CN115607610A

CN115607610A - Traditional Chinese medicine composition for treating glycolipid metabolism disorder and/or intestinal flora disorder and preparation method and application thereof

Info

Publication number: CN115607610A
Application number: CN202211401723.3A
Authority: CN
Inventors: 李俊; 聂广宁; 王磊; 李雪文
Original assignee: Guangdong Hospital of Traditional Chinese Medicine
Current assignee: Guangdong Hospital of Traditional Chinese Medicine
Priority date: 2022-11-09
Filing date: 2022-11-09
Publication date: 2023-01-17
Anticipated expiration: 2042-11-09
Also published as: CN115607610B

Abstract

The invention belongs to the field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal flora imbalance, and a preparation method and application thereof. The traditional Chinese medicine composition comprises the following raw materials in parts by weight: 20 to 40 parts of rhizoma alismatis, 10 to 20 parts of bighead atractylodes rhizome, 10 to 15 parts of glossy privet fruit, 10 to 15 parts of parasitic loranthus, 20 to 30 parts of kudzuvine root, 10 to 20 parts of salvia miltiorrhiza and 10 to 15 parts of dried orange peel. The traditional Chinese medicine composition disclosed by the invention can reduce the weight of mice with post-menopausal glycolipid metabolic disorders, improve the blood sugar and blood fat levels, improve the insulin sensitivity and improve the hepatic steatosis, so that the metabolic condition of the mice with castrated glycolipid metabolic disorders is effectively improved. Meanwhile, the abundance of akkermansia muciniphila, clostridium and firmicutes in the intestinal flora is specifically increased, the abundance of proteobacteria and bacteroides massiliensis is reduced, and the imbalance of the intestinal flora is adjusted, so that various diseases are prevented and treated.

Description

Traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal flora imbalance and preparation method and application thereof

Technical Field

The invention belongs to the field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal flora imbalance, and a preparation method and application thereof.

Background

Women have lower blood lipid levels and a 1/2 risk of Cardiovascular disease (CVD) in men than in men of the same age before menopause, but the incidence of post-menopausal glycolipid metabolic Disorders (DLM) is significantly increased. DLM is a main risk factor of cardiovascular diseases, and compared with non-menopausal women of the same age, the incidence rate of CVD of postmenopausal women is increased by 2-3 times, and CVD becomes the first cause of death of postmenopausal women. The early treatment of postmenopausal glycolipid metabolic disturbance and the reduction or delay of CVD generation have important significance for improving the life quality of women.

Previous researches show that estrogen can promote the proliferation and migration of intestinal stem cells, is beneficial to maintaining the stability of intestinal microecology and is closely related to intestinal microorganisms. The low estrogen level after menopause and the disturbance of intestinal microorganisms cause the abnormal metabolism of the glycolipid of the intestinal and hepatic axis, so that the promotion of the stable intestinal microecology after menopause has important significance in the treatment of the metabolic disorder of the glycolipid after menopause.

Menopausal Hormone Therapy (MHT) is the first choice of modern medicine for the treatment of menopausal related disorders. MHT is effective in alleviating symptoms associated with menopause, but the benefits of lipid metabolism are controversial and the guidelines do not recommend MTH for first-line treatment of menopausal women with existing dyslipidemia.

The traditional Chinese medicine has unique advantages in treating menopause related diseases due to multi-target effect and small side effect. However, the existing traditional Chinese medicines for treating menopause-related diseases are difficult to effectively improve abnormal glycolipid metabolism or intestinal flora imbalance, so that the treatment effect on the menopause-related diseases is greatly reduced.

Disclosure of Invention

The first purpose of the invention is to provide a traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal dysbacteriosis, the second purpose of the invention is to provide a preparation method of the traditional Chinese medicine composition, and the third purpose of the invention is to provide application of the traditional Chinese medicine composition.

According to the first aspect of the invention, the traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal flora imbalance is provided, and comprises the following raw materials in parts by weight: 20 to 40 parts of oriental waterplantain rhizome, 10 to 20 parts of largehead atractylodes rhizome, 10 to 15 parts of glossy privet fruit, 10 to 15 parts of Chinese taxillus twig, 20 to 30 parts of kudzuvine root, 10 to 20 parts of danshen root and 10 to 15 parts of tangerine peel.

The invention considers that after menopause of women, kidney qi deficiency exists due to 'seven, deficiency of conception vessels, little Taichong vessel failure and exhaustion of Tian Decaho'. Due to the deficiency of the spleen and kidney, phlegm-turbidity and blood stasis are produced internally, causing postmenopausal glycolipid metabolic disturbance. The treatment of postmenopausal diseases is based on the theory that "Tian Decastes and all the people belong to the taiyin system", i.e. spleen qi is deficient and should be nourished for the later days.

Aiming at the pathogenesis of deficiency of kidney qi and stagnation of phlegm-dampness after menopause, the Loranthus parasiticus and the Alisma orientale are used for tonifying kidney qi and purging kidney turbidity, the Loranthus parasiticus and the Alisma orientale are mutually reinforced as monarch drugs, the Atractylodes macrocephala is used for strengthening acquired spleen soil to nourish the congenital, the Atractylodes macrocephala is used for eliminating dampness and promoting diuresis, the Alisma orientale is used for promoting diuresis and removing dampness, and the glossy privet fruit is used for tonifying kidney and nourishing yin and strengthening the kidney tonifying effect. Radix Puerariae is added to strengthen spleen and raise yang to promote the decline of turbid qi; because water is liable to combine with blood to cause blood stasis, dan Shen can activate blood and resolve stasis. Tangerine peel is used to strengthen the actions of regulating qi, strengthening spleen, drying dampness and resolving phlegm. The whole prescription has the effects of tonifying and purging, both kidney qi and kidney yin are taken into consideration for tonifying, phlegm dampness and blood stasis are taken into consideration for purging, the medicine is reasonable in matching according to the core pathogenesis, the tonifying but no stagnation and the purging are realized, the effects of tonifying the kidney and strengthening the spleen, eliminating phlegm and removing blood stasis and lowering turbidity are realized, and the tonifying and purging are realized.

The raw materials of the invention are as follows:

rhizoma alismatis: dried tubers of Alisma orientalis (Sam.) Juzep. Of Alismaceae. Sweet, bland and cold. It enters kidney and bladder meridians.

White atractylodes rhizome: dried rhizome of Atractylodes macrocephala Koidz of Compositae. Bitter, sweet and warm. It enters spleen and stomach meridians.

Glossy privet fruit: dried ripe fruit of Ligustrum lucidum ait of Oleaceae. Sweet, bitter and cool. It enters liver and kidney meridians.

Parasitic loranthus: branches and leaves of herba Taxilli, carthami flos herba Taxilli, and herba Blumeae Laciniatae of Loranthaceae. Sweet and neutral. It enters liver and kidney meridians.

Kudzu root: dried root of Pueraria lobata (Willd.) Ohwi or Pueraria thomsonii Benth, leguminosae. Sweet, pungent and cool. It enters spleen, stomach and lung meridians.

Red sage root: root of Salvia miltiorrhiza bge of Labiatae. Bitter and slightly cold. It enters heart and liver meridians.

Dried orange peel: dried mature pericarp of Citrus reticulata Blanco of the Rutaceae family and its cultivars. Bitter, pungent and warm. It enters lung and spleen meridians.

In some embodiments, the raw material composition comprises, in parts by weight: 20 parts of rhizoma alismatis, 10 parts of bighead atractylodes rhizome, 15 parts of glossy privet fruit, 15 parts of parasitic loranthus, 20 parts of kudzuvine root, 10 parts of salvia miltiorrhiza and 10 parts of dried orange peel.

In some embodiments, pharmaceutically acceptable excipients are also included.

In some embodiments, the Chinese medicinal composition is in the form of decoction, granules, powder, tablets, pills or capsules.

According to a second aspect of the present invention, there is provided a method for preparing the above-mentioned Chinese medicinal composition for treating glycolipid metabolic abnormality and/or intestinal dysbacteriosis, comprising the steps of:

(1) Weighing the raw materials according to the proportion, soaking the raw materials in water for 30-40min, decocting for 1-2 times, and filtering to obtain a water extract;

(2) Concentrating the water extract, adding 1-3 times of 95% ethanol to the concentrated water extract, precipitating with ethanol until the ethanol concentration in the water extract is 60% -80%, standing at 4 deg.C for 24 hr, filtering, and concentrating the filtrate under reduced pressure to obtain concentrated extract;

(3) Freezing the concentrated extract at-80 deg.C for 12-48 hr to obtain frozen extract, and freeze drying.

According to a third aspect of the present invention, there is provided a use of the above-mentioned Chinese medicinal composition in the preparation of a medicament for treating post-menopausal metabolic syndrome.

According to a fourth aspect of the present invention, there is provided a use of the above-mentioned Chinese medicinal composition in the preparation of a medicament for treating glycolipid metabolism disorder and/or intestinal flora disorder.

In some embodiments, the gut flora comprises at least one of Akkermansia muciniphila (Akkermansia muciniphila), clostridium sp.

The beneficial effects of the invention include:

(1) The traditional Chinese medicine composition can obviously reduce the weight, abdominal circumference, blood sugar, serum total cholesterol, serum triglyceride and low-density lipoprotein of mice with post-menopausal glycolipid metabolic disturbance, increase high-density total protein, improve glucose tolerance, insulin sensitivity and insulin resistance, reduce hepatic steatosis and reduce the accumulation and vacuolation degree of liver lipid, thereby preventing and treating the occurrence of post-menopausal cardiovascular adverse events.

(2) The traditional Chinese medicine composition can remarkably increase the abundance of Akkermansia muciniphila (Akkermansia muciniphila), clostridium (Clostridium scabrins) and Firmicutes (Firmicutes) in the intestinal tract of mice with post-menopausal glycolipid metabolic disturbance, reduce the abundance of Proteobateria and Bacteroides madilliensis (Bacteroides massiensis), and regulate the imbalance of intestinal flora, thereby preventing and treating the diseases related to glycolipid metabolic abnormality caused by menopause and high-calorie diet.

Drawings

FIG. 1 is Swiss stain of vagina shed cell smears after castration of mice (200X), where A is prophase estrus; b is estrus; c is the anaphase of estrus; d is an estrus interval.

FIG. 2 shows a Chinese medicinal compositionThe effect of mouse body weight, abdominal circumference, uterine weight, etc., wherein a is mouse body weight (n =10,

weekly testing during the experiment); b is the mouse abdominal circumference (n =10,

) (ii) a C is mouse uterine weight (n =10,

) (ii) a D is the uterine coefficient (n =10,

) (ii) a * Represents p<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001。

FIG. 3 is the effect of the Chinese medicinal composition on the blood sugar, glucose tolerance, insulin tolerance, etc. of mice, wherein A is fasting blood sugar of mice, which is measured every two weeks during the experiment; b is a glucose tolerance test result; c is an insulin tolerance detection result; d is the area under the glucose tolerance curve; e is the area under the insulin tolerance curve; f is the fasting serum insulin content of the mouse; g is the insulin resistance index (HOMA-IR); n =10, and n is a linear variable of,

* Represents p<0.05, denotes p<0.01, represents p<0.001 denotes p<0.0001。

FIG. 4 is a graph of the effect of a Chinese medicinal composition on lipid metabolism in mice, wherein A is the total cholesterol level in serum of the mice; b is the content of triglyceride in the serum of the mouse; c is the content of high-density lipoprotein in mouse serum; d is the content of low-density lipoprotein in mouse serum; n =10 (m) of the total number of the main chains,

* Denotes p<0.05, denotes p<0.01, indicates p<0.001 denotes p<0.0001。

FIG. 5 shows the effect of Chinese medicinal composition on mouse liver, wherein A is the weight of mouse liver(ii) a B is mouse liver HE staining result; n =10, and n is a linear variable of,

* Denotes p<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001。

FIG. 6 is an experimental flow chart of pretreatment of DNA sequencing analysis of mouse intestinal flora.

FIG. 7 is a flow chart of the steps of DNA sequencing analysis of mouse intestinal flora.

Fig. 8 is a principal component analysis of the traditional Chinese medicine composition on intestinal flora, wherein scales of the abscissa axis and the ordinate axis are relative distances and have no practical significance. Each of pca1 and pca2 represents a suspected influence on the shift in the composition of the respective groups of microorganisms.

FIG. 9 is a graph showing the effect of a Chinese medicinal composition on the composition of intestinal flora in mice.

FIG. 10 is a graph of the effect of a Chinese medicinal composition on the intestinal flora of mice.

Detailed Description

The present invention will be described in further detail with reference to specific examples, but the embodiments of the present invention are not limited thereto. The materials referred to in the following examples are commercially available.

Example 1

The traditional Chinese medicine composition for treating glycolipid metabolism abnormality and/or intestinal flora imbalance is prepared from the following components: 600g of rhizoma alismatis, 300g of bighead atractylodes rhizome, 450g of glossy privet fruit, 450g of parasitic loranthus, 600g of radix puerariae, 300g of salvia miltiorrhiza and 300g of dried orange peel.

The preparation method comprises the following steps:

(1) According to the components, 3kg of raw medicinal materials are soaked in 18.5L of distilled water for 0.5h, then decocted for 1h, and an extracting solution and dregs are respectively collected; repeatedly decocting the residue in 18.5L water for 1 hr, collecting extractive solution, mixing the two decoctions, and filtering with gauze to obtain water extractive solution;

(2) Concentrating the water extract to 3L with rotary evaporator, adding 5.3L 95% ethanol into the concentrated water extract, precipitating with ethanol under stirring until the ethanol concentration in the water extract is 60%, standing at 4 deg.C for 24 hr, filtering, and concentrating the filtrate at 60 deg.C under reduced pressure to 1L with rotary evaporator to obtain concentrated extract;

(3) Freezing the concentrated extract at-80 deg.C for 12h to obtain frozen extract, and freeze drying the frozen extract with freeze dryer to obtain 530g of lyophilized extract powder.

Next, in order to verify the improvement of glycolipid metabolism abnormality and intestinal flora disturbance by the Chinese medicinal composition for treating glycolipid metabolism abnormality and/or intestinal flora disturbance of the present invention, the following animal experiments were performed.

1. Laboratory animal

C57BL/6 mice (female, 6-8 weeks old, 20-22 g in body weight) purchased from Guangdong province medical laboratory animal center (Guangzhou, china, approval No.: SCXK (YUE) 2018-0002) were housed in SPF environment (temperature 22 + -2 ℃, humidity 50 + -10%), and food and water were provided.

2. Experimental reagent

4% paraformaldehyde (Bilun sky, china); total Cholesterol (TC) assay kit (nanjing buildingcompany, china); triglyceride (TG) assay kit (nan jing, china built corporation); high density lipoprotein (HDL-C) assay kit (nan jing, china, founded company); low density lipoprotein (LDL-C) assay kit (nan jing, china, established corporation); mouse insulin enzyme linked immunoassay kit (Nanjing, china built company); glutamic-pyruvic transaminase (ALT/GPT) test kit (Nanjing, china built Co.); aspartate aminotransferase (AST/GOT) test kit (Namikyo Indo, china); creatinine (Cr) assay kit (nan jing, china build company); uric Acid (UA) assay kit (nan jing, china, founded company); hematoxylin staining solution (Biyun day, china).

3. Laboratory instrument and consumable

Disposable syringe for injection (1 mL) (china medical care); laser confocal dishes (NEST Corp., china); glucometer (Roche switzerland); blood glucose test strips (Roche, switzerland); an electronic analytical balance (Mettler-Toledo, switzerland); inverted microscope (Olympus, usa); microplate reader (BioTek corp., usa); pipette guns (Eppendorf, germany); refrigerated high speed centrifuges (Eppendorf, germany); tissue embedding machines (Thermo corporation, usa); paraffin microtomes (Leica, germany); full-automatic dyeing and mounting integrated workstation (Leica company, germany).

4. Construction of the post-menopausal glycolipid metabolism disturbance the glycolipid metabolism phenotype in mice

80C 57BL/6 mice (female, 6 to 8 weeks old, 20 to 22g in body weight) were ovariectomized (OVX, n = 60) or sham operated (n = 20). The ovariectomy experiment comprises the following steps: after 1 week of adaptive feeding, mice were anesthetized by injecting 1% sodium pentobarbital (40 mg/kg) into the abdominal cavity, Y-shaped uterus was found through a lower abdominal median incision under aseptic conditions, ovaries were found at the distal end of each uterine side, respectively, and after ligating and excising all ovarian tissues, the abdominal cavity was closed by suturing. The mice after operation are naturally awake, the mice are treated by conventional penicillin intramuscular injection for 2 days, the food intake and the wound healing condition are observed every day, the vaginal cytology smear is continuously carried out for 5 days after the operation, the change of the estrus cycle is judged, whether the operation castration is successful or not is judged according to the result of the cytology smear, and a post-menopausal mouse model is established. 50 of menopausal model mice are given high calorie diet (HFD) for 6 weeks until the weight and fasting blood glucose values of the mice are significantly different from those of normal mice (4-6 weeks), and the post-menopausal glycolipid metabolic disorder mouse model is successfully constructed; another 10 menopausal model mice were given a Normal Diet (ND). Sham surgery experimental procedures reference was made to the ovariectomy experiment described above except that after cutting the uterus, the ovaries were not removed and the abdominal cavity was closed by suturing. In sham operated mice 10 were given a normal diet and 10 were given a high calorie diet.

The ovariectomized mice were fed with high-sugar and high-fat diet for 6 weeks to form a post-menopausal glycolipid metabolic disorder mouse model. After the molding is successful, the intragastric administration is carried out for 12 weeks while continuing the diet of the high-sugar and high-fat diet. The glucose tolerance test and the insulin tolerance test are carried out at 18 weeks, tissues such as blood, liver, fat, skeletal muscle and the like are reserved on the day of experiment ending so as to carry out subsequent detection, meanwhile, the abdominal circumference of the mouse is measured by a tape measure, and the uterus is weighed.

Swiss staining (200X) of vaginal cast cell smears after castration of mice is shown in FIG. 1, wherein FIG. 1A is a prophase of estrus, and a large number of large-volume nucleated epithelial cells and a small number of flat keratinized epithelial cells are visible; FIG. 1B shows estrus, with a large number of "snowy" flattened keratinocytes; FIG. 1C shows the anaphase of estrus, which shows three cells, namely, nucleated epithelial cells, keratinized epithelial cells and leukocytes; FIG. 1D shows the estrus phase, in which three cells, a small number of nucleated epithelial cells, keratinized epithelial cells, and a large number of leukocytes, are observed.

5. Grouping and administration of experiments

The experimental mice were divided into the following 8 groups:

sham group (Sham + general diet, abbreviated Sham);

ovariectomized group (ovariectomized + general diet, abbreviated OVX);

high fat diet group (sham surgery + high fat diet, HFD for short);

model group (ovariectomized + high fat diet, abbreviated OVX + HFD);

the low-dose group of Chinese medicinal composition (ovariectomization + high-fat diet + low-dose Chinese medicinal composition, abbreviated as OVX + HFD + TKRDF-L);

a medium-dose group of Chinese medicinal composition (ovariectomized + high fat diet + medium-dose Chinese medicinal composition, abbreviated as OVX + HFD + TKRDF-M);

a high-dose group of Chinese medicinal composition (ovariectomy + high-fat diet + high-dose Chinese medicinal composition, abbreviated as OVX + HFD + TKRDF-H);

positive drug group (ovariectomization + high fat diet + positive drug, abbreviated as OVX + HFD + E2).

Each group had 10.

Wherein, the sham operation group, the ovariectomized group, the high fat diet group and the model group do not have medicine intervention, and the other groups are administrated as follows:

the low-dose group of the traditional Chinese medicine composition comprises: the dosage of the Chinese medicinal composition prepared in example 1 was 11.9mg/g/day (weight of crude drug/weight of mouse/day, the same applies below).

The traditional Chinese medicine composition comprises the following dosage groups: the dosage of the Chinese medicinal composition prepared in example 1 is 23.8mg/g/day.

High-dose group of Chinese medicinal composition: the dosage of the Chinese medicinal composition prepared in example 1 is 47.5mg/g/day.

A positive drug group: the positive medicine estradiol valerate tablet has the dosage of 0.0056mg/g/day.

The low, medium and high dosage groups and the positive medicine group of the traditional Chinese medicine composition are both administered by intragastric administration, and the administration period is 12 weeks.

6. Measurement of glycolipid metabolism-related index

1. Body weight and Fasting Blood Glucose (FBG) measurements

During the experimental period, the body weight was measured once a week and the fasting blood glucose was measured once every two weeks. The fasting blood glucose determination method comprises the following steps: all mice were fasted for 8 hours without water deprivation, and were autoclaved with scissors in a sterilization box the day before the experiment. After a mouse is pacified, a small opening is cut on the tail of the mouse, after the first drop of blood is discarded, a drop of fresh blood is directly dropped on blood glucose test paper (the Roche glucometer and the matched test paper are adopted, the test paper is only used once), blood glucose value data is read and recorded, and then the tail wound of the mouse is treated by using a proper amount of alcohol.

2. Oral Glucose Tolerance Test (OGTT)

At week 18 of the experiment, the mice were subjected to OGTT assay: all mice were fasted for 12h without water deprivation, and then the mice in each group were gazed with 2.0g/kg of glucose solution, and the blood glucose values of the mice were measured and recorded at 0h, 0.5h, 1.0h, 1.5h and 2h, with the gavage time being 0, and the blood glucose measurement method was determined by the FBG measurement method.

3. Insulin Tolerance Test (IGITT)

At experimental week 18, mice were subjected to an IGITT assay: all mice are fasted for 12 hours without water prohibition, insulin is diluted by normal saline to prepare insulin with the concentration of 0.5U/10mL, the weight of the mice is measured, the insulin injection amount (0.1 mL/10 g) is calculated according to the weight, the blood sugar is measured before the insulin is injected, the blood sugar is measured after the insulin is injected into the abdominal cavity of the mice for 15min, 30min, 45min and 60min respectively, the measurement method of the blood sugar refers to the measurement method of FBG, and each cage is supplemented with feed after the experiment is finished.

4. Abdominal circumference: after the 18 week experiment, the mice were anesthetized and their circumference around the abdomen was measured with a tape.

5. Uterus weight: after the 18-week experiment, the mice were anesthetized, and the uterus was taken and weighed on an analytical balance.

6. Measurement of blood biochemical indices

After the experiment for 18 weeks, serum of the mice is taken to measure four blood lipids (total cholesterol (TC), total Triglyceride (TG), high-density lipoprotein (HDL-C) and low-density lipoprotein (LDL-C)), creatinine (CRE), uric Acid (UA), alanine Aminotransferase (ALT) and glutamic-oxaloacetic transaminase (AST), and serum Insulin (INS) of the mice. The 9 indexes are measured by using corresponding kits, and the operation is carried out according to the kit instructions.

7. Hematoxylin-eosin (HE) staining method

The liver of each group of 6 mice was prepared into 4 μm paraffin sections by conventional fixation, dehydration, embedding and sectioning. Dewaxing and baking slices by xylene, gradient ethanol and distilled water, dyeing the tissue slices according to the method indicated by an HE dyeing kit, and dehydrating, transparentizing and sealing the slices after dyeing. Finally, the liver tissue section is shot by using an optical microscope, and the pathological change condition of the liver of the mouse is observed.

7. Statistical method

SPSS 22.0 statistical software is adopted, the result of the measured data is expressed by mean plus minus standard deviation (mean plus minus SD), the single-factor variance analysis is adopted for the comparison among a plurality of groups, the LSD is used for the comparison in pairs, and the inspection level alpha =0.05.

8. Measurement results of glycolipid metabolism-related indices

1. The effects of the Chinese medicinal composition on weight, abdominal circumference and uterus weight of mice

The body weight, abdominal circumference, uterine weight, and uterine coefficient of each group of mice are shown in fig. 2, in which fig. 2A shows the body weight of the mice (n =10,

weekly testing during the experiment); figure 2B is the mouse abdominal circumference (n =10,

) (ii) a Figure 2C is the mouse uterine weight (n =10,

) (ii) a Fig. 2D is the uterine coefficient (n = 1)0，

) (ii) a * Denotes p<0.05, denotes p<0.01, indicates p<0.001, denotes p<0.0001。

Due to the continuous administration of high-calorie diet, the body weight of the mice in the model group continuously increased (fig. 2A), while the body weights of the mice in the low, medium and high dosage groups and the positive drug group of the traditional Chinese medicine composition increased and slowed down to different degrees, and the body weight average of the mice was reduced compared with the model group, and the mice had statistical significance (p < 0.05). Wherein, the weight loss of the high-dose group and the positive drug group of the traditional Chinese medicine composition occurs first at week 12 (compared with the model group, p is less than 0.05). Among the three groups of mice given the Chinese medicinal composition, the mice in the high dose group showed the most weight loss, the statistically significant weight loss (p <0.01 compared with the model group) appeared at the 12 th week rate, and the mice in the low and medium dose groups showed different degree of weight loss (p <0.01 compared with the model group) in the 13 th week and had dose-effect relationship. Compared with the positive drug group, the low, medium and high dosage groups of the traditional Chinese medicine composition have no statistical difference at each time point, but the weight of the positive drug group is significantly reduced compared with the model group only in the 12 th week (p is less than 0.05), and in the rest weeks, the weight of the high dosage group of the traditional Chinese medicine composition has no statistical difference compared with the model group (p is more than 0.05), and the weight advantage of the high dosage group of the traditional Chinese medicine composition is maintained until the end of the experiment (p is less than 0.05 compared with the model group). Therefore, the effect of the traditional Chinese medicine composition on weight reduction is better than that of the positive medicine estradiol valerate.

The results of abdominal circumference (fig. 2B) show that the low, medium and high doses of the Chinese medicinal composition can reduce the abdominal circumference (p <0.01 compared with the model group), and this data is mutually corroborated with the body weight data.

The results of the weights of the uterus of the mice (fig. 2C) show that the weights of the uterus of the mice on the high fat diet group did not change with a significant difference compared to the sham operation group, the weight of the uterus of the mice on the ovariectomized group did not decrease, while the weight of the uterus of the model group was significantly decreased (p < 0.01) compared to the sham operation group under the dual actions of the castration and the high calorie diet, and the weight of the uterus of the mice was increased after the administration of the traditional Chinese medicine composition and the positive drug, but was not significantly different compared to the model group.

Uterine coefficients were calculated by dividing the weights of the mice' womb by their corresponding weights (fig. 2D), and the calculated uterine coefficient data were similar to the uterine weight trend.

2. Effect of Chinese medicinal composition on sugar metabolism of mice

The measurement results of blood glucose, glucose tolerance, insulin tolerance, and the like of each group of mice are shown in fig. 3, wherein fig. 3A shows fasting blood glucose of the mice, which is measured every two weeks during the experiment; FIG. 3B shows the results of glucose tolerance test; FIG. 3C shows the results of insulin tolerance tests; fig. 3D is the area under the glucose tolerance curve; FIG. 3E is the area under the insulin tolerance curve; FIG. 3F is the fasting serum insulin levels in mice; FIG. 3G is the insulin resistance index (HOMA-IR). n =10, and n is a linear variable of,

* Denotes p<0.05, denotes p<0.01, indicates p<0.001, denotes p<0.0001。

Fasting glucose data (fig. 3A) shows that the model group showed a significant increase in blood glucose compared to baseline. At week 12 of the experiment (week 6 of the administration), the high dose of the Chinese medicinal composition has shown therapeutic effect, and the fasting blood glucose level is decreased (p < 0.01) compared with the model group, and after week 14 of the experiment (week 8 of the administration), the low and medium dose groups of the Chinese medicinal composition also show a decrease in blood glucose level (p < 0.01) compared with the model group. Although the blood sugar level of the positive medicine group is also remarkably reduced (p is less than 0.05) at the 14 th week (the 8 th week of medication), the blood sugar rebound is increased at the 18 th week (the 12 th week of medication) of the experiment, and each dosage group of the traditional Chinese medicine composition is in continuous regulation and control reduction of the whole blood sugar. On the general trend, each dosage group of the traditional Chinese medicine composition has better effect than the positive medicine group in reducing the fasting blood glucose level.

Insulin resistance and hyperinsulinemia are precursors to the development of type 2 diabetes. Animal experiment results show that the traditional Chinese medicine composition can improve glucose tolerance and insulin sensitivity, and specifically comprises the following components in percentage by weight:

glucose tolerance test results (figure 3B and figure 3D) show that compared with a model group, the low, medium and high dose groups of the traditional Chinese medicine composition can obviously improve the OGTT result (p is less than 0.01), and the traditional Chinese medicine composition has dose-effect relationship. The results of the insulin tolerance test (fig. 3C and fig. 3E) show that compared with the sham operation group, the high fat diet group and the model group are not sensitive to insulin (p < 0.01), the model group has the worst insulin sensitivity, and the sensitivity to insulin is increased after the traditional Chinese medicine composition is administered with low, medium and high doses (p <0.01 compared with the model group), and the results have dose-effect relationship. The serum insulin test results show (fig. 3F) that each dosage group of the traditional Chinese medicine composition has a tendency of reducing the content of serum free insulin, but has no statistical difference compared with the model group. The insulin resistance index results calculated according to the fasting blood glucose data and the fasting insulin data show (fig. 3G), the insulin resistance index of the model group is higher than that of the sham operation group (p is less than 0.01), the low, medium and high dosage groups of the traditional Chinese medicine composition can effectively improve the insulin resistance index and improve the insulin utilization rate, the difference from the model group has statistical significance (p is less than 0.05), and compared with the positive medicine group and the model group, the difference has no significant significance (p is more than 0.05).

3. Effect of Chinese medicinal composition on mouse lipid metabolism

The four detection results of serum blood lipids of each group of mice are shown in fig. 4, wherein fig. 4A shows the total cholesterol content of the serum of the mice; FIG. 4B is the mouse serum triglyceride level; FIG. 4C shows the serum HDL content of mice; FIG. 4D shows the low density lipoprotein content in mouse serum. n =10 (m) of the total number of the main chains,

* Represents p<0.05, denotes p<0.01, indicates p<0.001 denotes p<0.0001。

The results show that the contents of total cholesterol, triglyceride and low density lipoprotein are obviously increased (p is less than 0.01) in the model group compared with the sham operation group, and the contents of serum total cholesterol (p is less than 0.01) in each dosage group and the positive medicine group of the traditional Chinese medicine composition are reduced in the model group compared with the model group (fig. 4A); the traditional Chinese medicine composition high-dose group and the positive medicine group can reduce the content of serum triglyceride (p is less than 0.05) (figure 4B); for serum low density lipoprotein, compared with the model group, each dosage group of the traditional Chinese medicine composition has a descending trend, but has no statistical significance, and the positive medicine group has the same trend (fig. 4D); for high-density total protein, the traditional Chinese medicine composition group and the positive medicine group have no significant influence, but the traditional Chinese medicine composition high-dose group has a tendency of increasing high-density lipoprotein (fig. 4C).

4. Effect of Chinese medicinal composition on mouse liver

The liver measurement results of the mice in each group are shown in fig. 5, wherein fig. 5A shows the weight of the liver of the mouse; FIG. 5B shows HE staining of mouse liver, in FIG. 5B, OVX + HFD + LD refers to OVX + HFD + TKRDF-L, OVX + HFD + MD refers to OVX + HFD + TKRDF-M, and OVX + HFD + HD refers to OVX + HFD + TKRDF-H. n =10, and n is a linear variable of,

* Represents p<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001。

The livers of the mice were weighed and the results showed no significant difference in liver weight between the groups of mice (fig. 5A). The pathological changes of the livers of the mice are observed by embedding, slicing and HE staining the livers of the mice, and the results show that the liver lipid accumulation and vacuolation degree of the mice in the model group are increased, and the pathological changes can be obviously improved by each dosage group of the traditional Chinese medicine composition, and the effect is better along with the increase of the dosage of the traditional Chinese medicine composition (figure 5B).

In conclusion, the traditional Chinese medicine composition disclosed by the invention can reduce the weight of a model mouse, improve the blood sugar and blood fat level, improve the insulin sensitivity and improve the liver steatosis, so that the metabolic condition of a mouse with castrated glycolipid metabolic disorder is effectively improved.

9. Determination of the intestinal flora

The intestinal microorganisms are a huge and complex group, the species of the intestinal microorganisms reach 500 to 1000, the total number of the bacteria reaches 100 trillion, and the total number of the bacteria is 10 times of the total number of the cells of the human body. The intestinal flora mainly comprises anaerobic bacteria, facultative anaerobic bacteria and aerobic bacteria, wherein the anaerobic bacteria account for more than 99 percent. In this vast microbial community of the human intestinal tract, 9 phyla of bacteria are found, including Firmicutes, bacteroidetes, proteobacteria, actinomyces, fusobacteria, verrucomicrobia, cyanobacteria, spirochaeta and VadinBE97. The majority of the flora is considered to be obligate anaerobes, among which the Firmicutes (Clostridium species predominating; 50-70% of all bacteria), bacteroidetes (10-30%), proteobacteria (Proteobacteria) (. Ltoreq.10%), and Actinobacteria (Actinobacteria) (. Ltoreq.5%). The most important of them are Bacteroidetes (bacteroides) and Firmicutes (Firmicutes), which account for an absolute advantage of over 98%.

In order to explore the influence of the traditional Chinese medicine composition on the intestinal flora of mice with post-menopausal glycolipid metabolic disturbance, intestinal contents are collected, the DNA of the intestinal flora is extracted, and 16SrDNA sequencing is carried out.

1. Collecting samples: taking out the whole intestinal tract of the mouse by using sterile surgical forceps and surgical scissors, cutting off the content from the cecum to the colon section, taking out the content, placing the content in a sterile freezing tube for storage, placing the sterile freezing tube in liquid nitrogen for freezing for more than 2 hours, and transferring the frozen colon section to a refrigerator at the temperature of 80 ℃ below zero for storage after full freezing is ensured.

2. Extracting the DNA of the intestinal flora: and extracting the DNA of the intestinal flora by adopting a feces extraction kit according to the instruction.

3. 16SrDNA sequencing:

(1) Experimental procedure

Taking 30ng of the qualified genomic DNA sample extracted in the step 2 and a corresponding fusion primer to configure a PCR reaction system, wherein the used primer sequence is as follows: 338F: ACTCCTACGGGAGGCAGCAG;806R: GGACTACHVGGGTWTCTAAT. Setting PCR reaction parameters for PCR amplification, purifying PCR amplification products by using AgencourtAMPure XP magnetic beads, dissolving the purified PCR amplification products in an Elution Buffer, and attaching a label to complete library construction. The range and concentration of fragments from the library were measured using an Agilent2100 Bioanalyzer. And (4) selecting a HiSeq platform for sequencing according to the size of the insert. The experimental flow chart is shown in fig. 6.

(2) Information analysis flow

The information analysis flow chart is shown in fig. 7. Filtering the sequencing data in the step (1), and using the remaining high-quality Clean data for later analysis; splicing reads into Tags through an overlap relation between the reads; clustering Tags into OTUs, comparing the OTUs with a database, and annotating species; sample species complexity analysis, inter-group species difference analysis, and correlation analysis and model prediction were performed based on OTU and annotation results.

(3) The sample sequencing data processing method comprises the following specific steps:

and (3) data filtering: the original sequencing Data is processed as follows to obtain clear Data, and the specific steps are as follows:

the method for removing the low-quality data according to the window is adopted, and the specific operation is as follows: setting a 25bp window, and if the average quality value of the window is lower than 20, cutting off a rear-end base from the window; after the length of the read after truncation is 75% lower than that of the original read, the whole sequence is removed.

Removing the reads polluted by the joint (the default adapter sequence and the read sequence have 15bp overlap, the overlap is set as 15bp, and the number of allowed mismatches is 3 bp);

removing the reads containing N; low complexity reads are removed (default reads are low complexity reads with consecutive bases of length ≧ 10).

Samples are distinguished according to the barcode and primers, and the number of mismatches allowed by the comparison of the barcode sequence and sequencing reads is 0bp.

And (3) Tags connection: sequence splicing uses software FLASH (Fast Length Adjustment of Short reads, v 1.2.11), pairs of reads obtained by double-end sequencing are assembled into a sequence by utilizing an overlapping relation, and the Tags of a hypervariable region is obtained. The splicing conditions were as follows:

the minimum matching length is 15bp;

the overlap region allows a mismatch ratio of 0.1.

Counting OTU clustering results:

there are two approaches to OTU clustering. Usearch: clustering according to 97% sequence similarity to generate OTU; DADA2: ASV sequences, collectively referred to herein as OTUs, are generated by clustering denoised sequences with 100% similarity.

Usearch：

And clustering the spliced Tags into OTUs by using software USEARCH (v7.0.1090). The main process is as follows:

a: clustering by using UPARSE under 97% similarity to obtain a representative sequence of the OTU;

b: removing chimeras generated by PCR amplification from the OTU representative sequences using UCHIME (v4.2.40);

(16S and ITS adopt a method of comparing with the existing chimera database to remove chimera.18S adopts a method of De novo to remove chimera.16S chimera database gold database (v 20110519)

ITS chimera database: UNITE (v 201407 03) divided into ITS full length, ITS1 and ITS2, selected by sequencing region)

c: all Tags were aligned back to OTU representative sequences using the user _ global method, resulting in a statistical table of the abundance of OTUs for each sample.

DADA2: denoising by using a DADA2 (digital amplification Denoising Algorithm) method in software QIIME2 to obtain Amplification Sequence Variants (ASVs), wherein the ASV is a 100% similar Sequence. Further, a Feature table (Feature, a general term for ASV/ASV, etc.) is obtained. The main process is as follows:

a: introducing the filtered double-ended sequence by utilizing a qiime tools import;

b: constructing a feature table by utilizing a qiime DADA2 dense-paired command to the introduced double-ended sequence based on a DADA2 method;

c: the feature table is converted into a directly viewable format using a qiime tools export.

10. Analysis of measurement results of intestinal flora

FIG. 8 is a principal component analysis of intestinal flora of each group of mice, wherein scales on the abscissa and ordinate axes are relative distances and have no practical significance; pca1 and pca2 represent suspected influences of shifts in the microbial composition of the groups, respectively. The 16s rDNA sequencing result shows that the traditional Chinese medicine composition can affect the intestinal flora of ovariectomized mice with high calorie diet, and the main component analysis result shows that the composition of the mouse flora is greatly different in the model group compared with the sham operation group, and the intestinal flora is greatly changed in the high-dose group of the traditional Chinese medicine composition (figure 8).

FIG. 9 shows the composition of the intestinal flora species of mice in each group. The results show that the dominant intestinal flora of the experimental mice of the invention are Bacteroidetes (bacteroides), firmicutes (Firmicutes), proteobacteria (Proteobateria) and Verrucomicrobia (Verrucomicrobia) (fig. 9). In the high-dose group of the traditional Chinese medicine composition, the relative abundance of Verrucomicrobia (Verrucomicrobia) in mouse excrement exceeds 40 percent, and the Verrucomicrobia becomes the dominant bacterium in intestinal tracts of mice.

FIG. 10 is a graph showing the effect of a Chinese medicinal composition on intestinal flora. It is generally believed that in the intestinal flora of obese people, bacteroidetes (bacteroides) is less abundant than the leptin, and the ratio of Firmicutes to bacteroides (bacteroides) is significantly higher than that of the leptin. However, in the present invention, this change does not occur. In the invention, bacteroidetes (bacteroides) is not obviously different among mice in each group, and the abundance of Firmicutes (Firmicutes) in mice in a model group is reduced (figures 10A and B). For the ratio of Firmicutes to Bacteroidetes, the model group mice were lower than the sham group mice, but there were no statistical differences between the groups (fig. 10C).

Modern studies have shown that gut microorganisms play a key role in the pathogenesis of Ulcerative Colitis (UC) and show a major shift in gut flora in patients with UC, such as higher abundance of proteobacteria (Proteobateria) and lower abundance of Firmicutes (Firmicutes). In the invention, compared with a sham-operated group mouse, the abundance of proteobacteria (proteobacteria) and the abundance of Firmicutes (Firmicutes) of a model group mouse are increased (fig. 10A), and the change of the intestinal flora of a UC patient is consistent. And each dosage group of the traditional Chinese medicine composition can reduce the abundance of proteobacteria (Proteobateria) (compared with a model group), wherein the high dosage group of the traditional Chinese medicine composition has a significant difference (p =0.0036, compared with the model group). The abundance of Firmicutes (Firmicutes) can be increased in both the low-dose and the medium-dose groups of the traditional Chinese medicine composition (compared with the model group), wherein the low-dose group of the traditional Chinese medicine composition has significant difference (p =0.0106, compared with the model group). The abundance of Firmicutes in the high-dose group of the traditional Chinese medicine composition is remarkably reduced compared with that in the model group, presumably because the high abundance of Verrucomicrobia (Verrucomicrobia) in the high-dose group of the traditional Chinese medicine composition causes the Firmicutes to be not the dominant phylum in the intestinal tract of mice in the high-dose group of the traditional Chinese medicine composition.

Akkermansia muciniphila (Akkermansia muciniphila) in Verrucomicrobia (Verrucomicrobia) is a currently recognized beneficial bacterium, is a normal flora of human intestinal tracts, and the abundance of Akkermansia muciniphila (Akkermansia muciniphila) in the intestinal flora of obese patients is obviously reduced. Akkermansia muciniphila (Akkermansia muciniphila) is negatively associated with obesity, diabetes, cardiovascular disease and low grade inflammation. The Akkermansia muciniphila (Akkermansia muciniphila) can not only protect the integrity of intestinal epithelial cells and mucus layers and play a role in metabolic protection, but also play an anti-inflammatory role in inflammatory reaction by regulating T cells, the endocannabinoid system and non-classical Toll-like receptors.

Table 1 shows the abundance of Akkermansia muciniphila (Akkermansia muciniphila) and Clostridium clostridia (Clostridium scendens) in each group of mice, and the results show that the high dose of the Chinese medicinal composition can significantly increase the abundance of Akkermansia muciniphila (Akkermansia muciniphila) in the phylum verrucomicrobia to become intestinal dominant bacteria (fig. 10D). In addition, the traditional Chinese medicine composition can also improve the abundance of Clostridium (Clostridium scab) in intestinal flora of mice (fig. 10E), the abundance of Clostridium scab (Clostridium scab) in each dosage group of the traditional Chinese medicine composition is about twice that of the model group, and the difference between groups is obvious (table 1).

TABLE 1 abundance of Ackermanella muciniphila and Clostridium in groups of mice

Note: the p-values in the table are the total p-values between 6 groups.

Meanwhile, the traditional Chinese medicine composition can reduce the abundance of Bacteroides massiliensis (Bacteroides massilisensis) in intestinal flora of mice (fig. 10F), compared with a pseudo-operation group, the abundance of Bacteroides massiliensis (Bacteroides massilisensis) in a model group is remarkably increased (p < 0.0001), and compared with the model group, the abundance of Bacteroides massiliensis (Bacteroides massilisensis) in each dose group and positive medicine group of the traditional Chinese medicine composition is remarkably reduced (p < 0.0001). Modern researches show that the abundance of Clostridium (Clostridium scab) is negatively related to the waist circumference, and the higher the abundance is, the smaller the waist circumference is; in the case of prostatic cancer, the relative abundance of Bacteroides maxiliensis (Bacteroides maxiliensis) is high, and the Bacteroides maxiliensis (Bacteroides maxiliensis) is related to promoting tumorigenesis. However, the traditional Chinese medicine composition has little influence on the two floras compared with the Akkermansia muciniphila (Akkermansia muciniphila) from the aspect of the total abundance ratio of the intestinal tract.

In conclusion, the traditional Chinese medicine composition can specifically increase the abundance of Akkermansia muciniphila (Akkermansia muciniphila), clostridium (Clostridium scabies) and Firmicutes in the intestinal flora, reduce the abundance of proteobacteria (Proteobateria) and Bacteroides madilliensis (Bacteroides massiensis), and regulate the imbalance of the intestinal flora, thereby preventing and treating various diseases.

What has been described above are merely some embodiments of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the inventive concept thereof, and these changes and modifications can be made without departing from the spirit and scope of the invention.

Claims

1. The traditional Chinese medicine composition for treating glycolipid metabolic abnormality and/or intestinal dysbacteriosis is characterized by comprising the following raw materials in parts by weight: 20 to 40 parts of rhizoma alismatis, 10 to 20 parts of bighead atractylodes rhizome, 10 to 15 parts of glossy privet fruit, 10 to 15 parts of parasitic loranthus, 20 to 30 parts of kudzuvine root, 10 to 20 parts of salvia miltiorrhiza and 10 to 15 parts of dried orange peel.

2. The Chinese medicinal composition for treating glycolipid metabolic abnormality and/or intestinal dysbacteriosis according to claim 1, characterized by comprising the following raw materials in parts by weight: 20 parts of rhizoma alismatis, 10 parts of bighead atractylodes rhizome, 15 parts of glossy privet fruit, 15 parts of parasitic loranthus, 20 parts of kudzuvine root, 10 parts of salvia miltiorrhiza and 10 parts of dried orange peel.

3. The Chinese medicinal composition for treating glycolipid metabolic abnormality and/or intestinal dysbacteriosis according to claim 1 or 2, characterized by further comprising pharmaceutically acceptable adjuvants.

4. The Chinese medicinal composition for treating glycolipid metabolism abnormality and/or intestinal flora dysregulation according to claim 1 or 2, characterized in that the dosage form of the Chinese medicinal composition is decoction, granule, powder, tablet, pill or capsule.

5. A process for preparing a Chinese medicinal composition for the treatment of abnormal glycolipid metabolism and/or intestinal dysbacteriosis according to any one of claims 1-4, characterized by comprising the following steps:

6. Use of a Chinese medicinal composition according to any one of claims 1 to 4 in the manufacture of a medicament for the treatment of post-menopausal metabolic syndrome.

7. Use of a Chinese medicinal composition as claimed in any one of claims 1 to 4 in the manufacture of a medicament for the treatment of abnormal glycolipid metabolism and/or intestinal dysbacteriosis.

8. The use of claim 7, wherein the gut flora comprises at least one of akkermansia muciniphila, clostridium, firmicutes, proteobacteria and bacteroides massiliensis.