CN115583994A - Polyclonal antibody of kiwi fruit AcVB virus and preparation method and application thereof - Google Patents

Abstract

The invention provides a polyclonal antibody of kiwi AcVB virus, a preparation method and application thereof. The antibody is prepared into products such as a detection kit or detection test paper, can accurately, conveniently, sensitively, quickly and economically detect the disease condition of the kiwi fruit, and is suitable for detecting a large number of samples.

Description

Polyclonal antibody of kiwi fruit AcVB virus and preparation method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a polyclonal antibody of kiwi fruit AcVB virus, and a preparation method and application thereof.

Background

The kiwi fruit is an economic fruit with rich nutrition and has great benefits for human health. The virus is an important microbial pathogen for infecting the kiwi fruit, reduces the yield, quality and economic benefit of the kiwi fruit, and seriously threatens the development of the kiwi fruit industry.

Previous studies found that more than 10 viruses, including both specific and non-specific viruses, can infect kiwifruit. AcVB is a specific virus that infects kiwi. AcVB is a positive single-stranded RNA virus with 5 Open Reading Frames (ORFs) and one polyadenylated 3' end. Among them, ORF 4 encodes Coat Protein (CP), which is the relatively most conserved segment of viral genes. The Chinese gooseberry infected by AcVB mainly shows green fading spots, is mostly seen on new bud base leaves before and after blooming, and has symptoms fading until early summer, and some vines have symptoms even until early summer. The above features make AcVB difficult to judge by symptoms, leading to spread and spread of the virus in the field. RNA virus has frequent variation, strong pathogenicity and lacks of effective prevention and control means, so that the research and development of a simple and feasible early rapid detection technology for the virus disease are urgently needed.

Currently, the main detection method of AcVB is reverse transcription polymerase chain reaction (RT-PCR) using virus specific primers. The method generally has higher sensitivity, but has the defects of time and labor consumption, high requirements on instruments and equipment, over-professional technology and difficult field operation. It is also believed by researchers that mutation of the viral genome, based on the high specificity of the nucleic acid, will lead to false negative results. In addition, the high polysaccharides and polyphenols in kiwi leaves make it difficult to extract nucleic acids.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a preparation method and application of a polyclonal antibody of kiwi fruit AcVB virus.

In order to achieve the purpose, the technical scheme adopted by the invention for solving the technical problems is as follows:

a preparation method of a polyclonal antibody of kiwi fruit AcVB coat protein comprises the following steps:

(1) Obtaining total RNA of the diseased kiwi fruit;

(2) Taking total RNA as a template, adopting an AcVB-F2/R2 primer to amplify a full gene fragment of an AcVB-CP gene, then taking the AcVB-CP full gene fragment as the template, and adopting an AcVB-F3/R3 primer to continuously amplify an AcVB-CP target gene fragment;

(3) Connecting the AcVB-CP target gene segment to an expression vector to obtain a recombinant vector, then transforming the recombinant vector into escherichia coli, and inducing protein expression and purification to obtain recombinant protein;

(4) The recombinant protein is used for immunizing a white rabbit to prepare the polyclonal antibody of the kiwi fruit AcVB coat protein.

Further, the method for obtaining the total RNA of the kiwi fruits in the step (1) comprises the following steps: grinding 0.2g of kiwi leaves in liquid nitrogen by adopting 500 mu L of RNA extraction buffer solution I, 500 mu L of RNA extraction buffer solution II and 100 mu L of absolute ethyl alcohol, extracting total RNA, precipitating the total RNA at-20 ℃ overnight by using 4mol/L LiCl, and purifying the RNA by using 70% ethyl alcohol the next day to obtain the compound RNA; wherein the RNA extraction buffer I consists of water-saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25; the RNA extraction buffer solution II contains 1% SDS by mass concentration, 20mmol/L Tris Base by mass concentration, 0.2mol/L NaCl by mass concentration and 5mmol/L EDTA-Na ₂ 。

Further, in the step (2), the primer AcVB-F2 is: 5 'and GTTATGCCAAACGTTTATGATGC and 3', wherein the primer AcVB-R2 is as follows: 5 'TAGAGCGTCTCATATCAGTTACTC-3'.

Further, the gene fragment comprising the AcVB-CP gene in the step (2) has the length of 840 base pairs.

Further, the PCR amplification conditions of the gene fragment containing the AcVB-CP gene in the step (2) are as follows:

the amplification system comprises 12.5 muL of 2 xTaq Master Mix, 1 muL of AcVB-F2, 1 muL of AcVB-R2, 1 muL of total RNA and 9.5 muL of ddH ₂ O；

The amplification procedure was: 94 ℃ 3min,94 ℃ 30s,54 ℃ 30s,72 ℃ 1min,34 cycles, 72 ℃ 10min,12 ℃ storage.

Further, the primer AcVB-F3 in the step (2) is: 5 'ATGTCAGGAGCTACATCAAGG-3', the primer AcVB-R3 is: 5 'CTATATCTCAACAGCTTTGTTCGC-containing material 3'.

Further, the length of the AcVB-CP gene fragment in the step (2) is 597 base pairs.

Further, the amplification conditions in the step (2) are as follows: the amplification system comprises 12.5. Mu.L of 2 XTaq Master Mix, 1. Mu.L of AcVB-F3, 1. Mu.L of AcVB-R3, 1. Mu.L of total RNA and 9.5. Mu.L of ddH ₂ O；

The amplification procedure was: 94 ℃ 3min,94 ℃ 30s,48 ℃ 30s,72 ℃ 1min,34 cycles, 72 ℃ 10min,12 ℃ storage.

The kiwi fruit AcVB coat protein polyclonal antibody is applied to preparation of kiwi fruit AcVB virus detection testing agents, detection kits or detection test paper.

The beneficial effects produced by the invention are as follows:

1. according to the invention, the kiwi fruit AcVB coat protein polyclonal antibody is prepared and applied to kiwi fruit detection, and the kiwi fruit diseased condition can be sensitively, quickly and economically detected by utilizing the principle of antigen-antibody specificity recognition, so that the kiwi fruit diseased condition detection method is suitable for detecting a large number of samples. The antibody can be detected by various serology such as protein hybridization, ELISA and the like, can also be loaded, can be made into detection test paper, has intuitive result judgment, and is easy to master by non-professionals; and fills the blank of the preparation technology of the polyclonal antibody in the detection of the kiwi fruit virus.

2. The kiwi fruit leaf extraction method in the application is researched and developed by utilizing the characteristic that RNA is insoluble in absolute ethyl alcohol and polysaccharide polyphenol is soluble in absolute ethyl alcohol, and effectively solves the problem that high-purity RNA cannot be obtained in the existing extraction method.

3. In the preparation process of the antibody, a core section of a relatively conservative coat protein gene is selected, so that the universality of the antibody is ensured.

4. The method optimizes the PCR amplification procedure of the target fragment, particularly prolongs the fragment for a super-long time, reduces the mismatching probability in the amplification process, obtains a more accurate target fragment sequence, and provides an accurate template for the preparation of the antibody.

Drawings

FIG. 1 is a photograph of a plant of kiwi fruit leaves infected with AcVB;

FIG. 2 is an AcVB-CP gene evolutionary tree, A being a nucleotide-based evolutionary tree and B being an amino acid sequence-based evolutionary tree;

FIG. 3 is a diagram showing the results of gene cloning, recombinant vector construction and transformation; a is an agarose gel electrophoresis picture of an AcVB-CP whole gene (840 bp) clone product, B is an agarose gel electrophoresis picture of an AcVB-CP target gene (597 bp) clone product, and C is an agarose gel electrophoresis picture of plasmid restriction, plasmid and target gene fragments; d is the result chart of agarose gel transformed by the competent cells;

FIG. 4 is a graph showing the results of protein expression and purification, wherein A is an SDS-PAGE detection graph of the induced expression of AcVB-CP protein, and B and C are SDS-PAGE detection graphs showing the results of protein purification; d is an SDS-PAGE concentration effect graph;

FIG. 5 is a graph showing the results of protein hybridization and ELISA, wherein the amounts of protein added in lanes 1, 2 and 3 in panel A are 0.2, 1, 5 and μ g, respectively, B is the color of each reaction well after the termination of ELISA, and well 1 and well 2 are blank controls; lanes 3 and 4 are positive controls; lanes 5 and 6 are YA35 samples buffered-milled with 1 XPBS; lanes 7 and 8 are QL17 samples buffered-milled with 1 x PBS; lanes 9 and 10 are DJY33 samples, buffered with 1 × PBS; lanes 11 and 12 are kiwi leaves containing AcVB, triturated with 1 × PBS buffer;

FIG. 6 is a graph showing the results of measurement of antibody titer by ELISA, wherein A is the absorbance values of antibody and antiserum at different dilutions, and the absorbance values of antibody and antiserum at each dilution _(S) Absorbance value of (D) with blank control BC _(B) The ratio of absorbance values of;

FIG. 7 is a diagram showing comparison of the AcVB-CP gene in the YA12 sample with other published AcVB-CP genes;

FIG. 8 is a diagram of 14 forward primer sequences used to synthesize a fragment of interest.

Detailed Description

The following detailed description of embodiments of the invention refers to the accompanying drawings.

1. Materials and methods

1.1. Material

Collecting suspected virus disease kiwi fruit leaves in Yaan, qiong and Dujiang weir areas of Sichuan province, drying all sample ice boxes, temporarily storing the samples in a laboratory, and storing the samples in an ultralow temperature refrigerator at-80 ℃. All leaf samples showed varying degrees of discoloured spots between veins. In addition, the DJY33 sample showed leaf shrinkage (fig. 1).

TABLE 1 all primers used in this study

Primers	Sequences(5-3)
		AcVB-F1	GTTTGCGAGGAGACGTAGGGC
AcVB-R1	AGTTAAGTGCTCTYGGRGGTGTG
		AcVB-F2	GTTATGCCAAACGTTTATGATGC
AcVB-R2	TAGAGCGTCTCACTATCAGTTACTC
		AcVB-F3	ATGTCAGGAGCTACATCAAGG
AcVB-R3	CTATATCTCAACAGCTTGTTCGC

1.2 RNA extraction and AcVB-CP Gene cloning

Total RNA was extracted by grinding 0.2g of kiwi leaves in liquid nitrogen using 500. Mu.L of RNA extraction buffer I (water-saturated phenol, chloroform, isoamyl alcohol, v/v/v, 25/24/1), 500. Mu.L of RNA extraction buffer II (1% SDS,20mmol/L Tris Base pH =8.0,0.2mol/L NaCl,5mmol/L EDTA-Na 2) and 100. Mu.L of absolute ethanol. RNA was precipitated overnight at-20 ℃ with 4mol/L LiCl. The next day, RNA was purified with 70% ethanol. The purified RNA was dried in vacuo and in ddH ₂ Dissolving in O.

cDNA was synthesized using the Golden star TM RT6 cDNA Synthesis Kit Ver.2 Kit (Tsingke, chengdu, the republic of China) according to the instructions using the total RNA as a template. And (3) carrying out normal PCR detection by adopting an AcVB-F1/R1 primer, and identifying whether the suspected infection sample carries the AcVB. And taking YA12 positive samples in Yaan area for subsequent experiments.

Primers were designed based on the published AcVB sequence in the NCBI database. The full-length 840 base pair fragment containing AcVB-CP gene is amplified by normal PCR, and the reaction system comprises 12.5 muL of 2 xTaq Master Mix (Vazyme, nanjing, JS, PRC), 1 muL of total RNA and 9.5 muL of ddH ₂ And (O). The specific steps are as follows:

TABLE 2PCR reaction conditions clones of 840bp long sequence, including 597bp AcVB-CP

The PCR product was confirmed by 1.5% agarose gel electrophoresis (FIG. 3-A), in which lane 1, lane 2 and lane 3 represent the results of three replicates, respectively, and the results were confirmed by the three replicates, and then sequenced by Producer Biotech company. And designing primers AcVB-F3 and AcVB-R3 for amplifying the AcVB-CP gene according to the sequencing result, wherein the reaction systems are the same except that the primers are different. After the product was confirmed by agarose gel electrophoresis (FIG. 3-B), lanes 1, 2 and 3 respectively show the results of three replicates, which proved consistent results, and were sequenced by Chengdu Biotechnology Ltd.

TABLE 3 PCR reaction conditions for cloning AcVB-CP (597 bp)

1.3. Sequence analysis and construction of evolutionary trees

The sequences cloned in this study (AcVB-CP) were compared with the sequence names disclosed in NCBI and accession numbers DJY2 (MK 900441), DJY5 (MK 900446), QL19 (MK 900452), QL29 (MK 900454), QL33 (MK 900443) and the AcVB whole genome CP section (NC 016404) using DNMAN software (FIG. 7). The 7 sequences and their deduced amino acid sequences were used to construct a phylogenetic tree using MEGA software.

The AcVB-CP gene cloned in this study was compared to DKY 2, DJY5, QL19, QL29, QL33 genes and the AcVB whole genome CP portion NC016404.1 obtained on NCBI (FIG. 7). The gene homology rate is 91.46%, and the sequence of the AcVB cloned in the scheme is proved to be used for preparing a subsequent antibody.

The results of construction of the evolutionary tree using the above genes show that the CP genes in the samples YA12, DJY5 and QL29 are in the same group (group I), wherein the AcVB-CP gene is an independent branch, and it can be proved that the three genes have close relationships (fig. 2-a).

The result of constructing the evolutionary tree by using the amino acid sequences deduced from the genes shows that the CP genes in the samples YA12, DJY5 and QL29 are in the same group (group 2) and are also in the same branch, which can prove that the genetic evolutionary relationships of the three sequences are closer (FIG. 2-B).

1.4. Optimization and Synthesis of sequences

The AcVB-CP gene is provided for Hangzhou Hua biology to complete codon optimization, and finally an optimized AcVB-CP' sequence (equivalent to cDNA) is obtained. Primers AcVB-CP 1-14 (FIG. 8) were designed based on the sequence of AcVB-CP', and AcVB-CP fragments were synthesized by PCR. The first PCR reaction system comprises: 0.5uL of AcVB-CP 1-14 (50 pmol/uL/primer),0.5. Mu.L of PV 2DNA polymerase (ZJ, hangzhou, china), 10. Mu.L of 5 XPV 2 buffer, 1. Mu.L of 10mmol/L dNTP and ddH ₂ O (50. Mu.L maximum). The second set of PCR reaction system included: first PCR product 0.5. Mu.L, mixture 1. Mu.L of AcVB-CP1 and AcVB-CP14 (0.5 uL/primer), PV 2DNA polymerase 0.5. Mu.L, 5 XPV 2 buffer 10. Mu.L, 10mmol/L dNTP and ddH ₂ O1. Mu.L, up to 50. Mu.L. The method comprises the following specific steps:

TABLE 4 conditions for the first and second PCR synthesis of AcVB-CP fragments

1.5. Construction of pET-28a-AcVB-CP expression vector

The product of the 1.4 second PCR was subjected to agarose gel electrophoresis. The recovery was performed according to the DP214-03 DNA purification kit (Tiangen, beijing, the people's republic of China) instructions. The recovered product was ligated with 1010S BamH I,1094A Xho I (Takara, beijing, the PRC) digested B540183-0001 pET-28a vector (Bio, cheng Du, the PRC) using 6022DNA ligation kit (TaKaRa, beijing, the PRC) at 16 ℃ for 90 minutes. The ligation product pET-28a-AcVB-CP vector was transformed into CB108 Rosetta (DE 3) competent cells (Tiangen, beijing, china, ministry of public republic), and the culture was transferred to solid Luria-Bertani (LB) containing 100. Mu.g/mL kanamycin (Kana) and incubated overnight at 37 ℃. Single colonies were selected for bacterial PCR and plasmids were extracted from well-matched colonies using the DP103-03 Mini plasmid kit (Tiangen, beijing, the people's republic of China). Subsequently, the plasmid was sequenced by genealogy Biotech. The sequencing results were compared at the NCBI website.

1.6. Small dose expression assay

50. Mu.L of E.coli Rosetta (DE 3) containing the pET-28a-AcVB-CP expression vector was placed in 5mL of LB solution containing 250. Mu.g of Kana, and incubated at 37 ℃ and 180rpm overnight. The control group had no isopropyl-beta-d-thiogalactoside (IPTG), the experimental group had 1mmol/L IPTG, and both groups were treated at 37 ℃ for 4h. After treatment, the broth was centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant discarded, and E.coli was lysed with P2262 lysis buffer (Beyotime, shanghai, china). Adding 25 μ L of P0015L 5 × Loading Buffer (Beyotime, shanghai, china), boiling for 10min, and taking 10 μ L of sample for SDS-PAGE analysis.

1.7. Large scale induction of expression

Transferring 3mL of the bacterial solution into 300mL of LB solution containing 1.5mg of Kana, and performing mass induction expression. And centrifuging the induced bacterial liquid at 10000rpm for 10min, and collecting thalli. Resuspend with 0.01mol/L PBS (pH = 7.4) 10mL, sonicate in 100W ice-water bath for 16min. Centrifugation is carried out at 4 ℃,12000rpm and 10min, 10mL of urea solution with 8mol/L is used for resuspension, 100W of ice-water bath is used for ultrasonic treatment for 10min, and 20 mu L of sample is reserved for SDS-PAGE analysis.

1.8. Purification and validation of recombinant proteins

1.7 samples prepared in the above were purified by Ni-NTA chromatography (hua, hangzhou, ZJ, republic of china) at room temperature at a rate of about 1 ml/min. The protein was eluted with elution buffer (8 mol/L urea, 250mmol/L NaCl, 250mmol/L imidazole, 0.01mol/L PBS). The eluate was put into a dialysis bag and dialyzed for 2 hours using a dialysis buffer (4 mol/L urea, 5% glycerol, 1% L-arginine, 2% glycine, 0.01mol/L PBS). Use of Pierce ^TM Protein Concentrator Tube (Thermo, shanghai, china's republic of China) Protein samples were concentrated and verified by SDS-PAGE.

The above test results are shown below: and (3) carrying out enzyme digestion on the pET-28a vector by using BamH I and Xho I respectively, and verifying the enzyme digestion effect by electrophoresis. As shown in FIG. 3-C, the vector before cleavage (lane 1) moved faster under the electric field than the vector after cleavage (lane 2). The synthetic gene of interest (lane 3) was shown to have a higher concentration and the correct fragment size. In conclusion, the plasmid cleavage and gene cloning procedures were confirmed to be accurate (FIG. 3-C). The ligation product was transformed into the Rosetta (DE 3) strain. At the same time, PCR was performed using vector-specific primers and the transformation effect was verified by electrophoresis (FIG. 3-D).

The Rosetta (DE 3) strain transformed with the recombinant plasmid was cultured at 37 ℃ and CP protein expression was induced at 37 ℃ for 4 hours. On a Coomassie blue stained SDS-PAGE gel, a single band with a molecular weight of approximately 25kDa was observed (lane 2), whereas the non-iptg-induced strain (lane 1) had no band with the same molecular weight, indicating that the introduction was complete (FIG. 4-A).

As for the purified fraction of the target protein, SDS-PAGE showed that the sonicated suspension (lane 1) contained a considerable amount of the target protein, almost no target protein flowed out of the column after the addition of the sample (lane 2), and the eluate from the adsorption column contained a large amount of the target protein (lanes 3 and 4) (FIG. 4-B). SDS-PAGE detection of the final dialyzed (FIG. 4-C) and concentrated (FIG. 4-D) protein samples showed only a single band with a molecular weight of 25kDa, confirming the completion of the protein purification and recovery procedure.

1.9. Preparation of antiserum

The recombinant protein is mixed with complete Freund's adjuvant at a volume ratio of 1. And the mixture is used to immunize new zealand white rabbits. The immunization was performed by multiple subcutaneous injections, 0.1mL per spot. For the first immunization, the antigen concentration was 1mg/mL, 0.5mL per rabbit. The recombinant protein was mixed with incomplete freund's adjuvant at the 2 nd and 4 th immunizations in a volume ratio of 1.

The 2 nd immunization was performed 14 days after the 1 st immunization, and the interval between the 2 nd and 3 rd immunizations was 7 days. A small amount of serum was taken from the middle ear artery of the rabbit at day 7 after the third immunization; if the test result is qualified, a fourth immunization is carried out 7 days after the test, and whole blood is collected 7 days after the fourth immunization.

The blood was placed in a 37 ℃ water bath and removed after 25 minutes. The blood sample is then placed at room temperature and the blood allowed to cool. Thereafter, the samples were transferred to a 4 ℃ freezer and the blood was awaited for automatic stratification. Centrifuging the supernatant at 12000rpm for 2min, transferring the supernatant into another centrifuge tube, and injecting 10% merthiolate sodium solution to obtain final concentration of 0.02%. Mixing the solutions, and storing at-20 deg.C.

1.10. Validation of antisera

The recombinant protein was subjected to SDS-PAGE, and 5. Mu.g, 1. Mu.g and 0.2. Mu.g of the recombinant protein were added to each lane. The electrophoresis program is 80V 30min and 120V 90min respectively, and the proteins are transferred to the PVDF membrane through electrophoresis transfer cells after electrophoresis. After this, the membrane was spun in blocking buffer (5% skim milk solution, 1% TBST) for 3 hours at room temperature.

20 mu L of antiserum AcVB-CP is taken, added into a blocking buffer solution according to the dilution ratio of 1. Thereafter, the reaction mixture was washed 3 times with 1% TBST for 10 minutes each. Enzyme-labeled goat anti-rabbit IgG (Producer, chengdu, people's republic of China) 1. Mu.L was diluted with blocking buffer at 1:2 ten thousand and incubated at room temperature for 2 hours with rotation. Thereafter, the membrane was washed 3 times with 1% TBST, E412-01 ECL luminophore (Vazyme, nanjing, JS, PRC) as specified, 10 minutes each time, and photographed.

And (3) verifying the titer of the antiserum to the field AcVB-carrying sample by an ELISA method. 0.2g of kiwi leaves were added to 1mL of 0.01mol/L PBS (pH = 7.4), ground with liquid nitrogen for 10min, centrifuged at 12000rpm at 4 ℃ to collect the supernatant. 100 μ L of supernatant, 100 μ L of PBS containing 0.4 μ g recombinant protein 0.01mol/L (positive control), 100 μ L of PBS suspension of leaves infected with Actinidia virus A (AcVA) (negative control), and 100 μ L of PBS suspension of healthy Actinidia leaves (blank control) were added to reaction wells of 514201 polystyrene ELISA plate (NEST, tin-free, people's republic of China). All reactions were repeated and the plates were placed at 4 ℃.

After 12h, the solution in all reaction wells was discarded and all reaction wells were rinsed with 180 μ L of 1% TBST/well. mu.L of blocking buffer was added to each well and incubated at 37 ℃ for 2 hours. The blocking buffer was discarded and 50. Mu.L of AcVB-CP antiserum was added to the blocking buffer for dilution at 2000. The antiserum solution was added to the reaction wells and incubated at 37 ℃ for 1 hour. The antiserum solution was discarded and 180. Mu.L of 1% TBST was added to each well for washing. mu.L of an enzyme-labeled goat anti-rabbit IgG solution (1 dilution, 500) was added to the reaction well, incubated at 37 ℃ for 45min, the secondary antibody solution was discarded, and the mixture was washed 3 times with 180. Mu.L of 1% TBST. In each reaction well, 100. Mu.L of P0209 TMB color developing solution (Beyotime, shanghai, china) prepared temporarily was added under a dark condition. After reacting at 37 ℃ for 5min, 90. Mu.L of 2mol/L sulfuric acid was added to each reaction well to terminate the reaction. After the reaction, the ELISA plate was placed in a preheated microplate reader (450 nm) to read, and the absorbance value was 2 times that of the blank control well, and it was considered that a positive reaction occurred.

Protein hybridization results showed that there was a distinct single band at 3 bands, with a molecular weight of approximately 25kDa. Notably, a clear band also appeared in the lane of 0.2. Mu.g of protein (lane 1) (FIG. 5-A). Taken together, it could be demonstrated that CP expressed in Rosetta (DE 3) could be sensitively recognized by antisera.

After the ELISA reaction is stopped by adding sulfuric acid, the liquid in the reaction wells of the positive control and the sample to be tested turns yellow. It was preliminarily determined that a positive reaction occurred (FIG. 5-B). The plate (the absorbance of each reaction well of the empty plate has been predetermined at 450 nm) is placed in a preheated microplate reader. The absorbance was measured at 450 nm.

Table 5 absorbance values at 450nm and data processing results.

Note: example is abbreviated S and blank control is abbreviated B

As can be seen from the data of table 5, the absorbance of the Blank Control (BC) and the Negative Control (NC) was at a very low level, and the absorbance of the Positive Control (PC) was the highest. OD ₄₅₀ (NC)/OD ₄₅₀ (BC) less than 2, considered a negative reaction; and OD ₄₅₀ (S)/OD ₄₅₀ A value of (BC) greater than 2 is considered a positive reaction. Therefore, the prepared antiserum can only detect AcVB viruses carried by kiwi leaves in fields, but cannot identify other plant viruses. The above results demonstrate that antiserum has higher sensitivity and specificity.

1.11. Further purification and potency assay of antisera

The antiserum was filtered through a 0.45 μm microporous membrane and further purified on a protein a/G agarose column. The efficacy of the antibodies was investigated against antisera. The purified recombinant protein was used as an antigen and diluted to 1 μ g/mL with CBS buffer (0.05 mol/L, pH = 9.6). The antibody and antisera were diluted with 1% BSA E661003 in 1% TBST as 1. All reactions were repeated. The same positive reaction standard was used to test the purification effect and antibody titer by ELISA.

The purified antibodies and antisera were diluted with 1% BSA solution in 1% TBST at a ratio of 1. ELISA was performed in the same manner, and the absorbance at 450nm was read. The results of absorbance values are shown in FIG. 6-A; the ratio of the average absorbance value to the average absorbance value for BC at each dilution is shown in FIG. 6-B.

OD ₄₅₀ (antiserum)/OD ₄₅₀ (BC) was 5.8 at 1. At the same dilution, OD ₄₅₀ (antibody)/OD ₄₅₀ (BC) of 10.2, which is considered a positive reaction, indicates that the purified antibody still can detect the recombinant protein when the dilution ratio is 1. In addition, the purified antibody showed higher potency than the antiserum before purification at all dilution concentrations. The results show that the purified antibody has a higher potency.

Claims (10)

1. A preparation method of a polyclonal antibody of kiwi fruit AcVB coat protein is characterized by comprising the following steps:

(1) Obtaining total RNA of the diseased kiwi fruit;

(2) Taking total RNA as a template, adopting an AcVB-F2/R2 primer to amplify a whole gene segment of an AcVB-CP gene, then taking the AcVB-CP whole gene segment as the template, and adopting an AcVB-F3/R3 primer to continuously amplify an AcVB-CP target gene segment;

(3) Connecting the AcVB-CP target gene segment to an expression vector to obtain a recombinant vector, then transforming the recombinant vector into escherichia coli, and inducing protein expression and purification to obtain recombinant protein;

(4) The recombinant protein is used for immunizing a white rabbit to prepare the polyclonal antibody of the kiwi fruit AcVB coat protein.

2. The method for preparing the polyclonal antibody of kiwi AcVB coat protein according to claim 1, wherein the method for obtaining the kiwi total RNA in the step (1) is as follows: miningGrinding 0.2g of kiwi leaves in liquid nitrogen by using 500 mu L of RNA extraction buffer solution I, 500 mu L of RNA extraction buffer solution II and 100 mu L of absolute ethanol, extracting total RNA, precipitating the total RNA by using 4mol/L LiCl at-20 ℃ overnight, and purifying the RNA by using 70% ethanol the next day; wherein the RNA extraction buffer I consists of water-saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25; the RNA extraction buffer solution II contains 1 percent SDS by mass concentration, 20mmol/L Tris Base by mass concentration, 0.2mol/L NaCl by mass concentration and 5mmol/L EDTA-Na ₂ 。

3. The method of claim 1, wherein the AcVB-F2 primer is: 5 'GTTATGCCAAACGTTTATGATGC-3', the AcVB-R2 primer is: 5 'TAGAGCGTCTCATATCAGTTACTC-3'.

4. The method for preparing polyclonal antibodies to kiwi AcVB coat protein according to claim 1, wherein the gene fragment containing the AcVB-CP gene in step (2) is 840 base pairs in length.

5. The method for preparing the polyclonal antibody of kiwi AcVB coat protein according to claim 1, wherein the PCR amplification conditions of the gene fragment containing the AcVB-CP gene in the step (2) are as follows:

the amplification system comprises 12.5 muL of 2 xTaq Master Mix, 1 muL of AcVB-F2, 1 muL of AcVB-R2, 1 muL of total RNA and 9.5 muL of ddH ₂ O；

The amplification procedure was: 94 ℃ 3min,94 ℃ 30s,54 ℃ 30s,72 ℃ 1min,34 cycles, 72 ℃ 10min,12 ℃ storage.

6. The method for preparing the polyclonal antibody of kiwi AcVB coat protein according to claim 1, wherein the AcVB-F3 primer in the step (2) is: 5 'ATGTCAGGAGCTACATCAAGG-3', the primer AcVB-R3 is: 5 'CTATATCTCAACAGCTTTGTTCGC-containing material 3'.

7. The method of claim 1, wherein the length of the AcVB CP gene fragment in step (2) is 597 base pairs.

8. The method of claim 1, wherein the amplification conditions in step (2) are: the amplification system comprises 12.5. Mu.L of 2 XTaq Master Mix, 1. Mu.L of AcVB-F3, 1. Mu.L of AcVB-R3, 1. Mu.L of total RNA and 9.5. Mu.L of ddH ₂ O；

The amplification procedure was: 94 ℃ 3min,94 ℃ 30s,48 ℃ 30s,72 ℃ 1min,34 cycles, 72 ℃ 10min,12 ℃ storage.

9. The polyclonal antibody against the kiwi AcVB coat protein prepared by the method of any one of claims 1-8.

10. The use of the kiwi AcVB coat protein polyclonal antibody of claim 9 in the preparation of kiwi AcVB virus detection reagents, detection kits or detection test paper.

Images