CN115678805A - Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects - Google Patents
Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects Download PDFInfo
- Publication number
- CN115678805A CN115678805A CN202211364506.1A CN202211364506A CN115678805A CN 115678805 A CN115678805 A CN 115678805A CN 202211364506 A CN202211364506 A CN 202211364506A CN 115678805 A CN115678805 A CN 115678805A
- Authority
- CN
- China
- Prior art keywords
- tricholoma matsutake
- yeast fermentation
- yeast
- fermentation liquor
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a preparation method of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects, which comprises the following steps: s1, inoculating saccharomyces cerevisiae into an apparatus filled with a YPD liquid culture medium; s2, introducing air, sealing, and oscillating for overnight culture to obtain a saccharomyces cerevisiae seed solution; s3, preparing the tricholoma matsutake fruiting bodies into tricholoma matsutake powder; s4, adding the fine powder of the tricholoma matsutake into the saccharomyces cerevisiae seed liquid; s5, purifying the fermented stock solution after fermentation; the preparation method of the tricholoma matsutake yeast fermentation liquid provided by the invention is simple in process, can effectively utilize the yeast to ferment the tricholoma matsutake raw material and reprocess bioactive components, and is mild in reaction conditions; the prepared tricholoma matsutake yeast fermentation liquid can effectively utilize saccharomycetes to ferment tricholoma matsutake raw materials and reprocess bioactive components, the reaction condition is mild, and the components added in the cosmetics can give skin regeneration activity; the Tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and has no additive, safety and irritation.
Description
Technical Field
The invention relates to the technical field of cosmetics, in particular to a preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects.
Background
Along with the rapid increase of the consumption of cosmetics in recent years, the frequency of improper use or unqualified use of products by consumers is increased, and in addition, various factors such as climate warming, environmental pollution, working and living pressure increase and the like in recent years cause that the skin cuticle of many consumers is damaged in succession, the skin barrier function is damaged, the skin is developed into sensitive skin with frequent dry itching, stabbing pain, red swelling and flushing, and the skin is difficult to cure in serious cases, and the use of 'green' and 'safe' purely natural cosmetic raw materials with various efficacies of anti-inflammation, anti-oxidation, anti-irritation, anti-aging and the like is the primary choice for effectively relieving the skin problems.
The tricholoma matsutake, also called black tricholoma matsutake, agaricus blazei murrill, tricholoma matsutake and the like is a rare pure natural edible fungus, is rich in nutrition, contains various proteins, amino acids, nucleotides, unsaturated fatty acids, polysaccharides, vitamins and other components, and has the effects of clearing free radicals, resisting radiation, inflammation and stimulation, resisting oxidation and aging, resisting cancer and the like. Some cosmetics containing tricholoma matsutake extracts are available on the market at present, but because the tricholoma matsutake extracts are generally prepared by traditional high-temperature cooking water extraction, organic solvent extraction and other processes, not only can the effective active ingredients of the tricholoma matsutake be seriously damaged, but also a large amount of organic solvent residues can be caused; moreover, because the price of the tricholoma matsutake is high, the addition amount of most tricholoma matsutake extract products is very small, and the real efficacy is difficult to be exerted; a small amount of product with a large addition amount is expensive, and most of common consumers cannot bear the product, so the popularization and the quality guarantee period of the product are limited.
The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a preparation method of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects, an application example of the tricholoma matsutake yeast fermentation liquor and cosmetics, the fermentation of the tricholoma matsutake raw materials and the reprocessing of bioactive components can be effectively carried out by using saccharomyces cerevisiae, the reaction conditions are mild, no additional chemical reagent is needed to be added, various natural active components in the tricholoma matsutake raw materials can be retained to the maximum extent, a large amount of yeast-specific active substances such as beta-glucan, protein and the like are generated in the yeast fermentation process, and the efficacy of the tricholoma matsutake raw materials can be obviously enhanced; the addition of a proper amount of tricholoma matsutake yeast fermentation liquor in the cosmetic can effectively relieve the sensitive skin problems of redness, dry itching, stabbing pain, redness and swelling and the like, repair the barrier function of the skin and restore the health state of the skin.
Disclosure of Invention
In view of this, the invention aims to provide a preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects.
In order to solve the technical problems, the technical scheme of the invention is as follows: a preparation method of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects is characterized by comprising the following steps:
s1, inoculating Saccharomyces cerevisiae into an apparatus filled with a YPD liquid culture medium, wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae (CICC 1001) of China center for industrial microorganism culture preservation management, and the apparatus comprises a test tube, a shake flask, a fermentation tank and the like;
s2, introducing air and sealing, performing shake culture on a shaker at 200-250 rpm for 1-2 days at the temperature of 28-32 ℃, and performing shake overnight culture to obtain a saccharomyces cerevisiae seed solution;
s3, cleaning the matsutake fruiting body, slicing, drying, sieving by a 50-mesh sieve, crushing and sieving for more than or equal to two times, pulverizing into fine powder, and preparing into matsutake powder;
s4, after the seed bacteria are cultured to the later stage of logarithmic growth phase, adding the fine powder of the tricholoma matsutake into the saccharomyces cerevisiae seed solution, and stirring and fermenting for 3-7 days at the temperature of 30 ℃;
s5, filtering, centrifuging or ultrasonically centrifuging the fermented stock solution to obtain tricholoma matsutake yeast fermentation liquor;
and (3) filtering treatment: filtering with gauze and 400 mesh screen, and collecting filtrate to obtain fermentation liquid with high Tricholoma matsutake powder content;
and (3) centrifugal treatment: centrifuging at 0-10 deg.c and 8000-10000 rpm for 20-30 min to obtain the fermented liquid with less tricholoma matsutake powder content;
ultrasonic treatment: then ultrasonic treatment, filtration and high-speed centrifugation are carried out firstly, and then supernatant is left to obtain fermentation liquor with less tricholoma matsutake powder content.
Preferably, in step S1, the preparation method of the YDPA liquid medium specifically includes:
s11, YPD culture medium formula and preparation: weighing 20.0g of Peptone and 10.0g of Yeast Extract, adding into about 800mL of ddH2O, and uniformly stirring;
s12, adding 20.0g of glucose, 3.0g of KH2PO4, 1.5g of MgSO4.7H2O and trace thiamine (Vit. B1) into the 1.0L 20% YPD culture medium obtained in the step S11, and uniformly stirring;
s13, adding ddH2O to a constant volume of 1000mL, adjusting the pH value to 5.8-6.0, carrying out autoclaving at 110-130 ℃ for 15-30 min, and cooling to room temperature to obtain the YPD liquid culture medium.
Preferably, the yeast is at least one of saccharomyces cerevisiae, pichia pastoris, rhodotorula rubra, candida, saccharomyces pastorianus or zygosaccharomyces rouxii, the liquid culture medium is a YPD liquid culture medium, and the volume ratio of the yeast to the liquid culture medium is 1-5:100, inoculating the yeast into the liquid culture medium under the aseptic condition.
Preferably, the tricholoma matsutake powder comprises the following components in percentage by mass: 10-30% of pine mushroom powder.
Preferably, the pine mushroom powder is added into the saccharomyces cerevisiae seed liquid after the saccharomyces cerevisiae is cultured to logarithmic growth stage and middle and later stages.
Preferably, the liquid medium is a YPD liquid medium, and the liquid medium further comprises at least one of fructose, KH2PO4, mgSO 4.7h2o, trace thiamine (vit. B1), and agar.
Preferably, the liquid culture medium is autoclaved at 110-130 ℃ for 15-25 min before being added into the apparatus, and is cooled to room temperature or filtered through a 0.22 micron filter membrane.
Preferably, in step S4, the aeration-sealing culture is specifically: after air-tight sealing, shaking the shaking table at the rotation speed of 100-250 rpm at the temperature of 28-32 ℃, and shaking for culturing for 7-15 days.
Preferably, the tricholoma matsutake yeast fermentation liquor is obtained by filtering, centrifuging or ultrasonic centrifuging twice or more, decoloring and deodorizing.
Preferably, the tricholoma matsutake yeast fermentation liquor with the efficacy of repairing and resisting aging can be used as any one of additives of cosmetic essence, lotion, toner, cream and facial mask for application.
The technical effects of the invention are mainly embodied as follows: (1) The preparation method of the tricholoma matsutake yeast fermentation liquid is simple in process, can effectively utilize saccharomycetes to ferment the tricholoma matsutake raw materials and reprocess bioactive components, is mild in reaction conditions, does not need to add additional chemical reagents, can reserve various natural active components in the tricholoma matsutake raw materials to the maximum extent, generates a large amount of active substances such as beta-glucan, protein and the like specific to yeast in the yeast fermentation process, can obviously enhance the efficacy of the tricholoma matsutake raw materials, and is small in technical difficulty, energy-saving, labor-saving and high in production efficiency;
(2) The tricholoma matsutake yeast fermentation liquor is high in protein content and activity and has remarkable anti-oxidation and anti-inflammatory effects, the regeneration activity of skin can be guaranteed by adding the component into cosmetics, the component has good hydrophilicity and lipophilicity, the skin gloss can be increased after the cosmetic is used, the anti-oxidation effect is high, the aging is delayed, the age-related skin elasticity loss is prevented, the facial contour is modified and improved, the emergence of orange peel warps is prevented or improved, the antibacterial property is realized, the acne caused by high male hormone can be prevented and treated, the oily skin can be regulated, the injured tissue can be healed and the skin can be tightened, and the close connection between the epidermis and the dermis can be promoted;
(3) The tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and is free of additives, safe and free of stimulation.
Drawings
FIG. 1 is a flowchart of a method for preparing a yeast fermentation broth of Tricholoma matsutake in example 1 of the present invention;
FIG. 2 is a growth curve of Saccharomyces cerevisiae in example 1 of the present invention;
FIG. 3 shows DPPH radical scavenging rates of Tricholoma matsutake Yeast fermentation broths obtained in examples 1 to 3 of the present invention and comparative examples 1 to 3;
FIG. 4 is a graph showing the relationship between yeast fermentation broth of Tricholoma matsutake obtained in examples 1 to 3 of the present invention and HaCaT cell proliferation obtained in comparative examples 1 to 3;
FIG. 5 is a graph showing the relationship between yeast fermentation broth of Tricholoma matsutake obtained in examples 1 to 3 and comparative examples 1 to 3 of the present invention and COX-2 gene expression levels;
FIG. 6 is a graph showing the relationship between the fermentation broth of Tricholoma matsutake Yeast and the IL-1. Alpha. Gene expression levels obtained in examples 1 to 3 and comparative examples 1 to 3 of the present invention;
FIG. 7 is a graph showing the relationship between the fermentation broth of Tricholoma matsutake Yeast and the NF-kB gene expression levels obtained in examples 1 to 3 and comparative examples 1 to 3 of the present invention.
Detailed Description
The following detailed description of the embodiments of the present invention is provided in order to make the technical solution of the present invention easier to understand and understand.
In the present embodiment, it should be understood that the terms "middle", "upper", "lower", "top", "right", "left", "above", "back", "middle", and the like indicate orientations or positional relationships based on the orientations or positional relationships shown in the drawings, and are only for convenience of describing the present invention, and do not indicate or imply that the referred devices or elements must have a specific orientation, be constructed and operated in a specific orientation, and thus, should not be construed as limiting the present invention.
In the present embodiment, if the connection or fixing manner between the components is not specifically described, the connection or fixing manner may be a bolt fixing manner, a pin connecting manner, or the like, which is commonly used in the prior art, and therefore, details thereof are not described in the present embodiment.
Example 1
Referring to fig. 1, this embodiment provides a method for preparing a tricholoma matsutake yeast fermentation broth, including the following steps:
s1, inoculating saccharomyces cerevisiae into an apparatus filled with a YPD liquid culture medium, wherein the yeast is at least one of saccharomyces cerevisiae, pichia pastoris, rhodotorula rubra, candida, pasteurella barnacle or zygosaccharomyces rouxii, and the apparatus comprises a test tube, a shake flask, a fermentation tank and the like;
specifically, the yeast is preferably Saccharomyces cerevisiae (CICC 1001) of the china industrial microorganism culture collection management center, and the volume ratio of the inoculation amount of the YPD liquid culture medium to the yeast is preferably 100:1-5. The saccharomyces cerevisiae is inoculated in the YPD liquid culture medium under the aseptic condition, and other strains and additional other chemical reagents are prevented from being introduced in the inoculation process, so that the clear and well-documented sources of nutrient components in the tricholoma matsutake yeast fermentation liquid are ensured.
S2, introducing air and sealing, performing shake culture on a shaker at 200-250 rpm for 1-2 days at the temperature of 28-32 ℃, and performing shake overnight culture to obtain a saccharomyces cerevisiae seed solution;
specifically, after air is introduced and sealed, shake culture is carried out for 1 day at the temperature of 30 ℃ and the rotating speed of 230rpm in a shaking table, so that the saccharomyces cerevisiae is rapidly proliferated, 1mL of bacterial liquid is sampled every 2 hours, the light absorption value of the bacterial liquid at the 600nm position is measured after the bacterial liquid is properly diluted, and then a growth curve is drawn by taking the light absorption value of the saccharomyces cerevisiae cells as the ordinate and the growth time as the abscissa.
S3, cleaning the matsutake mushroom fruiting bodies, slicing, drying, sieving with a 50-mesh sieve, crushing and sieving for more than or equal to two times, grinding into fine powder, and preparing into matsutake mushroom powder;
specifically, the tricholoma matsutake is dried, purified and crushed into powder, the powder is filtered by a 50-mesh filter screen, and the crushing and sieving times are more than or equal to two times, so that the tricholoma matsutake is crushed more uniformly, the utilization rate of intracellular nutrient substances is greatly improved, the content of extracellular active ingredients is increased, and the yield of active substances is effectively improved.
S4, after the saccharomyces cerevisiae seed bacteria are cultured to the later stage of logarithmic growth phase, adding the fine powder of the tricholoma matsutake into the saccharomyces cerevisiae seed liquid according to the addition amount of 10-30%, stirring and fermenting at 28-32 ℃ and 200-250 rpm for 3-7 days;
specifically, according to the growth curve drawn by S2, selecting Saccharomyces cerevisiae seed liquid cultured to the middle and late logarithmic growth period, weighing 20% of Tricholoma matsutake powder, adding, stirring at 30 deg.C, and fermenting for 3-7 days;
and S5, treating the fermented stock solution to obtain tricholoma matsutake yeast fermentation liquid.
Specifically, the fermented stock solution after fermentation is subjected to filtration, centrifugation or ultrasonic centrifugation. If the filtration treatment is carried out, filtering by using gauze and a 400-mesh screen to collect filtrate, thus obtaining the fermentation liquor with high tricholoma matsutake powder content. If the fermentation liquor is centrifuged, the fermentation liquor with less tricholoma matsutake powder content is obtained by centrifuging at a high speed of 8000-10000 rpm for 20-30 min at 0-10 ℃ and then taking the supernatant. If the fermentation liquor with less tricholoma matsutake powder content is obtained by firstly carrying out ultrasonic treatment, then carrying out filtration and high-speed centrifugation treatment and then remaining the supernatant. In addition, according to different requirements of cosmetic manufacturers, the steps of color removal, deodorization and the like by adding activated carbon or macroporous resin can be carried out.
Therefore, according to the preparation method of the tricholoma matsutake yeast fermentation liquid, the tricholoma matsutake yeast fermentation liquid is obtained by utilizing the synergistic fermentation of the saccharomyces cerevisiae and the tricholoma matsutake powder and sequentially carrying out the processing steps of high-pressure homogenization, ultrasonic crushing, high-speed centrifugation, color removal, deodorization and the like for many times. In addition, the tricholoma matsutake yeast fermentation liquor has obvious antioxidant and anti-inflammatory effects, can promote HaCaT cell proliferation and HaCaT cell autophagy, and has extremely low toxicity or no toxicity to HaCaT cells and Raw264.7 cells.
Further, the YDP liquid medium includes not only common peptone but also yeast powder, and also at least one of glucose, KH2PO4, mgSO4 · 7H2O, trace thiamine (vit. B1) and agar.
In this example, the preparation method of the YDPA liquid medium is as follows:
(1) YPD culture medium formula and preparation: weighing 20.0g of Peptone and 10.0g of Yeast Extract, adding into about 800mL of ddH2O, and uniformly stirring;
(2) Adding 20.0g of g glucose, 3.0g of KH2PO4, 1.5g of MgSO4.7H2O and trace thiamine (Vit. B1) into 1.0L 20% YPD culture medium obtained in the step (1), and uniformly stirring;
(3) ddH2O is used for fixing the volume to 1000mL, the pH value is adjusted to 5.8-6.0, the YPD liquid culture medium is obtained after autoclaving at the temperature of 110-130 ℃ for 15-30 min and cooling to the room temperature. Therefore, the mixed bacteria in the liquid culture medium are prevented from interfering the fermentation of the microzyme by autoclaving at 110-130 ℃ for 15-30 min.
Further, the embodiment also provides a cosmetic which applies the preparation method of the tricholoma matsutake yeast fermentation liquor with the repairing and anti-aging effects.
Example 2
This example is different from example 1 in that, in S3, after the saccharomyces cerevisiae seed bacteria are cultured to the late stage of logarithmic growth phase, fine powder of tricholoma matsutake is added to the saccharomyces cerevisiae seed liquid in an amount of 10%, and the rest is the same as example 1.
Example 3
This example is different from example 1 in that, in S3, after the Saccharomyces cerevisiae seed bacteria were cultured to the late stage of logarithmic growth phase, tricholoma matsutake fine powder was added to the Saccharomyces cerevisiae seed liquid at an addition amount of 30%, and the rest of the examples are the same as example 1.
Comparative example 1
This comparative example is different from example 1 in that step S3 is omitted, and the other portions are the same as example 1.
Comparative example 2
This comparative example is different from example 1 in that step S4 is omitted, and the other portions are the same as example 1.
Comparative example 3
The difference between the comparative example and the example 1 is that the tricholoma matsutake yeast fermentation broth is heated and boiled for 15-25 min, and the rest is the same as that of the example 1.
Positive control group
250 microgram/mL vitamin C
The mushroom fermentation liquids of examples 1 to 3 and comparative examples 1 to 3 were subjected to the following performance tests:
(1) Protein content detection
The test method comprises the following steps: detecting the protein content by adopting a BCA method, wherein the detection conditions are as follows: byunnan BCA protein concentration assay kit (P0012S).
A. Preparation of protein standards
a. 0.8ml of the protein standard preparation solution was added to a tube of protein standard (20 mg BSA), and was dissolved sufficiently to prepare a 25mg/ml protein standard solution. Can be used immediately after preparation, or stored at-20 deg.C for a long time.
b. An appropriate amount of 25mg/mL protein standard was taken and diluted to a final concentration of 0.5mg/mL. For example, 20. Mu.L of 25mg/mL protein standard is added with 980. Mu.L of diluent to prepare 0.5mg/mL protein standard. In which solution the protein sample is, the standard is preferably diluted with which solution. However, for simplicity, the standards may also be diluted with 0.9% NaCl or PBS. The diluted 0.5mg/mL protein standard can be stored for a long time at the temperature of 20 ℃ below zero.
BCA working solution preparation
According to the number of samples, a proper amount of BCA working solution was prepared by adding 50 volumes of BCA reagent a to 1 volume of BCA reagent B (50. For example, 5mL of BCA reagent A plus 100. Mu.L of BCA reagent B are mixed and mixed to prepare 5.1mL of BCA working solution. The BCA working solution is stable within 24 hours at room temperature.
C. Protein concentration determination
a. Adding standard substance into standard substance well of 96-well plate in an amount of 0, 1, 2, 4, 8, 12, 16, 20 μ l, and adding standard substance diluent to make up to 20 μ l, wherein the concentrations of the standard substance are 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5mg/ml respectively.
b. Add the appropriate volume of sample to the sample well of a 96-well plate. If the sample is less than 20 μ l, the standard dilution is added to make up to 20 μ l. Note that the sample volume is recorded.
c. Add 200. Mu.l BCA working solution to each well and leave at 37 ℃ for 20-30 minutes.
d. Absorbance at A562, or other wavelengths between 540-595nm, was measured with a microplate reader.
e. The protein concentration of the sample was calculated from the standard curve and the sample volume used.
The test results are shown in Table 1.
TABLE 1 protein content (mg/mL, mean. + -. SD) of the samples examined
| Protein content | |
| Example 1 | 21.094±3.136 |
| Example 2 | 10.167±2.231 |
| Example 3 | 22.356±3.004 |
| Comparative example 1 | 0.318±3.136 |
| Comparative example 2 | 1.105±1.142 |
| Comparative example 3 | 8.613±3.136 |
As can be seen from Table 1, the protein content in examples 1-3 was significantly higher than in comparative examples 1-3. Comparative example 1 omits the pine mushroom powder, but the protein content in the fermentation liquor is obviously reduced compared with that in example 1, which shows that the introduction of the pine mushroom powder can obviously improve the protein content in the fermentation liquor. Comparative example 2 omits yeast fermentation, but protein yield in the fermentation broth is obviously reduced, which indicates that the introduction of saccharomyces cerevisiae can improve the protein biosynthesis amount of the fermentation broth. Comparative example 3 is heated and boiled for 15-25 min, and the protein content in the fermentation broth is obviously lower than that in example 1, which shows that the tricholoma matsutake yeast fermentation broth obtained by the invention is rich in various bioactive substances, and the heating and boiling can cause protein denaturation, thereby obviously reducing the yield of the active substances in the fermentation broth.
(2) DPPH free radical scavenging ability test
The test method comprises the following steps: the tricholoma matsutake yeast fermentation liquids prepared in the above examples 1 to 3 and comparative examples 1 to 3 and the positive control VC were diluted with absolute ethanol to obtain a tricholoma matsutake yeast fermentation liquid solution with a concentration of 50% (v/v) as a test sample. Respectively putting 400 mu L into a 1.5ml centrifuge tube, adding 1200 mu L of 10 mu M DPPH solution, and reacting for 30min in a dark place at room temperature; 200. Mu.L of each tube was removed and transferred to a 96-well plate, and the absorbance of the reaction at 515nm was measured and recorded As As. The blank control group uses absolute ethyl alcohol with the same volume to replace the tested sample, the result is marked as A0, and the positive control group uses VC solution with the same volume and 100 mu g/mL to replace the sample; the negative control group uses absolute ethyl alcohol with the same volume instead of DPPH solution, and As0 is used As the negative control group result. The specific test results are shown in fig. 3.
In the formula: absorbance of the sample set was A S (ii) a The absorbance of the negative control group was A S0 (ii) a Absorbance of blank A 0 。
As can be seen from FIG. 2, the yeast fermentation products of Tricholoma matsutake obtained in examples 1-3 and comparative examples 1-3 have a significant effect of scavenging DPPH free radicals compared to the blank set. In example 2, compared with the content of the tricholoma matsutake in example 1, the content of the tricholoma matsutake is reduced from 20% to 10%, and the DPPH free radical scavenging capacity is reduced by about 20%; example 3 the content of the tricholoma matsutake is increased from 20% to 30%, the DPPH free radical scavenging capacity is not increased, and the fact that the content of the tricholoma matsutake is below 20% is increased along with the increase of the concentration, and the maximum value is reached by about 20%. Comparative example 1 omits matsutake powder, and compared with example 1, the DPPH free radical scavenging capacity of the fermentation liquid is obviously reduced, which shows that the oxidation resistance of the mushroom fermentation liquid can be obviously improved by introducing the matsutake powder. Comparative example 2 omits yeast fermentation, and the DPPH free radical scavenging ability of the fermentation liquid is obviously reduced compared with that of example 1, which shows that the oxidation resistance of the fermentation liquid can be obviously improved by introducing the saccharomyces cerevisiae. Comparative example 3 boiling and heating the fermentation broth, the DPPH free radical scavenging ability of the fermentation broth is obviously reduced compared with that of example 1, which shows that the fermentation broth contains a plurality of active ingredients, the oxidation resistance of the mushroom fermentation broth can be obviously improved, and the activity is lost once the mushroom fermentation broth is heated.
(3) HaCaT cytotoxicity assay
The test method comprises the following steps: haCaT cells in the logarithmic growth phase were taken, digested with trypsin, centrifuged (1000 rpm,5 min), counted and seeded in 96-well plates at a density of 3X 103 cells/well, with 100. Mu.L of cell suspension per well. After 24h of plating, adding DMEM complete medium containing Tricholoma matsutake Yeast fermentation products prepared in example 1 with different concentrations, setting 3 multiple wells per concentration by taking DMEM complete medium as blank control, adding 10 μ L CCK8 per well after 48h, incubating for 2h, measuring absorbance at 450nm by taking 630nm as reference wavelength, and recording the measurement results, wherein the specific test results are shown in Table 2.
In the formula: absorbance of the sample set was A S,450nm -A S,630nm (ii) a Absorbance of blank A 0,450nm -A 0,630nm 。
TABLE 2 comparison of the Effect of different concentrations of test samples on HaCaT cytotoxicity (mean, n = 3)
Note: * Indicating a significant difference compared to the blank group.
As can be seen from Table 2, the Tricholoma matsutake Yeast fermentation broths prepared in examples 1-3 of the present invention and comparative examples 1-3 all have a promoting effect on HaCaT cell viability at the determined volume fraction concentration (5-20%); the promoting effect is strongest under the concentration of 10% volume fraction, and the promoting effect on the HaCaT cell survival rate is slightly reduced under the concentration of 20% volume fraction. According to the judgment standard of the toxicity of cosmetics in the European Union national laboratory, the fermentation liquor has little or no toxicity to HaCaT cells in the measured concentration range.
(4) HaCaT cell proliferation assay
The test method comprises the following steps: the mushroom fermentation liquids obtained in examples 1 to 3 and comparative examples 1 to 3 were diluted to 10% (v/v) with DMEM basal medium to obtain test solutions. HaCaT cells in logarithmic growth phase are inoculated in a 96-well cell culture plate at 5 × 104cells/mL and 100 μ L/well, and cultured in a 5% CO2 incubator at 37 ℃ for 24h; discarding the old medium, washing with PBS solution once, adding 100 μ L of the test solution to each well of cell solution, adding fetal bovine serum (20% FBS) to the positive control group, adding equivalent volume of DMEM basal medium to the blank group, and culturing at 37 deg.C for 48h; adding 10 mu L of CCK8 solution into each hole, and incubating for 2h at the constant temperature of 37 ℃ in the dark; and measuring the absorbance at 450nm by taking 630nm as a reference wavelength, and recording the measurement result, wherein the specific test result is shown in figure 3.
In the formula: absorbance of the sample set was A S,450nm -A S,630nm (ii) a Absorbance of blank A 0,450nm -A 0,630nm 。
As can be seen from FIG. 3, the Tricholoma matsutake Yeast fermentation broths prepared in examples 1-3 and comparative examples 1-3 at a concentration of 10% were not toxic to HaCaT cells; the tricholoma matsutake yeast fermentation product has a remarkable promoting effect on HaCaT cell proliferation, and the tricholoma matsutake yeast fermentation product in example 1 has the most remarkable proliferation promoting effect, and is slightly better than 20% fetal bovine serum in a positive control group.
(5) Raw264.7 cytotoxicity assay
Test materials: mushroom fermentation broth prepared in examples 1 to 3 and comparative examples 1 to 3, DMEM complete medium (DMEM medium: FBS: penicillin/streptomycin solution = 89.
Test subjects: raw264.7 cells
The test method comprises the following steps: the results of the same HaCaT cytotoxicity assay, except that the cells were changed to raw264.7 cells and the plating density was changed to 1 × 106cells/mL, are shown in table 3.
TABLE 3 comparison of the Effect of different concentrations of test samples on Raw264.7 cytotoxicity (mean, n = 3)
Note: * Indicating a significant difference compared to the blank group.
As can be seen from Table 3, the mushroom fermentation broth prepared in examples 1-3 and comparative examples 1-3 of the present invention has a promoting effect on HaCaT cell viability at the determined volume fraction concentration (5-20%); the promoting effect is strongest under the concentration of 10% volume fraction, and the promoting effect on the HaCaT cell survival rate is slightly reduced under the concentration of 20% volume fraction. According to the judgment standard of toxicity of cosmetics in European Union national laboratories, the fermentation liquor of the invention has little or no toxicity to Raw264.7 cells in the measured concentration range.
(6) Anti-inflammatory related gene expression detection
Test materials: tricholoma matsutake yeast fermentation broths obtained in examples 1 to 3 and comparative examples 1 to 3; DMEM basal medium (DMEM medium: penicillin/streptomycin solution =99, 1,v;
the test method comprises the following steps: respectively taking the tricholoma matsutake yeast fermentation liquor, and diluting to 10% (v/v) by using a DMEM basic culture medium to obtain a detected solution; then the following operations are carried out:
(1) plate laying and sample adding: culturing RAW264.7 cells with good growth state in a 6-hole plate with the density of 1 × 106cells/mL and the density of 2 mL/hole for 16h, replacing the cells with a culture medium containing the detected samples with different concentrations in the same volume, and adding LPS for inducing for 6h after 1 h; DMEM complete medium was used as a blank control and 80 μ M dexamethasone was used as a positive control.
(2) And (3) RNA extraction: the same as in test example 5;
(3) cDNA synthesis and PCR amplification: the same as in test example 5;
(4) the cDNA was used for Real-Time PCR quantitative detection: except that the primers were changed to:
COX-2:
an upstream primer: ATTCCAAACCAGCAGACTCATA, downstream primer:
CTTGAGTTTGAAGTGGTAACCG；
IL-1α:
an upstream primer: CGCTTGAGTCGGCAAAGAAAT, downstream primer: AGATGGTCAATGGCAGAACTGT;
NF-kB:
an upstream primer: TCTCAGCTGCGACCCCG, downstream primer: TGGGCTGCTCAATGATCTCC;
reference gene GAPDH:
an upstream primer: TGCACCACCAACTGCTTAGC, downstream primer: GGCATGGACTGTGGTCATGAG;
other homoHaCaT cytotoxicity assays;
(5) and (3) carrying out data processing by adopting a 2^ -delta Delta CT method, wherein specific test results are shown in figures 4-6.
As can be seen from FIGS. 4 to 6, the mushroom fermentation broth prepared in examples 1 to 3 and comparative examples 1 to 3 of the present invention at a concentration of 10% inhibited the expression of inflammation-related genes (COX-2, IL-1. Alpha., NF-kB), and the anti-inflammatory effect of the mushroom fermentation broth of example 1 was the most significant. Therefore, the tricholoma matsutake yeast fermentation liquid can inhibit the expression of inflammation related genes, and further has the anti-inflammatory effect.
The technical effects of the invention are mainly embodied as follows:
(1) The preparation method of the tricholoma matsutake yeast fermentation liquid is simple in process, can effectively utilize saccharomycetes to ferment the tricholoma matsutake raw materials and reprocess bioactive components, is mild in reaction conditions, does not need to add additional chemical reagents, can reserve various natural active components in the tricholoma matsutake raw materials to the maximum extent, generates a large amount of active substances such as beta-glucan, protein and the like specific to yeast in the yeast fermentation process, can obviously enhance the efficacy of the tricholoma matsutake raw materials, and is small in technical difficulty, energy-saving, labor-saving and high in production efficiency;
(2) The tricholoma matsutake yeast fermentation liquor is high in protein content and activity and has remarkable anti-oxidation and anti-inflammatory effects, the regeneration activity of skin can be guaranteed by adding the component into cosmetics, the component has good hydrophilicity and lipophilicity, the skin gloss can be increased after the cosmetic is used, the anti-oxidation effect is high, the aging is delayed, the age-related skin elasticity loss is prevented, the facial contour is modified and improved, the emergence of orange peel warps is prevented or improved, the antibacterial property is realized, the acne caused by high male hormone can be prevented and treated, the oily skin can be regulated, the injured tissue can be healed and the skin can be tightened, and the close connection between the epidermis and the dermis can be promoted;
(3) The tricholoma matsutake yeast fermentation liquid is prepared by fermenting pure natural substances, and is free of additives, safe and free of stimulation.
The above are only typical examples of the present invention, and besides, the present invention may have other embodiments, and all the technical solutions formed by equivalent substitutions or equivalent changes are within the scope of the present invention as claimed.
Claims (10)
1. A preparation method of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects is characterized by comprising the following steps:
s1, inoculating Saccharomyces cerevisiae into an apparatus filled with a YPD liquid culture medium, wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae (CICC 1001) of China center for industrial microorganism culture preservation management, and the apparatus comprises a test tube, a shake flask, a fermentation tank and the like;
s2, introducing air and sealing, performing shake culture on a shaker at 200-250 rpm for 1-2 days at the temperature of 28-32 ℃, and performing shake overnight culture to obtain a saccharomyces cerevisiae seed solution;
s3, cleaning the matsutake mushroom fruiting bodies, slicing, drying, sieving with a 50-mesh sieve, crushing and sieving for more than or equal to two times, grinding into fine powder, and preparing into matsutake mushroom powder;
s4, after the seed bacteria are cultured to the later stage of logarithmic growth phase, adding the fine powder of the tricholoma matsutake into the saccharomyces cerevisiae seed liquid, and stirring and fermenting for 3-7 days at the temperature of 30 ℃;
s5, filtering, centrifuging or ultrasonically centrifuging the fermented stock solution to obtain tricholoma matsutake yeast fermentation liquor;
and (3) filtering treatment: filtering with gauze and 400 mesh screen, and collecting filtrate to obtain fermentation liquid with high Tricholoma matsutake powder content;
and (3) centrifugal treatment: centrifuging at 0-10 deg.c and 8000-10000 rpm for 20-30 min to obtain fermented liquid with less pine mushroom powder content;
ultrasonic treatment: then ultrasonic treatment, filtration and high-speed centrifugation are carried out firstly, and then supernatant is left to obtain fermentation liquor with less tricholoma matsutake powder content.
2. The method for preparing tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects as claimed in claim 1, wherein in step S1, the preparation method of the YDPA liquid medium specifically comprises the following steps:
s11, YPD culture medium formula and preparation: weighing 20.0g of Peptone and 10.0g of Yeast Extract, adding into about 800mL of ddH2O, and uniformly stirring;
s12, adding 20.0g of glucose, 3.0g of KH2PO4, 1.5g of MgSO4 7H2O and trace thiamine (Vit. B1) into the 1.0L 20-percent YPD culture medium obtained in the step S11, and uniformly stirring;
s13, adding ddH2O to a constant volume of 1000mL, adjusting the pH value to 5.8-6.0, carrying out autoclaving at 110-130 ℃ for 15-30 min, and cooling to room temperature to obtain the YPD liquid culture medium.
3. The method for preparing tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects as claimed in claim 1, wherein the yeast is at least one of saccharomyces cerevisiae, pichia pastoris, rhodotorula rubra, candida, saccharomyces pastorianus or zygosaccharomyces rouxii, the liquid culture medium is a YPD liquid culture medium, and the volume ratio of the yeast to the liquid culture medium is 1-5:100, inoculating the yeast into the liquid culture medium under the aseptic condition.
4. The preparation method of tricholoma matsutake yeast fermentation liquor with restoration and anti-aging effects as claimed in any one of claims 1 to 3, wherein the tricholoma matsutake powder comprises the following components in percentage by mass: 10-30% of pine mushroom powder.
5. The method for preparing tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects as claimed in claim 4, wherein the tricholoma matsutake powder is added to the saccharomyces cerevisiae seed liquor after the yeast is cultured to the late logarithmic growth phase.
6. The method for preparing tricholoma matsutake yeast fermentation broth with restoration and anti-aging effects according to any one of claims 1 to 3, wherein the liquid medium is YPD liquid medium and further comprises at least one of fructose, KH2PO4, mgSO 4H 2O, thiamine in trace amounts (Vit. B1) and agar.
7. The method for preparing tricholoma matsutake yeast fermentation liquor with efficacy of repairing and resisting senescence as claimed in claim 5, wherein the liquid culture medium is autoclaved at 110-130 ℃ for 15-25 min before being added into an appliance, and is cooled to room temperature or filtered through a 0.22 micron filter membrane.
8. The method for preparing tricholoma matsutake yeast fermentation liquor with efficacy of repairing and resisting senescence according to claim 1, wherein in step S4, the aeration sealing culture is specifically as follows: after air-tight sealing, shaking the shaking table at the rotation speed of 100-250 rpm at the temperature of 28-32 ℃, and shaking for culturing for 7-15 days.
9. The method for preparing tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects as claimed in claim 1, wherein the tricholoma matsutake yeast fermentation liquor is obtained by filtering, centrifuging or ultrasonic centrifuging twice or more, and decolorizing and deodorizing.
10. The use of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects as claimed in any one of claims 1 to 9, wherein the tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects can be used as any one of additives of cosmetic essence, lotion, toner, cream and mask for application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211364506.1A CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211364506.1A CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115678805A true CN115678805A (en) | 2023-02-03 |
| CN115678805B CN115678805B (en) | 2023-06-13 |
Family
ID=85047339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211364506.1A Active CN115678805B (en) | 2022-11-02 | 2022-11-02 | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115678805B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
| CN117281748A (en) * | 2023-07-14 | 2023-12-26 | 广东真丽斯化妆品有限公司 | A cosmetic composition containing mushroom extract for promoting skin repair |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420337A (en) * | 2015-12-16 | 2016-03-23 | 四川省中医药科学院 | Matsutake, caterpillar fungus and lactic acid bacteria fermented product as well as derivative cosmetics, preparation method and application thereof |
| CN106085792A (en) * | 2016-06-03 | 2016-11-09 | 西藏大学农牧学院 | A kind of preparation method of tricholoma matsutake mycelium fermented type vinegar beverage |
| CN109106730A (en) * | 2018-09-13 | 2019-01-01 | 长春健康未来医药科技有限公司 | It is a kind of to promote Liver Lipid Metabolism, extract of anti-inflammatory drop enzyme and preparation method thereof |
| JP2019187409A (en) * | 2018-04-20 | 2019-10-31 | 杭州優瑪達生物科技有限公司Ｈａｎｇｚｈｏｕ ＵＭｏｔｏｒ Ｂｉｏｔｅｃｈ Ｃｏ．， ＬＴＤ． | Thermus thermophilus and yeast combined fermentation method |
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
-
2022
- 2022-11-02 CN CN202211364506.1A patent/CN115678805B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105420337A (en) * | 2015-12-16 | 2016-03-23 | 四川省中医药科学院 | Matsutake, caterpillar fungus and lactic acid bacteria fermented product as well as derivative cosmetics, preparation method and application thereof |
| CN106085792A (en) * | 2016-06-03 | 2016-11-09 | 西藏大学农牧学院 | A kind of preparation method of tricholoma matsutake mycelium fermented type vinegar beverage |
| JP2019187409A (en) * | 2018-04-20 | 2019-10-31 | 杭州優瑪達生物科技有限公司Ｈａｎｇｚｈｏｕ ＵＭｏｔｏｒ Ｂｉｏｔｅｃｈ Ｃｏ．， ＬＴＤ． | Thermus thermophilus and yeast combined fermentation method |
| CN109106730A (en) * | 2018-09-13 | 2019-01-01 | 长春健康未来医药科技有限公司 | It is a kind of to promote Liver Lipid Metabolism, extract of anti-inflammatory drop enzyme and preparation method thereof |
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
Non-Patent Citations (1)
| Title |
|---|
| NAN-YEONG LEE等: "Biosynthesis of (R)-(-)-1-Octen-3-ol in Recombinant Saccharomyces cerevisiae with Lipoxygenase-1 and Hydroperoxide Lyase Genes from Tricholoma matsutake", 《J MICROBIOL BIOTECHNOL》, vol. 30, no. 2, pages 296 - 305 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114621881A (en) * | 2021-12-30 | 2022-06-14 | 广州君研生物科技有限公司 | Saccharomyces cerevisiae fermentation liquor and skin care product comprising saccharomyces cerevisiae fermentation liquor |
| CN117281748A (en) * | 2023-07-14 | 2023-12-26 | 广东真丽斯化妆品有限公司 | A cosmetic composition containing mushroom extract for promoting skin repair |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115678805B (en) | 2023-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115678805A (en) | Preparation method and application of tricholoma matsutake yeast fermentation liquor with repairing and anti-aging effects | |
| CN113337545B (en) | Schizophyllum commune fermentation product, preparation method thereof, skin care product and schizophyllum commune culture medium | |
| CN113855603B (en) | Combined fermentation product, skin external preparation containing same, and preparation method and application of combined fermentation product | |
| CN113499287B (en) | Potato ferment, skin external agent containing potato ferment, and preparation method and application of potato ferment | |
| CN106726949B (en) | Grape seed fermentation raw stock cosmetic and preparation method and application thereof | |
| CN114703074B (en) | Saccharomyces cerevisiae and application thereof in preparing brown rice fermentation filtrate for cosmetics | |
| CN113398045A (en) | Anti-aging and relieving aloe fermented product and preparation method and application thereof | |
| CN113101256A (en) | Anti-aging repair nanoemulsion and application thereof | |
| CN116162552B (en) | Preparation method and application of extremely red aspergillus sorghum fermentation product | |
| CN115737490A (en) | Preparation method of Inonotus obliquus yeast fermentation liquor and application of Inonotus obliquus yeast fermentation liquor in cosmetics | |
| CN113648254A (en) | Lupinus acutus and cherry fermentate for cosmetics and preparation method thereof | |
| CN108969430B (en) | Application of American ginseng fermentation liquor as skin care product or skin care product additive | |
| CN113648262A (en) | Lily leaf and cherry fermented product for cosmetic and preparation method thereof | |
| CN115364007B (en) | Roselle flower ferment, external skin preparation containing roselle flower ferment, and preparation method and application of roselle flower ferment | |
| CN114940948B (en) | Tricholoma matsutake and tricholoma matsutake mycelium fermentation medium and preparation method of fermentation broth | |
| CN113662894B (en) | Centella enzymolysis fermentation product and preparation method and application thereof | |
| CN115554206B (en) | Composite ferment for enhancing cell viability and preparation method and application thereof | |
| CN115025025B (en) | Paeonia lactiflora fermentation product and preparation method and application thereof | |
| CN114146040B (en) | Composition for strengthening skin barrier and resisting aging as well as preparation method and application thereof | |
| CN113712888B (en) | Royal jelly separating liquid fermentation product, external skin preparation containing same, and preparation method and application thereof | |
| CN117017842B (en) | Yeast fermentation product filtrate with relieving and repairing effects and preparation method thereof | |
| CN111494255B (en) | Composition containing ginseng cordyceps sinensis fermentation extract and application of composition in cosmetics | |
| CN116650380B (en) | Anti-aging tea fermentation product for improving skin microcirculation and preparation method and application thereof | |
| CN116999362A (en) | Post-treatment process and application of ganoderma lucidum and schisandra chinensis bidirectional fermentation liquor | |
| CN117701642A (en) | Preparation of natural plant fermentation oil and application of natural plant fermentation oil in cosmetics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |