CN115607610B

CN115607610B - Traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or intestinal flora imbalance as well as preparation method and application thereof

Info

Publication number: CN115607610B
Application number: CN202211401723.3A
Authority: CN
Inventors: 李俊; 聂广宁; 王磊; 李雪文
Original assignee: Guangdong Hospital of Traditional Chinese Medicine
Current assignee: Guangdong Hospital of Traditional Chinese Medicine
Priority date: 2022-11-09
Filing date: 2022-11-09
Publication date: 2023-09-26
Anticipated expiration: 2042-11-09
Also published as: CN115607610A

Abstract

The invention belongs to the field of traditional Chinese medicines, and in particular relates to a traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or dysbacteriosis of intestinal tracts, and a preparation method and application thereof. The traditional Chinese medicine composition provided by the invention comprises the following raw materials in parts by weight: 20-40 parts of rhizoma alismatis, 10-20 parts of bighead atractylodes rhizome, 10-15 parts of glossy privet fruit, 10-15 parts of mistletoe, 20-30 parts of kudzuvine root, 10-20 parts of red sage root and 10-15 parts of dried orange peel. The traditional Chinese medicine composition can reduce the weight of mice with postmenopausal glycolipid metabolic disorder, improve the blood sugar and blood lipid level, improve insulin sensitivity and improve liver steatosis, thereby effectively improving the metabolic condition of mice with castration glycolipid metabolic disorder. Meanwhile, the abundance of the mucin Acremonium, the clostridium and the firmicutes in the intestinal flora is increased specifically, the abundance of the Proteus and the Bacteroides martensii is reduced, and the unbalance of the intestinal flora is regulated, so that various diseases are prevented and treated.

Description

Traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or intestinal flora imbalance as well as preparation method and application thereof

Technical Field

The invention belongs to the field of traditional Chinese medicines, and in particular relates to a traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or dysbacteriosis of intestinal tracts, and a preparation method and application thereof.

Background

Women have lower blood lipid levels and only 1/2 risk of cardiovascular disease (Cardiovascular disease, CVD) in men than men of the same age before menopause, but the incidence of postmenopausal glycolipid metabolic disorders (disorder of glycolipid metabolism, DLM) is significantly increased. While DLM is a major risk factor for cardiovascular disease, CVD increases 2-3 fold in postmenopausal women compared to non-menopausal women of the same age, CVD being the leading cause of death in postmenopausal women. Early treatment of postmenopausal glycolipid metabolic disorders, reduction or delay of CVD occurrence, has important significance for improving female quality of life.

Previous researches show that the estrogen can promote the proliferation and migration of intestinal stem cells, is beneficial to maintaining the stability of intestinal microecology and is closely related to intestinal microorganisms. The postmenopausal estrogen level is low, and the intestinal microorganisms are disturbed, so that abnormal metabolism of intestinal liver axis glycolipid is caused, and the promotion of postmenopausal intestinal microecological stabilization is of great significance in the treatment of postmenopausal glycolipid metabolism disturbance.

Menopausal hormone therapy (Menopause hormone therapy, MHT) is the first method of treatment of menopausal related disorders in modern medicine. MHT is effective in alleviating menopausal-related symptoms, but there is a controversy for the benefit of lipid metabolism and guidelines do not recommend MTH for first-line treatment of pre-existing dyslipidemic menopausal women.

The traditional Chinese medicine has unique advantages in treating menopausal related diseases due to multiple target sites, small effect and side effect. However, the existing traditional Chinese medicine for treating the menopausal related diseases is difficult to effectively improve the abnormal glycolipid metabolism or the dysbacteriosis of intestinal tracts, so that the treatment effect on the menopausal related diseases is greatly reduced.

Disclosure of Invention

The first object of the present invention is to provide a Chinese medicinal composition for treating abnormal glycolipid metabolism and/or dysbacteriosis, the second object of the present invention is to provide a preparation method of the Chinese medicinal composition, and the third object of the present invention is to provide an application of the Chinese medicinal composition.

According to a first aspect of the present invention, there is provided a Chinese medicinal composition for treating abnormal glycolipid metabolism and/or dysbacteriosis of the intestinal tract, comprising the following raw materials in parts by weight: 20-40 parts of rhizoma alismatis, 10-20 parts of bighead atractylodes rhizome, 10-15 parts of glossy privet fruit, 10-15 parts of mistletoe, 20-30 parts of kudzuvine root, 10-20 parts of red sage root and 10-15 parts of dried orange peel.

The invention considers that the kidney qi deficiency exists after female menopause due to 'seven, deficiency of any pulse, little weak pulse of the too-strong pulse and exhaustion of the sky'. Spleen and kidney deficiency can lead to phlegm turbidity and blood stasis, and postmenopausal glycolipid metabolic disorder. The theory of postmenopausal diseases should follow "Tian Jiu is absolute, which belongs to Taiyin", i.e. spleen qi is deficient, and it should be nourished for the postnatal day.

Aiming at the pathogenesis of postmenopausal kidney qi deficiency and phlegm dampness stagnation, the invention takes Loranthus mulberry mistletoe and rhizoma alismatis, which are used for tonifying kidney qi and purging kidney turbidity, as monarch, minister, bighead atractylodes rhizome, which is used for strengthening the spleen and soil after the birth, to nourish the congenital, and bighead atractylodes rhizome, which is used for drying dampness and promoting diuresis, is matched with rhizoma alismatis, so as to promote diuresis and remove dampness, and glossy privet fruit, which is used for tonifying kidney and nourishing yin, and reinforcing the kidney. Radix Puerariae is added to strengthen spleen and raise yang so as to promote turbid qi to descend; because water is easy to bind with blood, blood stasis is caused, and Danshen root is used for activating blood and removing stasis. Dried orange peel can strengthen the ability of regulating qi and strengthening spleen, drying dampness and resolving phlegm. The whole prescription has the effects of tonifying and reducing, tonifying and taking into account kidney qi and kidney yin, and the effects of tonifying and reducing phlegm-dampness and blood stasis, aiming at the nuclear heart disease machine, tonifying but not stagnating, reducing but not passing, and has the effects of tonifying kidney and strengthening spleen, eliminating phlegm and removing blood stasis and reducing turbidity, and tonifying middle-jiao and purgation.

The sources of the raw materials of the invention are as follows:

oriental Waterplantain rhizome: dried tubers of alisma Alisma orientalis (Sam.) Juzep. Sweet, light and cold. Enter kidney and bladder meridians.

White atractylodes rhizome: dried rhizome of Atractylodes macrocephala Atractylodes macrocephala Koidz. Bitter, sweet and warm. Enter spleen and stomach meridians.

Fructus ligustri lucidi: dried mature fruit of ligustrum lucidum Ligustrum lucidum Ait. Sweet, bitter and cool. It enters liver and kidney meridians.

Loranthus mulberry mistletoe: branches and leaves of Loranthaceae plant Loranthaceae, sichuan parasitics, safflower parasitics and Mao Shedun fruit parasitics. Sweet and flat. It enters liver and kidney meridians.

Radix Puerariae: dried root of kudzu Pueraria lobata (Willd.) Ohwi or Pueraria thomsonii Pueraria thomsonii benth. Sweet, pungent and cool. Enter spleen, stomach and lung meridians.

Root of red-rooted salvia: root of Salvia Miltiorrhiza bge of Labiatae. Bitter and slightly cold. It enters heart and liver meridians.

Dried orange peel: the dry ripe pericarp of the rutaceae plant orange Citrus reticulata Blanco and its cultivar. Bitter, pungent and warm. Enter lung and spleen meridians.

In some embodiments, the composition of the raw materials in parts by weight comprises: 20 parts of rhizoma alismatis, 10 parts of bighead atractylodes rhizome, 15 parts of glossy privet fruit, 15 parts of mistletoe, 20 parts of kudzuvine root, 10 parts of red sage root and 10 parts of dried orange peel.

In some embodiments, pharmaceutically acceptable excipients are also included.

In some embodiments, the dosage form of the traditional Chinese medicine composition is decoction, granule, powder, tablet, pill or capsule.

According to a second aspect of the present invention, there is provided a method for preparing a Chinese medicinal composition for treating abnormal glycolipid metabolism and/or dysbacteriosis, comprising the steps of:

(1) Weighing the raw materials according to the proportion, soaking the raw materials in water for 30-40min, decocting for 1-2 times, and filtering to obtain water extract;

(2) Concentrating the water extract, adding 1-3 times of 95% ethanol into the concentrated water extract for alcohol precipitation until the concentration of ethanol in the water extract is 60% -80%, standing at 4deg.C for 24 hr, filtering, and concentrating the filtrate under reduced pressure to obtain concentrated extract;

(3) Freezing the concentrated extract at-80deg.C for 12-48 hr to obtain frozen extract, and lyophilizing the frozen extract.

According to a third aspect of the present invention, there is provided the use of the above-mentioned Chinese medicinal composition in the preparation of a medicament for the treatment of postmenopausal metabolic syndrome.

According to a fourth aspect of the present invention, there is provided the use of a Chinese medicinal composition as described above in the manufacture of a medicament for the treatment of abnormal glycolipid metabolism and/or dysbacteriosis.

In some embodiments, the intestinal flora includes at least one of akkermansia muciniphila (Akkermansia muciniphila), clostridium (Clostridium scindens), firmicutes, proteobactirium (Proteobateria), and bacteroides martensii (Bacteroides massiliensis).

The beneficial effects of the invention include:

(1) The traditional Chinese medicine composition disclosed by the invention can obviously reduce the weight, abdominal circumference, blood sugar, serum total cholesterol, serum triglyceride and low-density lipoprotein of a mouse with postmenopausal glycolipid metabolism disorder, increase the high-density total protein, improve glucose tolerance, insulin sensitivity and insulin resistance, reduce liver lipopathy, and reduce liver lipid accumulation and cavitation degree, thereby preventing and treating postmenopausal cardiovascular adverse events.

(2) The traditional Chinese medicine composition disclosed by the invention can be used for remarkably increasing the abundance of mucin Acremodelling bacteria (Akkermansia muciniphila), clostridium (Clostridium scindens) and Firmicutes in the intestinal tract of a mouse with postmenopausal glycolipid metabolism disorder, reducing the abundance of Proteus (Proteibacteria) and Bacteroides martensii (Bacteroides massiliensis) and regulating the unbalance of intestinal flora, so that diseases related to abnormal glycolipid metabolism caused by menopause and high-calorie diet can be prevented and treated.

Drawings

FIG. 1 is a Swiss stain (200X) of a mouse post-castration vaginal cast cell smear, where A is pre-estrus; b is estrus; c is the later estrus; d is estrus interval.

Fig. 2 is the effect of the Chinese medicinal composition on the weight of mice, abdominal circumference, uterine weight, etc., wherein a is the weight of mice (n=10,weekly testing during the experiment); b is the mouse abdominal circumference (n=10, < >>) The method comprises the steps of carrying out a first treatment on the surface of the C is the mouse uterine weight (n=10,) The method comprises the steps of carrying out a first treatment on the surface of the D is the uterine coefficient (n=10, +.>) The method comprises the steps of carrying out a first treatment on the surface of the * Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

FIG. 3 shows the effect of a Chinese medicinal composition on blood glucose, glucose tolerance, insulin resistance, etc. of mice, wherein A is fasting blood glucose of mice, detected every two weeks during the experiment; b is a glucose tolerance detection result; c is the insulin resistance detection result; d is the area under the glucose tolerance curve; e is the area under the insulin resistance curve; f is the fasting serum insulin content of the mice; g is insulin resistance index (HOMA-IR); n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

FIG. 4 is the effect of a Chinese medicinal composition on lipid metabolism in mice, wherein A is the total serum cholesterol level in mice; b is the content of triglyceride in serum of the mice; c is the content of high-density lipoprotein in the serum of the mice; d is the content of the serum low-density lipoprotein of the mice; n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

FIG. 5 is the effect of a Chinese medicinal composition on mouse liver, wherein A is mouse liver weight; b is the HE staining result of the liver of the mice; n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

FIG. 6 is a flow chart of the experimental procedure for pretreatment of DNA sequencing analysis of intestinal flora of mice.

FIG. 7 is a flow chart showing the steps of DNA sequencing analysis of intestinal flora of mice.

Fig. 8 shows the principal component analysis of the intestinal flora by the Chinese medicinal composition, wherein the scales of the horizontal and vertical axes are relative distances, and have no practical significance. pca1 and pca2 represent suspected factors that shift the composition of each group of microorganisms, respectively.

FIG. 9 is a graph showing the effect of a Chinese medicinal composition on the composition of the species of intestinal flora of mice.

FIG. 10 shows the effect of a Chinese medicinal composition on the intestinal flora of mice.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but embodiments of the present invention are not limited thereto. The materials referred to in the following examples are all available from commercial sources.

Example 1

The traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or dysbacteriosis of the intestinal flora of the embodiment is prepared from the following components: 600g of rhizoma alismatis, 300g of bighead atractylodes rhizome, 450g of glossy privet fruit, 450g of Chinese taxillus twig, 600g of kudzuvine root, 300g of red sage root and 300g of dried orange peel.

The preparation method comprises the following steps:

(1) Soaking 3kg of raw materials in 18.5L of distilled water for 0.5h, decocting for 1h, and collecting extract and residue respectively; repeatedly decocting the residue in 18.5L water for 1 hr, collecting extractive solution, mixing the extractive solutions, and filtering with gauze to obtain water extractive solution;

(2) Concentrating the water extract to 3L by using a rotary evaporator, adding 5.3L of 95% ethanol into the concentrated water extract for alcohol precipitation, stirring and adding until the concentration of the ethanol in the water extract is 60%, standing for 24h at 4 ℃, filtering, and concentrating the filtrate to 1L by using the rotary evaporator at 60 ℃ under reduced pressure to obtain a concentrated extract;

(3) Freezing the concentrated extract at-80deg.C for 12 hr to obtain frozen extract, and lyophilizing the frozen extract with a lyophilizer to obtain 530g lyophilized extract powder.

In the following, in order to verify the improvement of the abnormal glycolipid metabolism and/or the intestinal dysbacteriosis by the present invention, the following animal experiments were performed.

1. Experimental animal

C57BL/6 mice (female, 6-8 weeks old, weight 20-22 g) purchased from Guangdong province medical laboratory animal center (approved number: SCXK (YIE) 2018-0002, china) were kept in SPF environment (temperature 22.+ -. 2 ℃ C., humidity 50.+ -. 10%) and provided with food and water.

2. Experimental reagent

4% paraformaldehyde (china bi yun tian); total Cholesterol (TC) assay kit (south kyo build company, china); triglyceride (TG) assay kit (south kyo build company, china); high density lipoprotein (HDL-C) assay kit (Nanjing build company, china); low density lipoprotein (LDL-C) assay kit (south kyo build company, china); mouse insulin ELISA kit (Nanjing build company, china); glutamic pyruvic transaminase (ALT/GPT) test box (Nanjing build company of China); glutamic-oxaloacetic transaminase (AST/GOT) test box (south kyo build company, china); creatinine (Cr) assay kit (south kyo build company, china); uric Acid (UA) assay kit (Nanjing build Corp., china); hematoxylin staining solution (China Biyun day).

3. Experimental instrument and consumable

Disposable syringe for injection (1 mL) (China Corp.); laser confocal cuvette (chinese new company); glucometer (Roche company switzerland); blood glucose test paper (Roche company, switzerland); electronic analytical balance (Mettler-Toledo, switzerland); inverted microscope (Olympus corporation, usa); microplate reader (BioTek company, usa); pipetting gun (Eppendorf company, germany); refrigerated high speed centrifuges (Eppendorf, germany); tissue embedding machine (Thermo company, usa); paraffin microtomes (Leica company, germany); full-automatic dyeing and sealing integrated workstation (Leica company, germany).

4. Construction of the mouse glycolipid metabolism phenotype of postmenopausal disturbance of glycolipid metabolism

80C 57BL/6 mice (female, 6-8 weeks old, body weight 20-22 g) were subjected to ovariectomy (OVX, n=60) or sham surgery (n=20). The ovarian removal experiment steps are as follows: after 1 week of adaptive feeding, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (40 mg/kg), Y-shaped uterus was found through a lower abdomen median incision under aseptic conditions, ovaries were found at each uterine end, and after ligation and excision of all ovarian tissues, the abdominal cavity was closed by suturing. The postoperative mice are naturally awake, and are given a conventional penicillin intramuscular injection treatment for 2 days, the feeding amount and wound healing condition of the mice are observed every day, vaginal cytology smears are carried out for 5 continuous days after the operation, the change of estrus cycle is judged, whether the surgical castration is successful or not is judged according to the cytology smears, and a postmenopausal mouse model is established. 50 mice in the menopausal model are given 6 weeks high calorie diet (HFD) until the weight and the fasting blood glucose values of the mice are significantly different from those of the normal mice (4-6 weeks), and the mice model of postmenopausal glycolipid metabolic disturbance is successfully constructed; another 10 menopausal model mice were given a Normal Diet (ND). Procedure of sham surgery experiment referring to the above-described ovariectomy experiment, except that after the uterus was cut, ovariectomy was not excised and the abdominal cavity was closed by suturing. Among sham operated mice, 10 were given a normal diet, and the other 10 were given a high calorie diet.

The ovariectomized mice were fed with high-sugar high-fat feed for 6 weeks to form a postmenopausal mouse model of glycolipid metabolic disorders. After successful molding, gastric lavage administration was performed for 12 weeks while continuing the diet of the high-sugar high-fat diet. The glucose tolerance test and the insulin tolerance test were performed at 18 weeks, and tissues such as blood, liver, fat, skeletal muscle and the like were left on the day of the end of the experiment for subsequent detection, while the mouse abdominal circumference was measured with a tape measure, and the uterus was weighed.

The mouse is castrated and stained (200×) with a vaginal abscission cell smear swiss as shown in fig. 1, wherein fig. 1A is a prophase, where a large number of large-sized nucleated epithelial cells and a small number of flattened keratinocytes are visible; FIG. 1B is estrus, showing a number of "snowy" flattened keratinocytes; FIG. 1C shows three types of cells, namely nucleated epithelial cells, keratinocytes and leukocytes, in the late estrus; FIG. 1D shows estrus, in which a small number of nucleated epithelial cells, keratinocytes and a large number of leukocytes are seen.

5. Experimental grouping and administration

The experimental mice were divided into the following 8 groups:

sham surgery group (Sham surgery + general diet, abbreviated as Sham);

ovariectomy group (ovariectomy + normal diet, abbreviated OVX);

high fat diet group (sham surgery + high fat diet, abbreviated HFD);

model group (ovariectomy + high fat diet, abbreviated OVX + HFD);

a low dose group of herbal compositions (ovariectomy + high fat diet + low dose herbal composition, abbreviated OVX + HFD + TKRDF-L);

dose group in Chinese medicinal composition (ovariectomy + high fat diet + medium dose Chinese medicinal composition, abbreviated OVX + HFD + TKRDF-M);

high dose group of Chinese medicinal composition (ovariectomy + high fat diet + high dose Chinese medicinal composition, abbreviated OVX + HFD + TKRDF-H);

positive group (ovariectomy + high fat diet + positive, abbreviated OVX + HFD + E2).

Each group had 10.

Wherein, the sham operation group, the ovariectomy group, the high-fat diet group and the model group are not interfered by medicines, and the other groups are administrated as follows:

low dose group of traditional Chinese medicine composition: the dosage of the Chinese medicinal composition prepared in example 1 was 11.9mg/g/day (medicinal weight/mouse weight/day, the same applies below).

Dose group in the traditional Chinese medicine composition: the dosage of the traditional Chinese medicine composition prepared in the embodiment 1 is 23.8mg/g/day.

High dose group of traditional Chinese medicine composition: the dosage of the traditional Chinese medicine composition prepared in the embodiment 1 is 47.5mg/g/day.

Positive drug group: estradiol valerate tablet as positive medicine in the dosage of 0.0056mg/g/day.

The Chinese medicinal composition is administered by stomach infusion in low, medium and high dosage groups and positive medicinal group, and the administration period is 12 weeks.

6. Determination of glycolipid metabolism-related index

1. Body weight and fasting glycemia (FBG) assay

During the experimental period, the body weight was measured once a week and the fasting blood glucose was measured once every two weeks. The method for measuring fasting blood glucose comprises the following steps: all mice were fasted without water for 8 hours and the scissors were placed in a sterilization box for high temperature and high pressure sterilization the day before the experiment. After pacifying the mice, cutting off a small opening on the tail of the mice, discarding the first drop of blood, taking a drop of fresh blood to directly drop on blood glucose test paper (a rogowski blood glucose meter and matched test paper thereof are adopted, the test paper is only used once), reading and recording blood glucose value data, and then treating the wound of the tail of the mice with a proper amount of alcohol.

2. Oral Glucose Tolerance Test (OGTT)

At week 18 of the experiment, mice were subjected to OGTT assay: all mice were fasted without water for 12 hours, and then each group of mice was perfused with 2.0g/kg glucose solution, and blood glucose values of 0h, 0.5h, 1.0h, 1.5h and 2h of each mouse were measured and recorded at a time of the perfusing, and the measurement method of blood glucose was referred to the measurement method of FBG.

3. Insulin resistance test (IGITT)

At week 18 of the experiment, mice were subjected to IGITT assay: all mice are fasted without water inhibition for 12 hours, insulin is diluted by normal saline to prepare insulin with the concentration of 0.5U/10mL, the weight of the mice is measured, the insulin injection quantity (0.1 mL/10 g) is calculated according to the weight, the blood sugar is measured before the insulin injection, the blood sugar is measured respectively at 15min, 30min, 45min and 60min after the intraperitoneal injection of the insulin of the mice, the measuring method of the blood sugar is referred to the measuring method of FBG, and each cage is supplemented with feed after the experiment is finished.

4. Abdominal circumference: after the end of the 18-week experiment, the mice were anesthetized and their abdominal circumference was measured with a tape measure.

5. Uterine weight: after the end of the 18-week experiment, the mice were anesthetized, their uterus was taken and placed on an analytical balance for weighing.

6. Measurement of blood Biochemical index

After the end of the 18-week experiment, serum from the mice was taken to measure four terms of blood lipids (total cholesterol (TC), total Triglyceride (TG), high density lipoprotein (HDL-C) and low density lipoprotein (LDL-C)), creatinine (CRE), uric Acid (UA), glutamic pyruvic transaminase (ALT) and glutamic oxaloacetic transaminase (AST), and serum Insulin (INS) was also measured. The 9 indexes are all measured by corresponding kits, and the operation is performed according to the instructions of the kits.

7. Hematoxylin-eosin (HE) staining method

The livers of 6 mice in each group were obtained and subjected to conventional fixing, dehydration, embedding and slicing treatments to prepare paraffin sections of 4 μm. Dewaxing and baking slices by using xylene, gradient ethanol and distilled water, dyeing the tissue slices according to a method described by an HE (high-performance organic) dyeing kit, and dehydrating, transparentizing and sealing the tissue slices after dyeing. Finally, an optical microscope is used for shooting liver tissue sections, and the pathological changes of the liver of the mice are observed.

7. Statistical method

The SPSS 22.0 statistical software is adopted, the measurement data result is expressed as mean + -standard deviation (mean + -SD), the comparison among the groups adopts single factor analysis of variance, the comparison is tested by LSD, and the test level alpha=0.05.

8. Measurement results of glycolipid metabolism-related index

1. Influence of the Chinese medicinal composition on weight, abdominal circumference, uterus weight, etc. of mice

The body weight, abdominal circumference, uterine weight, uterine coefficients of each group of mice are shown in fig. 2, where fig. 2A is the body weight of the mice (n=10,weekly testing during the experiment); fig. 2B shows the mouse abdominal circumference (n=10,/-for the mice>) The method comprises the steps of carrying out a first treatment on the surface of the Fig. 2C is the uterine weight of the mice (n=10,/-for mice>) The method comprises the steps of carrying out a first treatment on the surface of the Fig. 2D shows the uterine coefficients (n=10, < >>) The method comprises the steps of carrying out a first treatment on the surface of the * Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

The weight of mice in the model group was continuously increased (fig. 2A) due to the continuous administration of the high calorie diet, while the weights of mice in the low, medium and high dose groups and the positive drug group were increased and retarded to different extents, and the weights were reduced compared with the model group, and had statistical significance (p < 0.05). Wherein, the high dose group and the positive group of the traditional Chinese medicine composition have weight reduction at the 12 th week (p <0.05 compared with the model group). Of the three groups of mice given the Chinese medicinal composition, the mice in the high-dose group had the most weight loss, and a statistically significant weight loss was observed first at week 12 (p <0.01 compared to the model group), and at week 13, the Chinese medicinal composition was also observed to have a different degree of weight loss in the low-and medium-dose groups compared to the model group (p <0.01 compared to the model group), and had a dose-effect relationship. There was no statistical difference between the low, medium and high dose groups of the traditional Chinese medicine composition compared to the positive group at each time point, but there was a significant decrease in body weight of the positive group compared to the model group only at week 12 (p < 0.05), there was no statistical difference compared to the model group (p > 0.05) for the remaining weeks, and the body weight advantage of the high dose group of the traditional Chinese medicine composition was maintained until the end of the experiment (p <0.05 compared to the model group). Therefore, the effect of the traditional Chinese medicine composition on weight reduction is superior to that of the positive medicine estradiol valerate.

The abdominal circumference results (fig. 2B) show that the lower, middle and higher doses of the Chinese medicinal composition can reduce the abdominal circumference (p <0.01 compared with the model group), and the data and the weight data are mutually proved.

The results of the uterine weights of mice (fig. 2C) showed that there was no significant difference in uterine weights of mice in the high fat diet group compared to the sham-operated group, nor did the uterine weights of mice in the ovaries-removed group drop, while the uterine weights of the model group significantly decreased (p < 0.01) compared to the sham-operated group under the dual action of castration and high calorie diet, and the uterine weights of mice increased after administration of both the traditional Chinese medicine composition and the positive drug, but there was no significant difference compared to the model group.

The uterine weights of the mice were divided by their corresponding body weights to obtain uterine coefficients (fig. 2D), and the calculated uterine coefficient data and uterine weight trend were similar.

2. Influence of Chinese medicinal composition on glucose metabolism of mice

The results of the measurement of blood glucose, glucose tolerance, insulin resistance, etc. in each group of mice are shown in FIG. 3, wherein FIG. 3A shows the fasting blood glucose of the mice, and one test is performed every two weeks during the experimentSecondary times; FIG. 3B shows the results of glucose tolerance test; FIG. 3C is an insulin resistance test result; FIG. 3D is the area under the glucose tolerance curve; FIG. 3E is the area under the insulin resistance curve; FIG. 3F is the fasting serum insulin levels of mice; FIG. 3G is the insulin resistance index (HOMA-IR). n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

Fasting blood glucose data (fig. 3A) shows that the model group showed significant blood glucose elevation over baseline. The high dose of the Chinese medicinal composition showed efficacy already at week 12 of the experiment (week 6 of administration), and the fasting blood glucose level was reduced (p < 0.01) compared to the model group, and the low and medium dose of the Chinese medicinal composition also showed a blood glucose level reduction (p < 0.01) compared to the model group after week 14 of the experiment (week 8 of administration). While significant reductions in blood glucose levels (p < 0.05) occurred at week 14 of the experiment (week 8 of dosing), the positive drug group had an elevated rebound in blood glucose at week 18 of the experiment (week 12 of dosing), while the individual dose groups of the traditional Chinese medicinal composition were in a sustained regulatory decline in blood glucose overall. In general, each dosage group of the traditional Chinese medicine composition has better effect than the positive medicine group in reducing fasting blood glucose level.

Insulin resistance and hyperinsulinemia are precursors to the development of type 2 diabetes. Animal experiment results show that the traditional Chinese medicine composition can improve glucose tolerance and insulin sensitivity, and specifically:

the glucose tolerance test results show that compared with the model group, the low, medium and high dose groups of the traditional Chinese medicine composition can significantly improve the OGTT result (p < 0.01) and have a dose-effect relationship (figure 3B and figure 3D). The results of the insulin resistance test showed that the high fat diet group and the model group were insensitive to insulin (p < 0.01) compared to the sham operation group, the model group had the worst insulin sensitivity, and the sensitivity to insulin was increased (p <0.01 compared to the model group) after administration of low, medium, and high doses of the Chinese medicinal composition. Serum insulin test results showed (fig. 3F) that each dose group of the Chinese medicinal composition had a tendency to decrease the content of serum free insulin, but there was no statistical difference compared to the model group. The results of insulin resistance index calculated according to fasting blood glucose data and fasting insulin data show (figure 3G), the insulin resistance index of the model group is higher than that of the sham operation group (p < 0.01), the low, medium and high dose groups of the traditional Chinese medicine composition can effectively improve the insulin resistance index, improve the insulin utilization rate, and have statistical significance (p < 0.05) compared with the model group, and the difference has no significance (p > 0.05) compared with the positive medicine group and the model group.

3. Influence of Chinese medicinal composition on lipid metabolism of mice

The four detection results of the serum blood lipid of each group of mice are shown in fig. 4, wherein fig. 4A shows the total cholesterol content of the serum of the mice; FIG. 4B is the serum triglyceride content of mice; FIG. 4C shows the serum HDL content of mice; FIG. 4D shows serum low density lipoprotein levels of mice. n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

The results showed that the total cholesterol, triglyceride and low density lipoprotein levels were all significantly elevated in the model group compared to the sham-operated group (p < 0.01), and that the serum total cholesterol levels were reduced in both the individual dose and positive drug groups of the traditional Chinese medicine composition compared to the model group (p < 0.01) (fig. 4A); the high dose group and the positive group of the traditional Chinese medicine composition can reduce the content of serum triglyceride (p < 0.05) (figure 4B); for serum low density lipoprotein, each dose group of the Chinese medicinal composition had a decreasing trend compared with the model group, but no statistical significance, and the positive medicinal group had the same trend (fig. 4D); for high density total protein, neither the group of Chinese medicinal compositions nor the group of positive drugs had a significant effect, but the group of Chinese medicinal compositions at high doses had a tendency to raise high density lipoproteins (FIG. 4C).

4. Influence of traditional Chinese medicine composition on mouse liver

The liver measurement results of each group of mice are shown in fig. 5, wherein fig. 5A is the liver weight of the mice; FIG. 5B shows the results of HE staining of the liver of mice, as shown in FIG. 5BOvx+hfd+ld refers to ovx+hfd+tkrdf-L, ovx+hfd+md refers to ovx+hfd+tkrdf-M, and ovx+hfd+hd refers to ovx+hfd+tkrdf-H. n=10 and,* Represents p<0.05 represents p<0.01 x represents p<0.001 denotes p<0.0001。

The livers of the mice were weighed and the results showed no significant difference in liver weight between the groups of mice (fig. 5A). The mice livers were subjected to embedding, slicing and HE staining to observe pathological changes of the livers of the mice in each group, and the results showed that the mice in the model group had lipid accumulation and increased vacuolation, and that each dose group of the Chinese medicinal composition could significantly improve the pathological changes, and the effect was better as the dose of the Chinese medicinal composition was increased (fig. 5B).

In conclusion, the traditional Chinese medicine composition disclosed by the invention can reduce the weight of a model mouse, improve the blood sugar and blood lipid level, improve insulin sensitivity and improve liver steatosis, so that the metabolic condition of a castrated glycolipid metabolic disorder mouse is effectively improved.

9. Determination of intestinal flora

Intestinal microorganisms are a huge and complex population, the variety of the intestinal microorganisms is 500-1000, the total number of bacteria is 100 trillion, and the intestinal microorganisms are 10 times of the total number of cells of a human body. The intestinal flora mainly comprises anaerobic bacteria, facultative anaerobic bacteria and aerobic bacteria, wherein the anaerobic bacteria account for more than 99 percent. In the human gut, a large number of microbial communities, 9 species of bacteria were found, including Firmicutes, bacteroides (bacterioides), proteobates, actinomycetes (actionobacteria), fusobacterium (fusobacterium), verrucomicrobia (Verrucomicrobia), cyanobacteria (Cyanobacteria), spirochetes (spiraea), and vadin 97. Most of the flora is considered to be obligate anaerobes, with the Firmicutes (mainly clostridium; 50-70% of all bacteria), bacteroides (10-30%), proteobates (10%), and actinomycetes (5%). Most of them are bacteroides (bacterioides) and Firmicutes (Firmicutes), which occupy more than 98% of the absolute advantage.

To explore the effect of the traditional Chinese medicine composition on intestinal flora of mice with postmenopausal glycolipid metabolic disorders, intestinal contents are also collected, intestinal flora DNA is extracted, and 16SrDNA sequencing is performed.

1. Sample collection: taking out the whole intestinal tract of the mouse by using a sterile forceps and a surgical scissors, cutting off the content from the cecum to the colon, taking out the content, placing the content in a sterile freezing tube for preservation, placing the content in liquid nitrogen for freezing for more than 2 hours, and transferring the content to a refrigerator at the temperature of minus 80 ℃ for preservation after the freezing is ensured to be sufficient.

2. Intestinal flora DNA extraction: the intestinal flora DNA is extracted according to instructions by adopting a fecal extraction kit.

3. 16SrDNA sequencing:

(1) Experimental procedure

Preparing a PCR reaction system by taking 30ng of the qualified genome DNA sample extracted in the previous step 2 and a corresponding fusion primer, wherein the sequence of the used primer is as follows: 338F: ACTCCTACGGGAGGCAGCAG;806R: GGACTACHVGGGTWTCTAAT. Setting PCR reaction parameters to perform PCR amplification, purifying the PCR amplification product by using AgencourtAMPure XP magnetic beads, dissolving in an absorption Buffer, and labeling to complete library establishment. Fragment ranges and concentrations of the library were detected using an Agilent2100 Bioanalyzer. The library that was qualified was sequenced by selecting the HiSeq platform based on insert size. The experimental flow chart is shown in fig. 6.

(2) Information analysis flow

The information analysis flow chart is shown in fig. 7. Filtering the sequencing data in the step (1), and using the remaining high-quality Clean data for later analysis; splicing reads into Tags through an overlap relation between the reads; clustering Tags into OTUs and comparing with a database and annotating species; sample species complexity analysis, inter-group species difference analysis, and correlation analysis and model prediction are performed based on OTU and annotation results.

(3) The sample sequencing data processing comprises the following specific steps:

and (3) data filtering: the original sequencing Data is processed as follows to obtain Clean Data, and the specific steps are as follows:

the method for removing low-quality data according to the window comprises the following specific operations: setting a window of 25bp, and if the average homogeneity value of the window is lower than 20, cutting off the base at the rear end from the window; after truncation the entire sequence is removed with a read length 75% less than the original read length.

Removing adaptor pollution reads (15 bp overlap between the default adaptor sequence and the read sequence, which is set to 15bp, and the allowable mismatch number is 3 bp);

removing reads containing N; low complexity reads are removed (default reads are low complexity reads with consecutive base lengths ≡10).

Samples are distinguished according to the barcode and the primer, and the number of mismatches allowed by the comparison of the barcode sequence and sequencing reads is 0bp.

Tags connection: and (3) sequence splicing, namely assembling paired reads obtained by sequencing the two ends into a sequence by utilizing an overlapping relation by using software FLASH (Fast Length Adjustment of Short reads, v1.2.11), so as to obtain Tags of the hypervariable region. The splicing conditions are as follows:

the minimum matching length is 15bp;

the overlap region allows a mismatch ratio of 0.1.

OTU clustering result statistics:

there are two approaches to OTU clustering. Userch: generating OTU according to 97% sequence similarity cluster; DADA2: ASV sequences, collectively referred to herein as OTUs, are generated by clustering denoised sequences with 100% similarity.

Usearch：

The spliced Tags were clustered into OTUs using software userch (v7.0.1090). The main process is as follows:

a: clustering by UPARSE under 97% similarity to obtain a representative sequence of the OTU;

b: removing the chimera generated by PCR amplification from the OTU representative sequence using UCHIME (v4.2.40);

(alignment of 16S and ITS with existing chimera database method to remove chimera. 18S method to remove chimera by De novo. 16S chimera database: gold database (v 20110519)

ITS chimera database: UNITE (v 201407 03), divided into ITS full length, ITS1 and ITS2, selected according to sequencing region

c: all Tags were aligned back to OTU representative sequences using the usearchglobal method, yielding a statistical table of abundance of OTUs for each sample.

DADA2: denoising was performed using the DADA2 (Divisive Amplicon Denoising Algorithm) method in software QIIME2, resulting in Amplicon Sequence Variants (ASVs), which is a 100% similar sequence. Further, a Feature table (collectively referred to as ASV/ASV or the like) is obtained. The main process is as follows:

a: introducing the filtered double-ended sequence by qiime tools import;

b: constructing a feature table by using a method that the introduced double-ended sequence is based on DADA2 by utilizing a qiime DADA2 denoise-paired command;

c: the feature table is converted to a format that can be viewed directly using qiime tools export.

10. Analysis of the results of the determination of intestinal flora

FIG. 8 is a principal component analysis of intestinal flora of mice of each group, wherein the scale of the horizontal and vertical axes is the relative distance, and has no practical significance; pca1 and pca2 represent suspected factors that shift the composition of each group of microorganisms, respectively. 16s rDNA sequencing results show that the traditional Chinese medicine composition can influence intestinal flora of an ovariectomized mouse with high calorie diet, and principal component analysis results show that the model group has larger difference in the composition of the mouse flora compared with a sham operation group, and the intestinal flora is changed greatly by a high-dose group of the traditional Chinese medicine composition (figure 8).

FIG. 9 shows the composition of intestinal flora species from each group of mice. The results showed that the dominant intestinal flora of the experimental mice of the invention was bacteroides (bacterioides), firmicutes (Firmicutes), proteobacteria (proteobacteria) and Verrucomicrobia (Verrucomicrobia) (fig. 9). Wherein, in the high dose group of the traditional Chinese medicine composition, the relative abundance of Verrucomicrobia (Verrucomicrobia) in the feces of mice exceeds 40%, and the Verrucomicrobia becomes dominant bacteria in the intestinal tract.

FIG. 10 shows the effect of a Chinese medicinal composition on intestinal flora. It is generally believed that in obese intestinal flora, the abundance of bacteroides (bacterioides) is reduced relative to that of slim subjects, and the ratio of bacteroides (firmates) to bacteroides (bacterioides) is significantly increased compared to slim subjects. However, in the present invention, this change does not occur. In the present invention, there was no significant difference in bacteroides (bacterioides) among the mice of each group, and the abundance of the Firmicutes (Firmicutes) was reduced in the model group mice (fig. 10A, B). For the ratio of Firmicutes to bacteroides (bacterioides), model group mice were lower than sham group mice, but there was no statistical difference between groups (fig. 10C).

Modern research has shown that intestinal microorganisms play a key role in the pathogenesis of ulcerative colitis (Ulcerative Colitis, UC) and have shown a significant shift in intestinal flora in patients with UC, such as higher abundance of proteobacteria (proteobacteria) and lower abundance of Firmicutes (firmics). In the present invention, model mice showed higher abundance of Proteus (Prote) and lower abundance of Firmides (Firmides) than sham mice (FIG. 10A), consistent with changes in intestinal flora in UC patients. While each dose group of the Chinese medicinal composition can reduce the abundance of Proteus (Proteus) in comparison with the model group, wherein the high dose group of the Chinese medicinal composition has a significant difference (p=0.0036 compared with the model group). Both the low and medium dose groups of the Chinese medicinal composition increased the abundance of Firmicutes (compared to the model group), with a significant difference (p=0.0106 compared to the model group). The significantly reduced abundance of Firmicutes (Firmicutes) in the high-dose group of the traditional Chinese medicine composition compared to the model group is presumed to be due to the high abundance of Verrucomicrobia (Verrucomicrobia) in the high-dose group of the traditional Chinese medicine composition, which is not the dominant fungus in the intestinal tract of the mice in the high-dose group of the traditional Chinese medicine composition.

Acremonium muciniphilum (Akkermansia muciniphila) in Verrucomicrobia is currently recognized as a beneficial bacterium, a normal flora in the human intestinal tract, and the abundance of Acremonium muciniphilum (Akkermansia muciniphila) in the intestinal flora of obese patients is significantly reduced. Acremonium muciniphilum (Akkermansia muciniphila) is inversely related to obesity, diabetes, cardiovascular disease and low-grade inflammation. The akkermansia muciniphila (Akkermansia muciniphila) not only can protect the integrity of intestinal epithelial cells and mucus layers, but also can play a role in metabolism protection, and the akkermansia muciniphila (Akkermansia muciniphila) can play an anti-inflammatory role in the inflammatory reaction process by regulating T cells, endogenous cannabinoid systems and non-classical Toll-like receptors.

Table 1 shows the abundance of Acremonium muciniphilum (Akkermansia muciniphila) and Clostridium (Clostridium scindens) in each group of mice, showing that high doses of the Chinese medicinal composition significantly increased the abundance of Acremonium muciniphilum (Akkermansia muciniphila) in the phylum Verrucomicroba, becoming an intestinal dominant bacterium (FIG. 10D). In addition, the traditional Chinese medicine composition can also improve the abundance of clostridium (Clostridium scindens) in the intestinal flora of mice (fig. 10E), the abundance of clostridium (Clostridium scindens) of each dose group of the traditional Chinese medicine composition is about twice that of the model group, and the group-to-group differences are obvious (table 1).

TABLE 1 abundance of Alkermansia muciniphila and Clostridium in mice groups

Note that: the p-values in the table are the total p-values between 6 groups.

Meanwhile, the traditional Chinese medicine composition provided by the invention can reduce the abundance of the bacteroides martensii (Bacteroides massiliensis) in the intestinal flora of the mice (figure 10F), the abundance of the bacteroides martensii (Bacteroides massiliensis) in the model group is obviously increased (p < 0.0001) compared with a sham operation group, and the abundance of the bacteroides martensii (Bacteroides massiliensis) in each dose group and the positive medicine group of the traditional Chinese medicine composition is obviously reduced (p < 0.0001) compared with the model group. Modern researches have shown that the abundance of clostridium (Clostridium scindens) is inversely related to waistline, the higher the abundance is, the smaller the waistline is; in cases of prostate cancer, however, the relative abundance of bacteroides equi (Bacteroides massiliensis) is high, and bacteroides equi (Bacteroides massiliensis) is associated with promoting tumorigenesis. However, the effect of the traditional Chinese medicine composition on the two bacterial groups is less than that of Acremonium muciniphilum (Akkermansia muciniphila) from the aspect of the total abundance ratio of intestinal tracts.

In summary, the traditional Chinese medicine composition can regulate the unbalance of intestinal flora by specifically increasing the abundance of mucin Acremonium (Akkermansia muciniphila), clostridium (Clostridium scindens) and Firmicutes (Firmicutes) in the intestinal flora, reducing the abundance of Proteus (Proteus) and Bacteroides martensii (Bacteroides massiliensis), and thus preventing and treating various diseases.

What has been described above is merely some embodiments of the present invention. It will be apparent to those skilled in the art that various modifications and improvements can be made without departing from the spirit of the invention.

Claims

1. The traditional Chinese medicine composition for treating the abnormal glycolipid metabolism and/or the dysbacteriosis of intestinal tracts is characterized by comprising the following raw material medicines in parts by weight: 20-40 parts of rhizoma alismatis, 10-20 parts of bighead atractylodes rhizome, 10-15 parts of glossy privet fruit, 10-15 parts of mistletoe, 20-30 parts of kudzuvine root, 10-20 parts of red sage root and 10-15 parts of dried orange peel.

2. The traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or intestinal dysbacteriosis according to claim 1, which is characterized by comprising the following raw materials in parts by weight: 20 parts of rhizoma alismatis, 10 parts of bighead atractylodes rhizome, 15 parts of glossy privet fruit, 15 parts of mistletoe, 20 parts of kudzuvine root, 10 parts of red sage root and 10 parts of dried orange peel.

3. The traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or dysbacteriosis according to claim 1 or 2, characterized by further comprising pharmaceutically acceptable auxiliary materials.

4. The traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or intestinal flora imbalance according to claim 1 or 2, wherein the traditional Chinese medicine composition is in the form of decoction, granule, powder, tablet, pill or capsule.

5. A method for preparing a traditional Chinese medicine composition for treating abnormal glycolipid metabolism and/or dysbacteriosis according to any one of claims 1 to 4, characterized by comprising the following steps:

6. Use of a traditional Chinese medicine composition according to any one of claims 1-4 for the preparation of a medicament for the treatment of postmenopausal metabolic syndrome.

7. Use of a traditional Chinese medicine composition according to any one of claims 1-4 for the preparation of a medicament for the treatment of abnormal glycolipid metabolism and/or dysbacteriosis in the intestinal tract.

8. The use according to claim 7, wherein the intestinal flora comprises at least one of the mucin ackermanni, clostridium, firmicutes, proteus and bacteroides martensis.