain and microzyme combined fermentation method |
| CN109106730A (en) * | 2018-09-13 | 2019-01-01 | 长春健康未来医药科技有限公司 | It is a kind of to promote Liver Lipid Metabolism, extract of anti-inflammatory drop enzyme and preparation method thereof |
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
-
2022
- 2022-11-02 CN CN202211364506.1A patent/CN115678805B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN115678805A (en) | 2023-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115678805B (en) | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects | |
| CN111297791B (en) | Anti-aging and repairing skin care composition containing symbiotic bacteria combined fermentation product, essence milk and preparation method and application of essence milk | |
| CN114209617B (en) | Ganoderma lucidum extract fermented by yeast and preparation method and application thereof | |
| CN114703074B (en) | Saccharomyces cerevisiae and application thereof in preparing brown rice fermentation filtrate for cosmetics | |
| CN114557927B (en) | Yeast essence water composition, yeast essence water, and preparation method and application thereof | |
| CN112691125B (en) | Pharmaceutical composition for whitening or resisting aging, preparation method thereof and skin care product | |
| CN113398045A (en) | Anti-aging and relieving aloe fermented product and preparation method and application thereof | |
| CN116869870B (en) | Galactose yeast-like fermentation product filtrate with moisturizing, tightening and relieving effects, and preparation method and application thereof | |
| CN115927128B (en) | Transparent tremella fermentation product and preparation method and application thereof | |
| CN116355816A (en) | Microorganism of fermented samara oil seed and blood lipid reducing composition thereof | |
| CN115414290B (en) | Traditional Chinese medicine composition with moisturizing, antioxidant and anti-inflammatory effects and preparation and application thereof | |
| CN115737490A (en) | Preparation method of Inonotus obliquus yeast fermentation liquor and application of Inonotus obliquus yeast fermentation liquor in cosmetics | |
| CN111494255B (en) | Composition containing ginseng cordyceps sinensis fermentation extract and application of composition in cosmetics | |
| CN108969430B (en) | Application of American ginseng fermentation liquor as skin care product or skin care product additive | |
| CN114404344A (en) | Yeast/barley seed fermentation product, product containing yeast/barley seed fermentation product, and preparation method and application of yeast/barley seed fermentation product | |
| CN114209621A (en) | Moisturizing and antioxidant red yeast rice fermented product and preparation method and application thereof | |
| CN113648254A (en) | Lupinus acutus and cherry fermentate for cosmetics and preparation method thereof | |
| CN113662894B (en) | Centella enzymolysis fermentation product and preparation method and application thereof | |
| CN115025025B (en) | Paeonia lactiflora fermentation product and preparation method and application thereof | |
| CN115554206B (en) | Composite ferment for enhancing cell viability and preparation method and application thereof | |
| CN114146040B (en) | Composition for strengthening skin barrier and resisting aging as well as preparation method and application thereof | |
| CN114931537B (en) | Composite ferment capable of delaying aging and preparation method and application thereof | |
| CN117925731B (en) | Galactose yeast-like fungus centella asiatica fermentation product and preparation method and application thereof | |
| CN115584337B (en) | Plant exosomes, preparation method and application thereof in skin aging resistant products | |
| CN115645330B (en) | Pelargonium extract and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |