CN109485704B

CN109485704B - Expression system of meningococcal fHbp protein

Info

Publication number: CN109485704B
Application number: CN201811425674.0A
Authority: CN
Inventors: 许诺; 胡振林; 李校堃; 高爽; 李世军; 王云鹏; 王宝慧; 丁明; 祁均梅; 林豪杰; 陈毓; 李雪囡
Original assignee: Wenzhou University
Current assignee: Wenzhou University
Priority date: 2018-11-27
Filing date: 2018-11-27
Publication date: 2022-04-19
Anticipated expiration: 2038-11-27
Also published as: CN109485704A

Abstract

The invention provides an expression system of meningococcal fHbp protein, which comprises an fHbp antigen gene and a vector pCAMBIA1301, wherein the expression system is pCAMBIA-fHbp, and the promoter is a beta-phaseolin promoter. The full length of the nucleotide sequence of the codon preference of fHbp Arabidopsis thaliana is synthesized through design, the fHbp Arabidopsis thaliana codon preference nucleotide sequence is subcloned into a plant expression vector with a kidney bean seed specific promoter, and the fHbp gene is integrated into an Arabidopsis thaliana genome through agrobacterium mediation. The fHbp is expressed in seeds, the production process is simplified, the production cost is reduced, and the possibility of producing the oral vaccine fHbp in large quantities by plants is realized.

Description

Expression system of meningococcal fHbp protein

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an expression system of meningococcal fHbp protein.

Background

The high morbidity and mortality associated with meningococcal disease makes it a serious global public health problem. Nearly 50 more than ten thousand cases of invasive meningitis disease occur each year worldwide, with 6 thousand patients having severe sequelae. In developing countries 2% of born children die of meningitis before the age of 5 years. Almost all meningococcal cases in humans are caused by A, B, C, W135 and serotype Y. The A, C, W135 and Y tetravalent capsular polysaccharide vaccine developed by Sanofi-Pasteur proved effective in preventing these four serotypes. The capsular polysaccharide of group B is homologous to human neural cell adhesion molecules of a few mature tissues. And thus cannot elicit immunity. However, Novartis has entered phase III clinics with a vaccine developed using "reverse vaccinology" containing 4 outer membrane protein antigens that is capable of preventing meningococcal group B, and in which fHbp has been shown to be more immunogenic than other outer membrane proteins. Currently, genetically engineered vaccines for fHbp are still expressed by prokaryotic expression systems. However, the problems of high cost and easy heat source in the product can not meet the social needs, and a brand new expression system is urgently needed.

The rise of the plant bioreactor leads the low-cost large-scale production of the genetic engineering vaccine, simplifies the later purification process, embodies great technical advantages in the aspect that the product does not contain a heat source, and has wide application prospect.

Disclosure of Invention

The invention aims to provide an expression system of meningococcal fHbp protein.

The invention is realized by the following technical scheme:

an expression system of meningococcal fHbp protein, the expression system comprises an fHbp antigen gene and a carrier pCAMBIA1301, and the expression system is pCAMBIA-fHbp.

The expression system comprises a promoter which can enable the fHbp antigen gene to be efficiently expressed in a plant, and the promoter is a beta-phaseolin promoter.

The nucleotide sequence of the beta-phaseolin promoter is shown as SEQ ID NO. 1.

The expression system comprises a screening marker, and the screening marker is a Bar gene.

The application of the beta-phaseolin promoter in improving the high-efficiency expression of the fHbp antigen gene in the plant is also within the protection scope of the invention.

The application of the Bar gene in the screening expression system pCAMBIA-fHbp is also within the protection scope of the invention.

In another method, the invention also provides a method for preparing the expression system, which specifically comprises the following steps: the antigen protein gene containing fHbp is subcloned into a vector capable of efficiently expressing the gene, and a seed specific promoter capable of improving the expression quantity and a gene capable of screening a screening marker of a transformed plant are introduced into an expression system.

The promoter introduced by the expression system is a beta-phaseolin promoter, the screening marker is a Bar gene, and the vector is pCAMBIA 1301.

In a particular embodiment of the invention, the expression cassette for the fHbp gene and the Bar gene expression cassette of the above construct can be randomly integrated into the plant genome by agrobacterium infection, enabling the plant to produce fHbp antigenic protein.

In one embodiment of the invention, Bar gene specific primers are designed to perform PCR detection on plants positive to herbicide screening, and 'false positive' plants negative to PCR detection and resistant to herbicides are removed.

Preferably, PCR detection of the target gene of fHbp is carried out on the screened 'Bar gene positive plant' subjected to Bar gene PCR detection. Plants in which only the Bar gene integrated into the plant genome and the fHbp did not integrate into the plant genome were deleted during transformation. Through two rounds of PCR detection, all the screened arabidopsis thaliana contain the fHbp target gene and the Bar screening marker gene.

Since there is no commercially available fHbp antibody for detecting the expression level of fHbp protein, the integration mechanism of agrobacterium is to integrate a T-DNA region containing the expression cassette of the gene of interest and the selection marker into the plant genome. Therefore, in the present invention, the expression level of the target gene fHbp gene is indirectly determined by detecting the expression level of the Bar gene, which is a selection marker. The expression quantity of the Bar gene is detected by the Bar gene colloidal gold test strip of the plant screened by PCR in the invention. And (3) diluting the concentration of the sample by 10 times, and detecting by using a test strip, wherein the result is still positive, the result is determined to be arabidopsis thaliana with high Bar gene expression, and the high expression of the target gene fHbp is indirectly proved.

The agrobacterium-mediated exogenous gene integration is multi-site and random integration, genetic factors can be separated when a plant is inherited, and the exogenous gene is not single copy in the plant, so that the exogenous gene cannot be stably inherited along with a genome. The invention screens out high expression plants capable of stably inheriting by detecting the copy of the exogenous gene through Southern-Blot.

The invention has the beneficial effects that:

the invention firstly breaks through on an expression vector, replaces a constitutive promoter with a seed specific promoter, and improves the expression quantity of the protein by the specific expression of the protein in seeds. The agrobacterium-mediated arabidopsis infection method is a unique technical platform. The method has great advantages in aspects of reducing production cost, simplifying production process, improving product safety and the like.

Drawings

FIG. 1 shows the restriction enzyme identification of expression vector p 1301-phas-fHbp;

FIG. 2 shows the PCR detection result of Bar gene of transformed Arabidopsis thaliana: m is DL100DNAmarker (Trans Gen); yang: p 1301-phas-fHbp; WT: untransformed Arabidopsis genomic DNA; 1-21: a transformed Arabidopsis thaliana;

FIG. 3 is the PCR assay of the transformed Arabidopsis fHbp; m: DL2000DNAmarker (TAKARA); yang: p 1301-phas-fHbp; WT: untransformed Arabidopsis genomic DNA; 1-23: a transformed Arabidopsis thaliana;

FIG. 4 shows the results of the test strip for detecting the Bar gene expression level; left: bar test strip detection results; and (3) right: diluting by 10 times, and detecting the result by using a Bar test strip;

FIG. 5 shows the result of SDS-PAGE electrophoresis of the target protein fHbp; m: protein low marker (TAKARA); WT: untransformed Arabidopsis thaliana; 1-8: a transformed Arabidopsis thaliana;

FIG. 6 shows the Southern-Blot detection result of high expression plants of target protein fHbp; m: trans 15K DNAmarker; +: p 1301-phas-fHbp; -: untransformed Arabidopsis thaliana; 01-06: a plant with high fHbp expression;

FIG. 7 shows SDS-PAGE results of purified fHbp-highly expressed plants; m is Protein Molecular Weight Marker (Low); 1: untransformed total arabidopsis protein; 2: transformed total arabidopsis protein; 3: purified fHbp protein;

FIG. 8 shows the ELISA assay for serum IgG titers: the control group is PBS buffer solution; the experimental group was a fHbp/freund adjuvant preparation.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 cloning of fHbp antigen Gene and construction of plant expression vector

MenB standard strain MC58 was streaked onto chocolate solid medium. 37 ℃ and 5% CO₂Culturing for 36-48 hr. Single colonies 1.0-1.5mm in diameter were picked and resuspended in PBS and the MC58 whole genome was extracted using the Universal Genomic DNA Extraction Kit. The upstream and downstream primers of fHbp were designed using Primer Premier5.0 based on the known sequence of fHbp and NcoI and HindIII restriction sites were introduced at 5 'and 3', respectively：

An upstream primer: 5' ATCGTCCATGGGACATCATCATCATCATC 3'；

A downstream primer: 5'AAGCTTAATTAGCCATAGAAATAGCAGC 3'。

The fHbp fragment was amplified and ligated into pEASY-T1. The vector was named pEASY-T1-fHbp.

pEASY-T1-fHbp and p1301-phas were digested with Nco I and Hind III enzymes, respectively, the cleavage effect was examined by 1% agarose gel electrophoresis, and a small fragment of pUC57-fHbp and a large fragment of p1301-phas were recovered, respectively. Recovered product is used for T₄DNA ligase ligation was performed overnight at 16 ℃. The ligation product was transformed into E.coli and inoculated on LB solid medium containing ampicillin (100. mu.g/mL). Resistant monoclonal colonies were picked on solid medium for identification by bacterial fluid PCR and restriction with Nco I and Hind III. The cleavage results are shown in FIG. 1.

And (3) PCR reaction system:

an enzyme digestion reaction system:

connecting a reaction system:

EXAMPLE 2 transformation of Agrobacterium with plant expression vectors

1) Preparation of Agrobacterium EHA105 competent cells

A single colony of Agrobacterium EHA105 was inoculated into 5ml of LYEP liquid medium and incubated overnight at 28 ℃ and 220 rpm. 2mL of overnight culture liquid is transferred into 50mCulturing in LYEP liquid medium at 28 deg.C and 220rpm to OD₆₀₀Is about 0.5, ice-bath is carried out for 30min, centrifugation is carried out at 4 ℃ and 5000rpm for 5min, supernatant is discarded, and 700 mu L of 50mmol/L CaCl is added₂And 300. mu.L of 80% glycerol, 100. mu.L of each tube was aliquoted and stored at-80 ℃.

2) Transformation of Agrobacterium

Adding 20ng of purified plasmid pCAMBIA-fHbp into 100. mu.L of Agrobacterium infected state, mixing, ice-cooling for 30min, transferring into liquid nitrogen for 5min, rapidly incubating at 37 deg.C for 5min, adding 800. mu.L of YEP liquid culture medium, and culturing at 28 deg.C and 220rpm for 4-5 h. The bacterial solution was transferred to a YEP medium containing 50mg/L kanamycin solid, spread over the plate, and cultured at 28 ℃ for 1 to 2 days.

3) Screening and identification of transformed Agrobacterium

Resistant colonies were selected and cultured in 5mL YEP liquid medium containing 50mg/L kanamycin at 28 ℃ and 220rpm for 1 day, centrifuged, plasmid extracted, and the fragment size was detected by enzyme digestion electrophoresis.

EXAMPLE 3 Agrobacterium-mediated transformation and selection of herbicide resistance in transformed plants

1) Preparation of Agrobacterium engineering bacteria

Taking Agrobacterium strain with expression vector, adding the strain and culture medium at a ratio of 1:200 into YEP liquid culture medium containing 50mg/L kanamycin and 25mg/L rifamycin, culturing at 28 deg.C and 220rpm to OD₆₀₀Centrifuging at 5000rpm for 5min to collect thallus at 0.5-0.6. Resuspending the collected thallus in infection solution, and adjusting to OD₆₀₀Is 1.0-1.2, and is ready for use.

2) Transformation of Arabidopsis thaliana

A. Soaking the whole plant of the arabidopsis with the bolting flower buds in the agrobacterium liquid, carrying out dip dyeing for 5min, taking out the arabidopsis, and placing the arabidopsis in a dark place for 24 h;

B. collecting yellow seed pods after the infected plants are 2-3 weeks;

C. uniformly sowing the collected seeds in a flowerpot, spraying 1% of glufosinate-ammonium for screening when two true leaves grow out, and spraying for 3 times at intervals of 5 days.

Example 4 molecular biological assay of transformed plants

1) PCR detection of fHbp gene and Bar gene of transformed plant

0.05g of Arabidopsis thaliana leaves are ground in liquid nitrogen, 1mL of CTAB extraction buffer (75mM 1M Tris-HCl (pH8.0), 100mM 0.5M EDTA (pH8.0), 1.05M NaCl, 0.75% 40K PVP, water is added to the buffer to a constant volume of 1L), the mixture is incubated at 65 ℃ for 30min, the mixture is centrifuged at 12000rpm for 10min, the supernatant is transferred into a new centrifuge tube, phenol/chloroform/isoamyl alcohol (volume ratio 25:24:1) with the same volume is added, the mixture is fully mixed, and the mixture is centrifuged at 12000rpm for 10 min. Transferring the supernatant into a new centrifuge tube, adding chloroform with the same volume, fully and uniformly mixing, and centrifuging at 12000rpm for 10 min. The supernatant was transferred to a new centrifuge tube, and two times the volume of absolute ethanol was added to precipitate DNA at-20 ℃. Centrifuging at 12000rpm for 10min after 30min, discarding supernatant, drying precipitate, adding ddH₂And (4) dissolving the O back for later use. Taking total DNA of a resistant plant as a template, taking total DNA of transformed arabidopsis thaliana as negative control, taking pUC57-fHbp plasmid as positive control, and designing specific primers according to fHbp, wherein the two primers are respectively as follows:

an upstream primer: 5'ATCGTCCATGGGACATCATCATCATCAT 3';

a downstream primer: 5'AAGCTTAATTAGCCATAGAAATAGCAG 3'.

Designing specific primers according to the Bar gene, wherein the two primers are respectively as follows:

an upstream primer: 5'TCAAATCTCGGTGACGGGCAGGA 3';

a downstream primer: 5'ATGAGCCCAGAACGACGCCCGGC 3'.

The amplification products were detected by electrophoresis on a 1% agarose gel. Amplification of fHbp gene reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 56 ℃ for 30 s; extension at 72 ℃ for 1min20 s; 30 cycles; stretching for 7min at 72 ℃; the reaction was terminated at 4 ℃. The detection results are shown in FIG. 2.

And (3) PCR reaction system:

bar gene PCR reaction program: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 56 ℃ for 30 s; extension at 72 ℃ for 50 s; 30 cycles; stretching for 7min at 72 ℃; the reaction was terminated at 4 ℃. The detection results are shown in FIG. 3.

And (3) PCR reaction system:

2) detection of Bar gene high expression plant

The Bar test strip is used for detecting the plants with positive target genes by PCR, and the expression quantity of the Bar gene is detected according to the instruction of the Bar gene detection kit. And diluting the positive result of the Bar gene test strip by 10 times, and then rechecking by using the Bar test strip. Plants with still positive results were retained. The results are shown in FIG. 4.

3) Expression of antigen fHbp protein

0.1g of seed pod PBS buffer (137mM NaCl, 2.7mM KCl, 10mM Na) was weighed out₂HPO₄，2mM KH₂PO₄(pH7.4), adding water to a constant volume of 1L), extracting total protein, wherein the material-liquid ratio is 1:3, the extraction temperature is 4 ℃, the speed is 10000rpm, and centrifuging is carried out for 20 min. The supernatant is the electrophoretic total protein sample.

Formulation of 12% separation gel (5 mL):

formulation of 5% concentrated gum (2 mL):

separating gel and concentrated gel are prepared according to the formula, protein is mixed with loading buffer5:1, boiling water bath is carried out for 10min, and 10 mu L of the mixture is taken for SDS-PAGE detection of protein fHbp. The results are shown in FIG. 5.

4) Detection of Southern-Blot of transformed plants

1g of the sample was taken into a suitable centrifuge tube and ground in liquid nitrogen. 5mL of CTAB extraction buffer (75mM 1M Tris-HCl (pH8.0), 100mM 0.5M EDTA (pH8.0), 1.05M NaCl, 0.75% 40K PVP, water to a constant volume of 1L) was added, and incubation was carried out at 65 ℃ for 45min, during which time mixing was carried out 2-3 times. The mixture was taken out of the water bath and left at room temperature, centrifuged at 13000rpm for 10min, and the supernatant was transferred to a new centrifuge tube. Adding equal volume of chloroform, and mixing by inversion for 2-3 min. Centrifuge at 13000rpm for 10 min. The above operation was repeated until the color was clear. 2 volumes of absolute ethanol were added to precipitate the DNA. Centrifuging at 13000rpm for 5-7 min. The supernatant was discarded and the precipitate was dried. Add 100. mu.L of ddH₂And O redissolving and precipitating. The extracted plant DNA is digested with the appropriate restriction enzymes. Enzyme digestion system:

after the completion of the digestion, the mixture was mixed by inversion, and 1/10 volumes of 3M NaAc (pH5.2) and 2 volumes of absolute ethanol were added to the mixture, and the mixture was mixed by inversion. 13000rpm for 2min, discard the supernatant, dry the precipitated DNA. Add 40. mu.L of ddH₂And O redissolving and precipitating. The positive control was pCAMBIA1301-fHbp, and the negative control was non-transformed Arabidopsis DNA. The DNA was separated on a 0.8% agarose gel at 50V. Detection was performed according to Southern-Blot kit. The results are shown in FIG. 6.

Example 5 isolation and purification of fHbp and measurement of the content

1) Extraction of Total protein from Arabidopsis seed pod

Placing the seeds in a mortar, adding liquid nitrogen, grinding into powder, adding 1 volume of PBS extract, oscillating, homogenizing, standing on ice for 30min, and mixing by reversing every 5 min. The mixture was centrifuged at 10000g4 ℃ for 40min in a centrifuge. The supernatant was aspirated and centrifuged again. The supernatant was aspirated. Detection of OD according to the above method₅₉₅Values, the total protein concentration was calculated.

2) Ni-NTA purification of fHbp

Passing the extracted total plant protein throughFiltration through a 0.22 μm filter. 10mL of total plant protein was each time poured into a Binding Buffer (300mM NaCl, 50mM NaH)₂PO₄10mM imidazole, 10mM Tris base, pH8.0) on a well-balanced Ni-NTA affinity chromatography column. Controlling the flow rate of the effluent at 1 mL/min by using a peristaltic pump^-1And collecting effluent liquid. Wash Buffer (20 mmol. L)^-1NaH₂P0₄，500mmol·L^-1NaCl, pH7.4, 20 mmol. L imidazole) was washed for about 5 column volumes, followed by Elution Buffer (20 mmol. L)^-1NaH₂P0₄，500mmol·L^-1NaCl, pH7.4, 100 mmol. multidot.L (imidazole) eluted fHbp from the column. The results are shown in FIG. 7.

3) Determination of purified fHbp concentration

Collecting protein standard (BSA 5 mg. mL)^-1)10 μ L of the resulting solution was diluted to 100 μ L with PBS, i.e., 0.5 mg/mL^-1. The diluted standards were added to 96-well plates at 0,2, 4, 6, 8, 12, 16, 20 μ L, respectively, and all standards were made up to 20 μ L with PBS. Add purified protein to 96-well plate. Adding 200 μ L Bradford staining solution into each well, gently sucking and mixing with pipette, standing at room temperature for 3-5min, and measuring A with microplate reader₅₉₅The absorbance value of (c). Calculating the protein concentration according to the standard curve, wherein the protein concentration is about 3.437 mg/mL^-1。

Example 6 identification of the immunological Activity of a fHbp subunit vaccine

1) Preparation of immunological formulation

The purified fHbp protein was collected and adjusted to 1.000. mu.g/. mu.L in PBS^-11:1 Freund's complete adjuvant and Freund's incomplete adjuvant to prepare the emulsifier for later use.

2) Animal immunization test

20 female BALB/C mice 6 weeks old were randomly divided into 2 groups, i.e., experimental and control groups (10 mice per group), and the prepared immunization preparation was intraperitoneally injected at 0, 15, and 30 days, respectively, the primary immunization injection was fHbp/Freund's complete adjuvant, the booster immunization injection was fHbp/Freund's incomplete adjuvant, the experimental group was injected with 0.3mL (containing 20. mu.g of fHbp protein) per one, and the control group was injected with an equal amount of PBS solution per one.

3) Obtaining animal serum

Mice were bled by tail-off prior to immunization, and 10 days after primary immunization, 25 days and 40 days after booster immunization, and sera were separated and stored frozen at-80 ℃.

4) ELISA detection of fHbp antisera

Using the purified fHbp, the concentration was adjusted to 20. mu.g.mL^-1Coating 96-hole enzyme label plate. The plate was washed 3 times. Blocking with 3% BSA in PBST for 2hr, and removing the blocking solution. Serum obtained at 10,25, and 40 days was added, and a negative control, i.e., non-transformed Arabidopsis seed total protein, was set, reacted at 37 ℃ for 2hr, and the plate was washed 3 times. Adding a goat anti-mouse IgG labeled with horseradish peroxidase (HRP) and diluted by 5000 times in the confining liquid, and removing the antibody solution. 100 μ L of substrate o-phenylenediamine (OPD) was added and color developed in the dark. The reaction was stopped by adding 50. mu.L of 2M sulfuric acid per well. Absorbance of the sample at 492nm with a microplate reader. The positive result is judged when the light absorption value of the serum sample is more than 2 times of that of the negative control. Antibody titers were expressed as the reciprocal of the highest dilution that gave a positive result, 10 mouse serum samples A₄₉₂The average of the absorbance values represents the titer of the antibody at that time, and the results are shown in FIG. 8.

5) Preparation of suspension of MenB (Strain No. 29315) Strain

Inoculation of MenB on chocolate solid Medium, 37 ℃, 5% CO₂Culturing for 36-48 hr. Single colonies were picked. Culturing to OD on chocolate liquid medium₆₀₀0.5, collect the cells, resuspend the cells with PBS buffer to a final concentration of 5 × 10³cfu·mL^-1。

6) Protection of the immune Effect of fHbp against MenB (Strain No. 29315) Strain

A total of 20 mice (10 experimental groups and 10 control groups) immunized with fHbp and PBS in the abdominal cavity for 40 days were injected with 100. mu.L of the bacterial solution, and the mice were observed for fatality after 72 hr. And the immunoprotection Rate (RPS) was calculated using the following formula: RPS-100 x (1-percent mortality in immunized mice)/(percent mortality in control mice). Therefore, the immune protection rate of the recombinant fHbp subunit vaccine on MenB is 80%, so that fHbp can protect mice from infection of MenB.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> university of Wenzhou

<120> expression system of meningococcal fHbp protein

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1717

<212> DNA

<213> promoter (. beta. -phaseolin)

<400> 1

attcgggcag tgattgtata cgactcacta tagggcgaat tgggccctct agatgcatgc 60

tcgagcggcc gccagtgtga tggatatctg cagaattgcc cttgaaatta tcacgcttcc 120

gcacacgata tccctacaaa tttattattt gttaaacgtt ttcaaaccgc ataaaatttt 180

gtgaagtccc gtctatcttt aatgtagtct aacattttca tattgaaata tataatttac 240

ttaattttag cgttggtaga aagcataatg atttattctt attcttcttc atataaatgt 300

ttaatataca atataaacaa attctttacc ttaagaagga tttcccattt tatattttaa 360

aaatatattt atcaaatatt tttcaaccac gtaaatctca taataataag ttgtttcaaa 420

agtaataaaa tttaactcca taattttttt attcgactga tcttaaagca acacccagtg 480

acacaactag ccattttttt ctttgaataa aaaaatccaa ttatcattgt atttttttta 540

tacaatgaaa atttcaccaa acaatgattt gtggtatttc tgaagcaagt catgttatgc 600

aaaattctat aattcccatt tgacactacg gaagtaactg aagatctgct tttacatgcg 660

agacacatct tctaaagtaa ttttaataat agttactata ttcaagattt catatatcaa 720

atactcaata ttacttctaa aaaattaatt agatataatt aaaatattac ttttttaatt 780

ttaagtttaa ttgttgaatt tgtgactatt gatttattat tctactatgt ttaaattgtt 840

ttatagatag tttaaagtaa atataagtaa tgtagtagag tgttagagtg ttaccctaaa 900

ccataaacta taagatttat ggtggactaa ttttcatata tttcttattg cttttacctt 960

ttcttggtat gtaagtccgt aactagaatt actgtgggtt gccatgacac tctgtggtct 1020

tttggttcat gcatggatgc ttgcgcaaga aaaagacaaa gaacaaagaa aaaagacaaa 1080

acagagagac aaaacgcaat cacacaacca actcaaatta gtcactggct gatcaagatc 1140

gccgcgtcca tgtatgtcta aatgccatgc aaagcaacac gtgcttaaca tgcactttaa 1200

atggctcacc catctcaacc cacacacaaa cacattgcct ttttcttcat catcaccaca 1260

accacctgta tatattcatt ctcttccgcc acctcaattt cttcacttca acacacgtca 1320

acctgattat gcgtgtcatc ccatgcccaa atctccatgc atgttccaac caccttctct 1380

cttatataat acctataaat acctctaata tcactcactt ctttcatcat ccatccatcc 1440

agagtactac tactctacta ctataatacc ccaacccaac tcatattcaa tactactcta 1500

ctccatggcg gatacagcta gaggaaccca tcacgatatc atcggcagag accagtaccc 1560

gatgatgggc cgagaccgag accagtacca gatgtccgga cgaggatctg actactccaa 1620

gtctaggcag attgctaaag aagggcaatt ccagcacact ggcggccgtt actagtggat 1680

ccgagctcgg taccaagctg gcgtaatcat gtccaag 1717

<210> 2

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atcgtccatg ggacatcatc atcatcatc 29

<210> 3

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aagcttaatt agccatagaa atagcagc 28

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaatctcg gtgacgggca gga 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgagcccag aacgacgccc ggc 23

Claims

1. An expression system of meningococcal fHbp protein is characterized by comprising an fHbp antigen gene, a vector pCAMBIA1301 and a promoter capable of enabling the fHbp antigen gene to be efficiently expressed in a plant, wherein the promoter is a beta-phaseolin promoter, the expression system is pCAMBIA-fHbp, and the nucleotide sequence of the beta-phaseolin promoter is shown in SEQ ID No. 1;

by streaking MenB Standard strain MC58 on chocolate solid Medium at 37 deg.C, 5% CO₂Culturing for 36-48hr, picking single colony with diameter of 1.0-1.5mm, re-suspending with PBS, extracting MC58 whole genome with Universal genomic DNA Extraction Kit, designing two specific primers at the upstream and downstream of fHbp according to known fHbp sequence and introducing NcoI and HindIII enzyme cutting sites at 5 'and 3', respectively:

an upstream primer: 5'ATCGTCCATGGGACATCATCATCATCATC 3';

a downstream primer: 5'AAGCTTAATTAGCCATAGAAATAGCAGC 3' of the formula I,

amplifying a fHbp fragment and connecting the fHbp fragment into pEASY-T1, wherein the carrier is named as pEASY-T1-fHbp, and pEASY-T1-fHbp and p1301-phas are subjected to double enzyme digestion, recovering a small fragment of pUC57-fHbp and a large fragment of p1301-phas, and connecting to obtain the plasmid pCAMBIA-fHbp.

2. The meningococcal fHbp protein expression system of claim 1, comprising a selection marker, wherein the selection marker is the Bar gene.

3. Use of the promoter of claim 1 for increasing the high expression of the fHbp antigen gene in plants.