CN115521918A

CN115521918A - Construction and application of MDA-MB-231 cell strain with estrogen activity

Info

Publication number: CN115521918A
Application number: CN202110713973.XA
Authority: CN
Inventors: 陈�田; 殷庆飞
Original assignee: Shanghai Jahwa United Co Ltd
Current assignee: Shanghai Jahwa United Co Ltd
Priority date: 2021-06-25
Filing date: 2021-06-25
Publication date: 2022-12-27

Abstract

The invention provides a recombinant MDA-MB-231 cell line for detecting estrogen compounds and a preparation method and application thereof. The method for constructing the recombinant MDA-MB-231 cell line comprises the following steps: (a) Providing an ER β coding sequence (SEQ ID NO: 1) and a 3 × ERE gene sequence (SEQ ID NO: 2); (b) Constructing the ER beta gene segment into a pCMV6-mGFP carrier plasmid to obtain an over-expression plasmid pCMV-ESR2 (SEQ ID NO: 3), and constructing the ERE gene segment into a luciferase reporter gene plasmid pGL4.21 to obtain an over-expression plasmid pGL-ERE (SEQ ID NO: 4); (c) Transfecting the pCMV-ESR2 into an MDA-MB-231 cell to obtain a cell strain MDA-MB-231-ESR2 which excessively expresses ER beta genes and GFP fluorescent protein; (d) After the MDA-MB-231-ESR2 cell strain is stable in character, transfecting the over-expression plasmid pGL-ERE into the cell strain to obtain the cell strain MDA-MB-231-ESR2-ERE stably expressing ER beta and ERE genes.

Description

Construction and application of MDA-MB-231 cell strain with estrogen activity

Technical Field

The invention relates to the technical field of biology, in particular to an MDA-MB-231 cell strain with estrogen activity and a preparation method and application thereof.

Background

With the increasing consumption level of residents in China and the pursuit of higher living quality, the scale of the cosmetic consumption market in China is continuously expanded. However, while cosmetics bring great economic benefits, the quality safety of cosmetics is more and more focused on people, and particularly, the phenomenon that hormones are illegally added to cosmetics is particularly prominent. The existing technical code for cosmetic safety (2015 edition) and regulations of European Union cosmetic directive 76/768/EEC and the like in China clearly stipulate that hormone is regarded as a forbidden component, but because the hormone has obvious effects of diminishing inflammation, removing acne, whitening and protecting skin and the like on skin, illegal manufacturers still add the hormone to the cosmetic illegally to seek improper benefits. For example: the Hubinger JC paper states that 63% of the tested cosmetics are labeled as containing estrogen and/or progesterone and also provides quantitative labeling information on the hormonal components (ref: hubinger JC. Determination of estrol, and progasterone in cosmetic products J cosmit Sci.2015Mar-Apr;66 (2): 113-28. PMID. The long-term use of the cosmetics by consumers without knowing can cause serious influence on the health of the body, such as skin thinning, redness, itching, metabolic disorder and even cancer.

Estrogens exert a regulatory effect on the body, primarily through binding to the Estrogen Receptor (ER). Common estrogen receptors are: estrogen Receptor alpha (ER α), estrogen Receptor beta (ER β), and G protein-coupled Estrogen receptors. The expression profiles of these receptors vary greatly between different tissues and cell types. Estrogen-related Receptors (ERRs) are a class of orphan Receptors, mainly ERR α, ERR β and ERR γ. ERRs can promote the expression of energy metabolism directly by regulating a wide range of genes important in metabolism, such as those encoding glycolytic pathway, tricarboxylic acid cycle, oxidase. Chronic dysregulation of these key pathways can lead to the development of metabolic syndrome, obesity and diabetes.

There are data showing that changes in estrogen levels are associated with skin damage, especially in women during menopause. While high estrogen levels may lead to cancer. For example, steroid hormones are important markers of breast cancer status, especially estrogen and its metabolites, increasing the risk of breast cancer. In general, estrogen has a variety of physiological functions and is associated with a number of different diseases, including obesity, metabolic disorders, osteoporosis, lupus, endometriosis, and uterine fibroids. Therefore, the research on the hormone detection method in the cosmetics is not only beneficial to improving the government regulatory capability, but also beneficial to guaranteeing the benefits and physical and psychological health of consumers.

At present, the detection of illegal addition hormones in cosmetics mainly aims at glucocorticoids and sex hormones (including estrogen, androgen and progestogen), and the analysis methods mainly comprise high performance liquid chromatography, liquid chromatography-tandem mass spectrometry, liquid chromatography-high resolution mass spectrometry and the like. The traditional manual sampling detection can only detect the contents of approximate components of the cosmetics, and cannot accurately manage the contents. The method is the most widely applied determination method at present, has good separation effect and accurate qualitative determination, and is a sex hormone detection method specified in the national cosmetic hygiene code at present. However, these detection methods require large expensive instruments in a laboratory, require long sample pretreatment time and large consumption of toxic organic solvents, and have complicated operation steps, high analysis cost and long analysis time.

At present, a recombinant yeast cell detection system exists, but a strong promoter (ADH 1) is constructed at the upstream of a target gene in the system, and the strong promoter can directly start the transcription expression of the target gene without the cis-regulation effect mediated by a hormone-receptor, so that the misestimation of the estrogen-like activity in a sample is caused. Therefore, the method does not construct a promoter at the upstream of the reporter gene, but only has an estrogen response element, so as to accurately evaluate the expression condition of the reporter gene mediated by the estrogen-receptor;

the recombinant yeast cell assay system uses Green Fluorescent Protein (GFP) activity as an indicator for the quantitative analysis of estrogenic activity. Green fluorescent protein GFP is a type of bioluminescent protein that is present in coelenterates including jellyfish, leeches, and corals and emits green fluorescence when excited by ultraviolet or blue light. It has been widely used for studies to monitor gene expression, localization, mobility, interaction of various membrane and cytoplasmic proteins, protein folding and interaction, etc. However, the practical technology in this aspect is not mature at present, and has little perfect related data. The expression level of GFP is related to its own characteristics such as the biological state of the cell, in addition to its upstream regulatory elements, and thus varies greatly among individuals. And objective conditions such as culture environment and detection instrument also influence the quantitative analysis of GFP fluorescence intensity. The method carries out quantitative analysis on the activity of the estrogen by a luciferase reporter gene system. The luciferase reporter gene is a relatively accurate reporter system for detecting the activity of firefly luciferase by using luciferin as a trigger. Is often used to detect the interaction between gene expression elements such as transcription factors and the promoter region DNA of a target gene.

In addition, the current application of GFP is to express a fusion protein of GFP and a target protein, which may change the spatial conformation of the target protein and further affect the biological function. In the recombinant cell line constructed by the method, an Internal Ribosome Entry Site (IRES) sequence is inserted between a target gene sequence and a GFP coding sequence, so that a target protein and GFP can be independently expressed, and the biological function of the target protein is not influenced. Meanwhile, GFP can qualitatively judge whether the recombinant cell line is successfully constructed or not.

Yeast is a prokaryote, and the biological effect of estrogen on its production has not been studied in depth. At present, the chemotherapy of breast cancer by combining estrogen is an emerging means. And MDA-MB-231 cell line is a triple negative breast cancer cell line, has high malignancy degree, does not express estrogen receptors, and is not sensitive to estrogen treatment. An MDA-MB-231 cell line capable of producing estrogenic activity was constructed which is capable of performing biological functions under estrogen stimulation. Therefore, the cell line can also be used for evaluating the curative effect of breast cancer treatment drugs.

In vitro estrogen receptor transcriptional activation assay is an evaluation established in recent years. The estrogen receptor is a protein molecule capable of being specifically combined with estrogen compounds, and an estrogen-estrogen receptor complex formed by the estrogen receptor molecule can be specifically recognized and combined with an Estrogen Response Element (ERE) positioned in a target gene promoter, so that the transcription level of a downstream target gene is regulated, and the biological function is realized.

Based on the action mechanism of the hormone-receptor regulation gene expression, the method constructs a eukaryotic cell system which can express an estrogen receptor and is provided with an estrogen response element and a report gene regulated by the estrogen response element, and evaluates the estrogen activity intensity of a sample to be tested according to the expression level of the report gene. The host cell can be a human breast cancer cell MDA-MB-231 cell line which does not express estrogen receptor alpha and estrogen receptor beta, so that the interference effect of endogenous estrogen receptors is eliminated, and the influence of in vivo receptor gene mutation on the result is not generated.

The invention provides an MDA-MB-231 cell strain with estrogen activity, a preparation method and application thereof, and by constructing the MDA-MB-231 cell strain which contains stably transfected estrogen receptor beta and can generate estrogen activity, the quantitative detection of estrogen compounds can be conveniently and effectively carried out by means of a luciferase report system. The method is simple and easy to operate, reduces the use of large instruments, can quickly realize field detection, and provides a new possibility for the detection method of hormone compounds in cosmetics.

Disclosure of Invention

In one aspect, the present invention provides a method for constructing an MDA-MB-231 cell line having estrogenic activity, comprising the steps of:

(a) Providing an ER β coding sequence (SEQ ID NO: 1) and a 3 × ERE gene sequence (SEQ ID NO: 2);

(b) Constructing the ER beta gene segment into a pCMV6-mGFP vector plasmid to obtain an over-expression plasmid pCMV-ESR2 (SEQ ID NO: 3), and constructing the ERE gene segment into a luciferase reporter gene plasmid pGL4.21 to obtain an over-expression plasmid pGL-ERE (SEQ ID NO: 4);

(c) Transfecting the pCMV-ESR2 into an MDA-MB-231 cell, and stably screening to obtain a cell strain MDA-MB-231-ESR2 for over-expressing ER beta gene and GFP fluorescent protein;

(d) After the MDA-MB-231-ESR2 cell strain is stable in character, transfecting the cell strain with the over-expression plasmid pGL-ERE, and stably screening to obtain the cell strain MDA-MB-231-ESR2-ERE stably expressing ER beta and ERE genes.

In a preferred embodiment, the overexpression plasmid pCMV-ESR2 is transfected into MDA-MB-231 cells using Lipofectamine 2000 in step (c) above.

In a preferred embodiment, in step (c) above, lipofectamine 2000 is mixed with pCMV-ESR2 in a volume to mass ratio of 2.

In a preferred embodiment, step (c) above employs G418 for stable screening.

In a preferred embodiment, step (d) above is a stable selection with puromycin.

In another aspect, the invention also provides MDA-MB-231 cell lines having estrogenic activity.

In another aspect, the invention provides the use of the MDA-MB-231 cell line with estrogenic activity in the detection of estrogenic compounds. In a preferred embodiment, for detecting estrogens in a cosmetic product, for example, for detecting 0.1-10 μ g of estrogens.

Drawings

FIG. 1 is an agarose gel electrophoresis of the pCMV6-mGFP (a) and pGL4.21 (b) vector plasmids of the present invention; wherein, 10kb Marker, the strip is from top to bottom: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb,1.5kb,1kb,750bp,500bp,250 bp.

FIG. 2 shows the partial sequencing results of the plasmids of the pCMV6-mGFP and pGL4.21 vectors of the present invention.

FIG. 3 is a map of the plasmids pCMV-ESR2 and pGL-ERE of the present invention.

FIG. 4 shows PCR identification agarose gel electrophoresis of plasmids pCMV-ESR2 (a) and pGL-ERE (b) according to the invention; wherein, 1: negative control (ddH 2O); 2: negative control (no-load self-ligation control group); 3: positive control (GAPDH); 4: marker, from top to bottom, sequentially comprises 5kb,3kb,2kb,1.5kb,1kb,750bp,500bp,250bp and 100bp;5-7: the PCR products of the positive transformation of the transformation products, pCMV6-ESR2 and pGL-ERE, are 446bp and 472bp respectively.

FIG. 5 shows the partial sequencing results of ESR2 and ERE of the fragments of interest according to the invention.

FIG. 6 shows the expression level of ESR2 gene in the stably transfected cell MDA-MB-231-ESR2 of the present invention, wherein P is less than 0.0001 compared with the control group.

FIG. 7 shows the expression levels of ESR2 and ERE genes in the stably transfected cells MDA-MB-231-ESR2-ERE of the present invention.

FIG. 8 is a graph comparing the activity of normal and stable transfected cells after treatment with varying concentrations of estradiol in accordance with the present invention.

FIG. 9 is a graph showing the intensity of luciferase response in stably transformed cells after treatment with varying amounts of estradiol in accordance with the present invention.

FIG. 10 is a linear relationship between estradiol treatment dose and luciferase response intensity for stably transfected cells of the present invention.

FIG. 11 is a linear relationship between estradiol treatment dose to stably transfused cells and luciferase reaction intensity after Box-Cox transformation in accordance with the present invention.

FIG. 12 shows the measurement results of the contents of estrogens in different samples in example 2.

Detailed Description

The invention aims to provide an MDA-MB-231 cell strain with estrogen activity and a preparation method and application thereof. Specifically, the present invention provides an MDA-MB-231 cell line with estrogenic activity stably transfected with estrogen receptor beta (ESR 2) and optionally an Estrogen Responsive Element (ERE).

The cell strain is MDA-MB-231 cells which are transferred with estrogen receptor beta genes, and the MDA-MB-231 cells are stably transfected with the estrogen receptor beta and can generate estrogen activity to estrogen compounds. The invention can judge the cell activity by means of the fluorescence characteristic of GFP, and can conveniently and effectively carry out qualitative detection on the estrogen compounds; the method has the advantages of quantitatively detecting the estrogen compounds according to the luciferase reaction intensity and the quality of the total cell protein, being simple and easy to operate, reducing the use of large machines such as a mass spectrometer and the like, effectively reducing the detection cost, time and manpower and material resources of a supervision department on cosmetics, quickly realizing the detection of the cosmetics, and providing new data and possibility for the detection method of the hormone compounds in the cosmetics.

The invention provides a recombinant cell line (such as MDA-MB-231 cell line with estrogenic activity), which is obtained by expressing an estrogen receptor beta gene and a reporter gene expression cassette containing 3 tandem ERE genes in cells.

In a preferred embodiment, the reporter gene expression cassette comprising 3 tandem ERE genes comprises, in order, the 3 tandem ERE genes and the reporter gene.

In a preferred embodiment, the recombinant cell line further expresses a first resistance gene expression cassette and a second resistance gene expression cassette.

In a preferred embodiment, the nucleotides of the 3 tandem ERE genes are nucleotides 207-385 of SEQ ID NO. 4.

In a preferred embodiment, the estrogen receptor beta gene is expressed in the cell line by introducing the estrogen receptor beta gene into the cell as a recombinant vector.

In a preferred embodiment, the expression of the estrogen receptor beta gene in the cell line and the expression cassette of the resistance selection gene are both homologous recombination fragments and are integrated into the genome of the cell for expression.

In a preferred embodiment, the reporter gene cassette containing 3 tandem ERE genes and the resistance selection gene cassette are expressed in the cell line as homologous recombination fragments integrated into the genome of the cell for expression.

In a preferred embodiment, the homologous recombination fragment comprises a fragment of the first resistance selection gene expression cassette and the estrogen receptor β gene.

In a preferred embodiment, the second homologous recombination fragment comprises a fragment of the second resistance selection gene expression cassette and the reporter gene expression cassette comprising 3 tandem ERE genes.

In a preferred embodiment, the first recombinant vector is a vector for inserting the estrogen receptor beta gene into an expression vector and expressing the estrogen receptor beta gene.

In a preferred embodiment, in the first recombinant vector, a promoter for driving the expression of the estrogen receptor beta gene is a DNA molecule shown as SEQ ID NO. 3.

In a preferred embodiment, the second recombinant vector is an expression vector into which the 3 tandem ERE genes are inserted.

In a preferred embodiment, the estrogen receptor beta gene has the nucleotide sequence of position 1057-2649 of SEQ ID NO. 3.

In a preferred embodiment, the resistance selection gene of the first resistance selection gene expression cassette is a neomycin resistance gene.

In a preferred embodiment, the resistance selection gene of the second resistance selection gene expression cassette is a puromycin gene.

In a preferred embodiment, the neomycin resistance gene has the nucleotide sequence 5091-5885 of SEQ ID NO. 3.

In a preferred embodiment, the puromycin gene nucleotide sequence is 2974-3573 of SEQ ID NO. 4.

In a preferred embodiment, the reporter gene of the reporter expression cassette containing 3 tandem ERE genes is luciferase gene, and the nucleotide sequence of the reporter expression cassette containing 3 tandem ERE genes is position 3-2096 of SEQ ID No. 4.

In a preferred embodiment, the first expression vector is a pCMV6-mGFP vector.

In a preferred embodiment, the second expression vector is a pgl4.21 vector.

In a preferred embodiment, the nucleotide sequence of the first homologous recombination fragment is SEQ ID NO 3, positions 958-3392.

In a preferred embodiment, the nucleotide sequence of the second homologous recombination fragment is 3-549 of SEQ ID NO. 4.

In a preferred embodiment, the homologous recombination fragments are integrated by integration plasmid-mediated homologous recombination.

In a preferred embodiment, the nucleotide sequence of integrative plasmid I is SEQ ID NO 3.

In a preferred embodiment, the nucleotide sequence of integrative plasmid II is SEQ ID NO. 4.

In another aspect, the present invention provides a method for constructing a recombinant cell line, comprising the steps of: and (3) introducing an estrogen receptor beta gene and a reporter gene expression cassette containing 3 series ERE genes into the cells to obtain a recombinant cell strain.

In a preferred embodiment, the method further comprises introducing into the cell a first resistance selection gene expression cassette and a second resistance selection gene expression cassette.

In a preferred embodiment, the nucleotides of the 3 tandem ERE genes are 207-385 of SEQ ID NO. 4 of the sequence Listing.

In a preferred embodiment, the expression of the estrogen receptor beta gene in the cell line and the expression of the resistance selection gene cassette are expressed as a homologous recombination fragment integrated into the genome of the cell.

In a preferred embodiment, the reporter gene expression cassette containing 3 tandem ERE genes and the resistance selection gene expression cassette are expressed in the cell line as homologous recombination fragments integrated into the genome of the cell.

In a preferred embodiment, the homologous recombination fragment comprises a fragment of the first resistance selection gene expression cassette and the estrogen receptor beta gene.

In a preferred embodiment, the estrogen receptor β gene has the nucleotide sequence of SEQ ID NO. 3 at positions 1057-2649.

In a preferred embodiment, the reporter gene of the reporter gene expression cassette containing 3 tandem ERE genes is luciferase gene, and the nucleotide sequence of the reporter gene expression cassette containing 3 tandem ERE genes is 3-2096 of SEQ ID NO. 4.

In a preferred embodiment, the first expression vector is a pCMV6-mGFP vector.

In a preferred embodiment, the second expression vector is a pgl4.21 vector.

In a preferred embodiment, the nucleotide sequence of the first homologous recombination fragment is SEQ ID NO 3 at positions 958-3392.

In a preferred embodiment, the nucleotide sequence of the integrative plasmid I is SEQ ID NO 3.

In a specific embodiment, the present invention also provides a method for preparing an MDA-MB-231 cell line having estrogenic activity, comprising the steps of:

step 1: obtaining a target fragment by using a gene recombination technology: the length of the ER beta coding sequence (SEQ ID NO: 1) is 1592bp, and the ER beta coding sequence with enzyme cutting sites added at two ends is chemically synthesized; the length of the 3 XERE gene sequence (SEQ ID NO: 2) is 179bp, and the 3 XERE gene sequence with enzyme cutting sites added at both ends is chemically synthesized.

Constructing the ER beta gene segment into a pCMV6-mGFP vector plasmid to obtain an overexpression plasmid pCMV-ESR2; meanwhile, an ERE gene fragment is constructed to a luciferase reporter gene plasmid pGL4.21, so that an over-expression plasmid pGL-ERE is obtained;

step 2: transfecting the pCMV-ESR2 into an MDA-MB-231 cell, and stably screening to obtain a cell strain MDA-MB-231-ESR2 which overexpresses ER beta gene and GFP fluorescent protein;

and step 3: after the MDA-MB-231-ESR2 cell strain is stable in character, transfecting the cell strain with the over-expression plasmid pGL-ERE, and screening with puromycin to obtain the cell strain MDA-MB-231-ESR2-ERE stably expressing ER beta and ERE genes.

In a preferred embodiment, in step 2, the overexpression plasmid pCMV-ESR2 is transfected into MDA-MB-231 cells using Lipofectamine 2000, and the cells are selected using G418 for 7-10 days 24h after transfection.

In a preferred embodiment, in step 2, lipofectamine 2000 is mixed with pCMV-ESR2 in a volume ratio of: the mass is 2:1 and mixing.

In another aspect, the invention also provides an application of the MDA-MB-231 cell strain with estrogenic activity in quantitative detection of estrogenic compounds. In a preferred embodiment, the kit is applied to the quantitative detection of the estrogen compounds in the cosmetics.

The hormone-receptor complex formed by the combination of estrogen and an estrogen receptor in a cell is combined with a target gene containing an Estrogen Response Element (ERE) in a promoter, so that the transcription and expression of the target gene are activated, and a series of physiological effects are exerted. The MDA-MB-231 is used as a carrier to build a classical pathway of an estrogen receptor, the interference of PR and EGF families, ER alpha and a shearing variant thereof is eliminated, a cell strain which stably expresses estrogen receptor beta and can generate estrogen activity is constructed, a preliminary research material can be provided for developing a new method for treating breast cancer, and the research of related fields is enriched.

The invention specifically transfers estrogen receptor beta into MDA-MB-231 cells to form MDA-MB-231 cell strains which can stably transfect the estrogen receptor beta and can generate estrogen activity, and after being treated by estradiol with different concentrations, the activity of the stably transferred cell strains is obviously improved, and the cell strains show certain affinity to estrogen. On the basis of stably over-expressing GFP and luciferase genes, the cell strain shows obvious cell activity after being stimulated by estrogen substances, and the content of the estrogen substances in an added sample can be quantitatively analyzed within a certain range according to the luciferase reaction intensity. The method applies biological detection to quantitative detection of estrogen substances in cosmetics, so that low-cost monitoring of estrogen harmful substances becomes possible.

Therefore, the construction of the GFP-containing cell line disclosed by the invention is convenient to be directly applied to the detection of estrogen of cosmetics, is simple and quick, can reduce the use of mass spectrometers and other large machines, can effectively reduce the detection cost, time, manpower and material resources of supervision and supervision departments for the cosmetics, and can quantitatively detect the estrogen in the cosmetics at a certain precision, so that a new thought can be provided for effectively detecting related compounds of estrogen by illegally adding the related compounds of estrogen in the cosmetics, the illegal behaviors can be attacked to a great extent, the exposure of the related compounds of estrogen by people through the cosmetics is reduced, the welfare of the health cause of people is brought to the public, and the legal benefit and the physical and mental health of consumers are ensured.

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present disclosure, it is understood that each intervening value, to the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

The present invention will be further illustrated below with reference to specific examples and comparative examples. However, these examples and comparative examples are only illustrative of the present invention and are not to be construed as limiting the scope of the present invention. The experimental procedures of the following examples and comparative examples, in which specific conditions are not specified, are generally conducted under conventional conditions or conditions recommended by the manufacturers.

The sources and names of the reagents used in the following examples are as follows:

l-15 medium (company: gibco, cat # 11415-064);

fetal bovine serum (Gibco, cat # 10270);

penicillin-streptomycin, i.e., double antibody (company: hyclone, cat # SV 30010);

lipofectamine 2000 (Inc.: invitrogen, cat # 11668019);

g418 (company: amresco, cat # E859);

puromycin (company: sigma, cat # 540222);

17 β estradiol (company: sigma, cat # E2758-250 MG);

DMSO (company: sigma, cat # D2650-100 ML);

competent Escherichia coli (Inc.: nanjing Nodezam Biotech Co., ltd., cat # C502-02).

Example 1: preparation of MDA-MB-231 cell line having estrogenic Activity

1. Cell culture

Culturing human breast cancer cells (MDA-MB-231) (purchased from cell bank of Chinese academy of sciences) in L-15 complete medium, adding 10% v/v fetal bovine serum, 1% v/v double antibody (penicillin, streptomycin) to the medium, culturing the cells in 37 deg.C incubator for 5-6 generations, and using the cells for subsequent research until their properties are stable.

2. Construction and verification of overexpression plasmid

2.1 vector plasmid amplification and validation

Two plasmid vectors, pCMV6-mGFP (6631 bp) and pGL4.21 (5532 bp), were obtained from Origene and Addgene, respectively. The two plasmids are respectively transformed into competent escherichia coli, and after amplification culture, the vector plasmid is extracted and purified by an alkaline lysis method. The plasmid DNA is separated, identified and purified by agarose gel electrophoresis. The results show that: the three bands of the plasmid are classical and correspond to the expected size, with reference to the DNA molecular weight standard (FIG. 1); the tag sequence in the vector plasmid was subjected to one-generation sequencing, and the extracted DNA was confirmed to be vector plasmid DNA (shown in FIG. 2).

2.2 acquisition and ligation of target fragments

2.2.1 construction of overexpression plasmids pCMV-ESR2 and pGL-ERE

ESR2 and ERE gene sequences of target genes are synthesized chemically. The transcript NM-001437.3 of the ER beta coding gene is retrieved from the NCBI database, the coding sequence of the transcript is 430..2022, and the total length is 1593bp, and is shown as SEQ ID NO. 1. Adding Hind3 enzyme cutting site AAGCTT at the 5 'end of the strain, adding XhoI enzyme cutting site CTCGAG at the 3' end of the strain, and carrying out chemical synthesis; typical EREs are palindromic structural elements, chemically synthesized 3 × ERE according to SEQ ID NO: 2. The 5 'end of the synthesized 3 XERE gene is added with KpnI restriction site GGTACC, and the 3' end is added with XhoI restriction site CTCGAG. ER β is a receptor, and when combined with a ligand (such as estrogen or estrogen inhibitor), it is likely to deform and further generate biological effect, while GFP in a general plasmid product is fused with a target gene, i.e. the expression protein is a fusion protein, which is likely to affect the biological effect of ER β, thereby reducing the reliability of the experiment. Therefore, the present invention adds an internal ribosome entry site (IRES 2) sequence between the target gene sequence and the GFP gene sequence, thereby effectively avoiding the above-mentioned problems caused by the fusion of the target gene and GFP.

ESR2-IRES2 and ERE gene fragments were transferred into linearized expression vectors pCMV6-mGFP and pGL4.21, respectively, and the ligation sites are shown in FIG. 3. Designing and synthesizing a target fragment specific primer for amplification, and detecting an amplification product by agarose gel electrophoresis; a negative control (ddH) was also set ₂ O), negative control (no-load self-ligation control group), and positive control (GAPDH).

Wherein, the specific primers are as follows:

ESR2-F：GTTCCTCTGGAAGCTTCTTG；

ESR2-R：CGTCGCCGTCCAGCTCGACCAG。

the PCR amplification reaction system is shown in Table 1.

TABLE 1

The PCR amplification reaction procedure is shown in Table 2.

TABLE 2

The results show that: the band of interest was clearly amplified, without non-specific bands, and matched the expected size with reference to DNA molecular weight standards (as shown in FIG. 4). And (3) extracting 5 mu l of samples from the recombinant plasmids respectively, performing first-generation sequencing and bidirectional sequencing, and splicing the results to be completely consistent with the target genes (as shown in figure 5). The above results indicate that the overexpression plasmids pCMV-ESR2 (SEQ ID NO: 3) and pGL-ERE (SEQ ID NO: 4) containing the target gene were successfully constructed.

3. Plasmid transfection and validation

3.1 Using Lipofectamine 2000, either the pCMV-ER β overexpression plasmid or the empty vector was transfected into MDA-MB-231 cells (e.g., lipofectamine 2000 to pCMV-ESR2 at a dose ratio of 8. Mu.L: 4. Mu.g), respectively, and 24h after transfection (when cell growth should approach 100% confluence), the cells were transfected in a 1:10, and then after 24h of attachment, L-15 medium (pCMV 6 plasmid resistance) containing G418 with different concentration gradients (0, 100. Mu.g/mL, 200. Mu.g/mL, 300. Mu.g/mL, 400. Mu.g/mL, 500. Mu.g/mL, 600. Mu.g/mL, 700. Mu.g/mL, 800. Mu.g/mL, 900. Mu.g/mL, 1000. Mu.g/mL) can be added for screening for 7-10 days. Meanwhile, wild type MDA-MB-231 plus G418 cells are set for screening as a control. And determining the screening concentration of G418 (600 mu G/mL), wherein the wild MDA-MB-231 cells do not survive, and the survival cells in the cells transferred with the resistance genes are the stable transfer cells.

And (4) digesting the stable transfer cell clusters respectively, transferring the stable transfer cell clusters to a 96-well plate, selecting monoclonals, and amplifying cells. And (3) identifying by using Real Time-PCR (polymerase chain reaction), and confirming whether the target gene is transferred into the cell and expressed or not, or observing whether the expression of GFP (green fluorescent protein) exists in the cell or not by using a fluorescence microscope.

The Real Time-PCR result shows that ESR2 gene expression in the stably transfected cells is obviously higher than that in the untransfected cells, and the target gene is confirmed to be transferred into the cells and expressed, but the efficiency is not high (as shown in figure 6).

To reduce false positives for stably transfected cells, cells that clearly express GFP fluorescence were screened by flow sorting and cultured. And after the cell characteristics are stable, observing under an inverted fluorescence microscope, wherein the purity of the positive cells is higher. And transfecting pGL-ERE plasmids into the sorted positive cells, and screening the transfected cells by using puromycin of 6 mu g/mL to finally obtain a pCMV-ESR2-ERE stable cell line. The PCR results showed that both ESR2 and ERE genes were highly expressed in the stably transfected cells (as shown in FIG. 7).

Example 2

With different concentrations of 17 beta estradiol (0, 10) ^-8 ，10 ^-7 ，10 ^-6 ，10 ^-5 ，10 ^-4 mol/L) treating the stable cell line and the control cell, and detecting the activity of the cell. The results show that as shown in FIG. 8, the activity of untransfected cells gradually decreased with increasing concentration of estradiol; in contrast, estradiol significantly increased the activity of the stable transfected cells compared to the untransfected group, indicating that the stable transfected cell line was responsive to estrogen.

In further experiments, 17 β estradiol (0, 10) was added at different concentrations according to the experimental design ^-14 ，5×10 ^-14 ，10 ^-13 ，5×10 ^-13 ，10 ^-12 ，5×10 ^-12 ，10 ^-11 ，10 ^-10 ，5×10 ^-10 ，10 ^-9 ，10 ^-8 ，10 ^-7 ，10 ^-6 ，10 ^-5 ，10 ^-4 mol/L) in stable sieve cells (pCMV-ESR 2-ERE) and untransfected cells, set up 9 biological parallel experimental groups (i.e. repeat the same experimental treatment 9 times in the same batch experiment, thereby reducing experimental error) and solvent control DMSO group and negative control group. Then, the estradiol-treated cells were collected, and the luciferase reaction intensity of each group and the total protein level of the cells were measured by a multifunctional microplate reader (equipment model: tristar2 LB 942 manufacturer: berthold technologies), thereby obtaining a value of "luciferase intensity/microgram protein" of each group; calculating the content (in pg) of 17 beta-estradiol after the treatment of an experimental group by using 2mL of cell culture medium and 272.39 molecular weight of 17 beta-estradiol in each hole of a six-hole plate, and obtaining 'log' after logarithmic transformation ₁₀ The values of (17 β -estradiol mass/pg) "are: 0. 0.73, 1.03, 1.73, 2.03, 2.73, 3.03, 3.73, 4.03, 4.73, 5.73, 6.73, 7.73, 8.73, 9.73, 10.73. The value of "luciferase intensity/microgram protein" was taken as Y, and "log ₁₀ The value of (17. Beta. -estradiol mass/pg) "was taken as X, and a scattergram was plotted (see FIG. 9). In the DMSO group, DMSO at the same concentration was used to treat the stable-screened cells instead of 17 beta-estradiol.

As shown in FIG. 9, the stable transfected cell line can still generate a certain intensity of luciferase reaction even without treatment or DMSO treatment, so the Y-average (i.e. 190) of the DMSO group is used as the background value in the present invention. And higher than 5 x 10 ^-13 After treatment with mol/L estradiol, the stable transgenic cell line begins to bind estrogen and react with luciferase substrate above background; and the treatment dosage of the estradiol has correlation with the reaction intensity of the luciferase within a certain range. Thus, 5 × 10 is selected ^-13 、10 ^-12 、5×10 ^-12 、10 ^-11 、10 ^-10 、10 ^-9 、10 ^-8 The Y-means and X-values of the experimental groups were used for further regression analysis (parameters as shown in table 3). The linear fit results shown in fig. 10 indicate that the linear correlation of Y and X is poor.

Table 3: regression analysis of estradiol treatment dose and luciferase reaction intensity of stable transfected cells

A residual error graph of the Y-value original data is in a horn mouth shape and belongs to the heteroscedastic condition. After Box-Cox conversion, the estradiol treatment dosage of stable cells and the luciferase reaction intensity haveThere is a certain linear dependence, as shown in fig. 11. Regression analysis of Y and X values of stably transfected cells showed adjustment of R ² The value is 0.992, the correlation is good. Finally, the relationship between estradiol treatment dose and luciferase response intensity was obtained as:

Y＝(9.03+4.037X)^ ^(1/0.55) equation (1) (parameters shown in Table 4).

Taking into account the variability of the cells and fitting the R of the curve ² The value is less than 0.999. Therefore, the background value more than twice the luciferase reaction intensity is used as the effective detection value (380), namely the detection range of the invention is 0.1-10 mug estrogen substances.

Table 4: regression analysis of estradiol treatment dose and luciferase response intensity of stably transfected cells after Box-Cox transformation

Example 3: detection of estrogens in different cosmetic samples

And if the sample to be detected is solid, weighing M g of the sample to be detected, dissolving the M g of the sample to be detected in V mL of DMSO solution, standing for 5min to remove insoluble impurities, and preparing a sample original solution. The original solution is respectively diluted by 20, 50 and 100 times for detection, and then v mL of the original solution is respectively taken from the diluted solution to be co-cultured with the stably transformed cell MDA-MB-231-ESR2-ERE for 24 hours. Setting up a control group, and setting 6 parallels in the experimental group; after the culture was completed, the cells were harvested, and 3 of them were used for the measurement of luciferase intensity R, and the other three were used for the measurement of total protein content m. Calculating the content of the estrogen component in the sample:

W＝10 ^{[(R/m)^0.55-9.03]/4.037} ×V×D/(M×v) -formula (2);

if the sample to be detected is liquid, V and M are saved, and the content of the estrogen component in the sample is calculated as follows:

W＝10 ^{[(R/m)^0.55-9.03]/4.037} XD/v-equation (3).

W: mass fraction (or mass concentration) of estrogenic component in the sample, pg/g (or pg/mL);

r: luciferase reaction intensity, rlu;

m: the total protein content of the cells to be detected, mu g;

m: sample mass, g;

v: sample solution volume, mL;

v: sample detection volume, mL;

d: dilution factor.

Samples were treated as described above and diluted 100, 50 and 20 fold respectively, and 2mL of the dilution was co-incubated with the stably transformed cells MDA-MB-231-ESR2-ERE. Measuring the mean values of luciferase intensity per microgram of protein in cells treated by samples 1 (home-made soymilk in colleges and universities) with different concentrations to be 388.26, 425.43 and 472.17 respectively, the mean values of samples 2 (sea soy sauce straw mushroom dark soy sauce, sea flavoring food GmbH in Foshan city) to be 179.18, 166.45 and 172.53 respectively, and the mean values of samples 3 (sea white rice vinegar, sea flavoring food GmbH in Foshan city) to be 176.46, 179.87 and 174.15 respectively, and then calculating the mass mean values of the estrogen components in the samples 1 with different concentrations to be 2.183 mu g, 2.384 mu g and 2.439 mu g according to the formula (1) and the formula (3), so that the mass concentration range of the estrogen components is 1.168 +/-0.055 mu g/mL; while the estrogenic species in

samples

2 and 3 were below the detection limit (as shown in figure 12).

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Shanghai's family Joint sharps Ltd

<120> construction and application of MDA-MB-231 cell strain with estrogen activity

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1593

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 1

atggatataa aaaactcacc atctagcctt aattctcctt cctcctacaa ctgcagtcaa 60

tccatcttac ccctggagca cggctccata tacatacctt cctcctatgt agacagccac 120

catgaatatc cagccatgac attctatagc cctgctgtga tgaattacag cattcccagc 180

aatgtcacta acttggaagg tgggcctggt cggcagacca caagcccaaa tgtgttgtgg 240

ccaacacctg ggcacctttc tcctttagtg gtccatcgcc agttatcaca tctgtatgcg 300

gaacctcaaa agagtccctg gtgtgaagca agatcgctag aacacacctt acctgtaaac 360

agagagacac tgaaaaggaa ggttagtggg aaccgttgcg ccagccctgt tactggtcca 420

ggttcaaaga gggatgctca cttctgcgct gtctgcagcg attacgcatc gggatatcac 480

tatggagtct ggtcgtgtga aggatgtaag gcctttttta aaagaagcat tcaaggacat 540

aatgattata tttgtccagc tacaaatcag tgtacaatcg ataaaaaccg gcgcaagagc 600

tgccaggcct gccgacttcg gaagtgttac gaagtgggaa tggtgaagtg tggctcccgg 660

agagagagat gtgggtaccg ccttgtgcgg agacagagaa gtgccgacga gcagctgcac 720

tgtgccggca aggccaagag aagtggcggc cacgcgcccc gagtgcggga gctgctgctg 780

gacgccctga gccccgagca gctagtgctc accctcctgg aggctgagcc gccccatgtg 840

ctgatcagcc gccccagtgc gcccttcacc gaggcctcca tgatgatgtc cctgaccaag 900

ttggccgaca aggagttggt acacatgatc agctgggcca agaagattcc cggctttgtg 960

gagctcagcc tgttcgacca agtacggctc ttggagagct gttggatgga ggtgttaatg 1020

atggggctga tgtggcgctc aattgaccac cccggcaagc tcatctttgc tccagatctt 1080

gttctggaca gggatgaggg gaaatgcgta gaaggaattc tggaaatctt tgacatgctc 1140

ctggcaacta cttcaaggtt tcgagagtta aaactccaac acaaagaata tctctgtgtc 1200

aaggccatga tcctgctcaa ttccagtatg taccctctgg tcacagcgac ccaggatgct 1260

gacagcagcc ggaagctggc tcacttgctg aacgccgtga ccgatgcttt ggtttgggtg 1320

attgccaaga gcggcatctc ctcccagcag caatccatgc gcctggctaa cctcctgatg 1380

ctcctgtccc acgtcaggca tgcgagtaac aagggcatgg aacatctgct caacatgaag 1440

tgcaaaaatg tggtcccagt gtatgacctg ctgctggaga tgctgaatgc ccacgtgctt 1500

cgcgggtgca agtcctccat cacggggtcc gagtgcagcc cggcagagga cagtaaaagc 1560

aaagagggct cccagaaccc acagtctcag tga 1593

<210> 2

<211> 179

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 2

ggtaccatct aggtcacagt gacctgcgga tccgcaggtc actgtgacct agatccgcag 60

gtcactgtga cctagatctg atatcatcga tgaattcggg ctataaaagg gggtgggggg 120

agctcggccc tcattctgga gacggatcct ctagagtcga cctgcaggca tgcctcgag 179

<210> 3

<211> 8812

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 3

aacaaaatat taacgcttac aatttccatt cgccattcag gctgcgcaac tgttgggaag 60

ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 120

ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 180

gtgccaagct gatctataca ttgaatcaat attggcaatt agccatatta gtcattggtt 240

atatagcata aatcaatatt ggctattggc cattgcatac gttgtatcta tatcataata 300

tgtacattta tattggctca tgtccaatat gaccgccatg ttgacattga ttattgacta 360

gttattaata gtaatcaatt acggggtcat tagttcatag cccatatatg gagttccgcg 420

ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga 480

cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat 540

gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa 600

gtccgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca 660

tgaccttacg ggactttcct acttggcagt acatctacgt attagtcatc gctattacca 720

tggtgatgcg gttttggcag tacaccaatg ggcgtggata gcggtttgac tcacggggat 780

ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt ttggcaccaa aatcaacggg 840

actttccaaa atgtcgtaat aaccccgccc cgttgacgca aatgggcggt aggcgtgtac 900

ggtgggaggt ctatataagc agagctcgtt tagtgaaccg tcagaatttt gtaatacgac 960

tcactatagg gcggccggga attcgtcgac tggatccggt accgaggaga tctgccgccg 1020

cgatcgccgg cgcgccagat ctcaagcttc gccaccatgg atataaaaaa ctcaccatct 1080

agccttaatt ctccttcctc ctacaactgc agtcaatcca tcttacccct ggagcacggc 1140

tccatataca taccttcctc ctatgtagac agccaccatg aatatccagc catgacattc 1200

tatagccctg ctgtgatgaa ttacagcatt cccagcaatg tcactaactt ggaaggtggg 1260

cctggtcggc agaccacaag cccaaatgtg ttgtggccaa cacctgggca cctttctcct 1320

ttagtggtcc atcgccagtt atcacatctg tatgcggaac ctcaaaagag tccctggtgt 1380

gaagcaagat cgctagaaca caccttacct gtaaacagag agacactgaa aaggaaggtt 1440

agtgggaacc gttgcgccag ccctgttact ggtccaggtt caaagaggga tgctcacttc 1500

tgcgctgtct gcagcgatta cgcatcggga tatcactatg gagtctggtc gtgtgaagga 1560

tgtaaggcct tttttaaaag aagcattcaa ggacataatg attatatttg tccagctaca 1620

aatcagtgta caatcgataa aaaccggcgc aagagctgcc aggcctgccg acttcggaag 1680

tgttacgaag tgggaatggt gaagtgtggc tcccggagag agagatgtgg gtaccgcctt 1740

gtgcggagac agagaagtgc cgacgagcag ctgcactgtg ccggcaaggc caagagaagt 1800

ggcggccacg cgccccgagt gcgggagctg ctgctggacg ccctgagccc cgagcagcta 1860

gtgctcaccc tcctggaggc tgagccgccc catgtgctga tcagccgccc cagtgcgccc 1920

ttcaccgagg cctccatgat gatgtccctg accaagttgg ccgacaagga gttggtacac 1980

atgatcagct gggccaagaa gattcccggc tttgtggagc tcagcctgtt cgaccaagta 2040

cggctcttgg agagctgttg gatggaggtg ttaatgatgg ggctgatgtg gcgctcaatt 2100

gaccaccccg gcaagctcat ctttgctcca gatcttgttc tggacaggga tgaggggaaa 2160

tgcgtagaag gaattctgga aatctttgac atgctcctgg caactacttc aaggtttcga 2220

gagttaaaac tccaacacaa agaatatctc tgtgtcaagg ccatgatcct gctcaattcc 2280

agtatgtacc ctctggtcac agcgacccag gatgctgaca gcagccggaa gctggctcac 2340

ttgctgaacg ccgtgaccga tgctttggtt tgggtgattg ccaagagcgg catctcctcc 2400

cagcagcaat ccatgcgcct ggctaacctc ctgatgctcc tgtcccacgt caggcatgcg 2460

agtaacaagg gcatggaaca tctgctcaac atgaagtgca aaaatgtggt cccagtgtat 2520

gacctgctgc tggagatgct gaatgcccac gtgcttcgcg ggtgcaagtc ctccatcacg 2580

gggtccgagt gcagcccggc agaggacagt aaaagcaaag agggctccca gaacccacag 2640

tctcagtgaa gcggccgcga ctctagaatt cgcccctctc cctccccccc ccctaacgtt 2700

actggccgaa gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc 2760

atattgccgt cttttggcaa tgtgagggcc cggaaacctg gccctgtctt cttgacgagc 2820

attcctaggg gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag 2880

gaagcagttc ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg 2940

cagcggaacc ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg tgtataagat 3000

acacctgcaa aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga 3060

gtcaaatggc tctcctcaag cgtattcaac aaggggctga aggatgccca gaaggtaccc 3120

cattgtatgg gatctgatct ggggcctcgg tacacatgct ttacatgtgt ttagtcgagg 3180

ttaaaaaaac gtctaggccc cccgaaccac ggggacgtgg ttttcctttg aaaaacacga 3240

tgataatatg gccacagtta acctcgagat gagcgggggc gaggagctgt tcgccggcat 3300

cgtgcccgtg ctgatcgagc tggacggcga cgtgcacggc cacaagttca gcgtgcgcgg 3360

cgagggcgag ggcgacgccg actacggcaa gctggagatc aagttcatct gcaccaccgg 3420

caagctgccc gtgccctggc ccaccctggt gaccaccctc tgctacggca tccagtgctt 3480

cgcccgctac cccgagcaca tgaagatgaa cgacttcttc aagagcgcca tgcccgaggg 3540

ctacatccag gagcgcacca tccagttcca ggacgacggc aagtacaaga cccgcggcga 3600

ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca aggacttcaa 3660

ggaggacggc aacatcctgg gccacaagct ggagtacagc ttcaacagcc acaacgtgta 3720

catccgcccc gacaaggcca acaacggcct ggaggctaac ttcaagaccc gccacaacat 3780

cgagggcggc ggcgtgcagc tggccgacca ctaccagacc aacgtgcccc tgggcgacgg 3840

ccccgtgctg atccccatca accactacct gagcactcag accaagatca gcaaggaccg 3900

caacgaggcc cgcgaccaca tggtgctcct ggagtccttc agcgcctgct gccacaccca 3960

cggcatggac gagctgtaca ggtccggact cagataagtt taaacggccg gccgcggtca 4020

tagctgtttc ctgaacagat cccgggtggc atccctgtga cccctcccca gtgcctctcc 4080

tggccctgga agttgccact ccagtgccca ccagccttgt cctaataaaa ttaagttgca 4140

tcattttgtc tgactaggtg tccttctata atattatggg gtggaggggg gtggtatgga 4200

gcaaggggca agttgggaag acaacctgta gggcctgcgg ggtctattgg gaaccaagct 4260

ggagtgcagt ggcacaatct tggctcactg caatctccgc ctcctgggtt caagcgattc 4320

tcctgcctca gcctcccgag ttgttgggat tccaggcatg catgaccagg ctcagctaat 4380

ttttgttttt ttggtagaga cggggtttca ccatattggc caggctggtc tccaactcct 4440

aatctcaggt gatctaccca ccttggcctc ccaaattgct gggattacag gcgtgaacca 4500

ctgctccctt ccctgtcctt ctgattttaa aataactata ccagcaggag gacgtccaga 4560

cacagcatag gctacctggc catgcccaac cggtgggaca tttgagttgc ttgcttggca 4620

ctgtcctctc atgcgttggg tccactcagt agatgcctgt tgaattgggt acgcggccag 4680

cttggctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca 4740

gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct 4800

ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc 4860

ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg 4920

gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc 4980

agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc ccgggagctt 5040

gtatatccat tttcggatct gatcaagaga caggatgagg atcgtttcgc atgattgaac 5100

aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact 5160

gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc 5220

gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caggacgagg 5280

cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg 5340

tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt 5400

catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc 5460

atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag 5520

cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg 5580

ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac ggcgaggatc 5640

tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt 5700

ctggattcat cgactgtggc cggctgggtg tggccgaccg ctatcaggac atagcgttgg 5760

ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt 5820

acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct 5880

tctgagcggg actctggggt tcgaaatgac cgaccaagcg acgcccaacc tgccatcacg 5940

agatttcgat tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga 6000

cgccggctgg atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa 6060

cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa 6120

taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta 6180

tcatgtctgt ataccgtcga cctctagcta gagcttggcg taatcatggt catagctgtt 6240

tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 6300

gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 6360

gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 6420

ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 6480

ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 6540

cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 6600

gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 6660

tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 6720

ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 6780

atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 6840

gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 6900

tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 6960

cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 7020

cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt 7080

tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 7140

cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 7200

cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 7260

gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 7320

gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 7380

gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 7440

ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 7500

atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 7560

agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 7620

ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 7680

tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 7740

ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 7800

caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 7860

gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 7920

atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 7980

accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 8040

aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 8100

gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 8160

tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 8220

aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 8280

ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 8340

aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc 8400

attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 8460

agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 8520

tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 8580

ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 8640

ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 8700

aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 8760

ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt tt 8812

<210> 4

<211> 5686

<212> DNA

<213> Artificial sequence

<220>

<223>

<400> 4

taagtaatat taaggtacgg gaggtattgg acaggccgca ataaaatatc tttattttca 60

ttacatctgt gtgttggttt tttgtgtgaa tcgatagtac taacatacgc tctccatcaa 120

aacaaaacga aacaaaacaa actagcaaaa taggctgtcc ccagtgcaag tgcaggtgcc 180

agaacatttc tctggcctaa ctggccggta ccatctaggt cacagtgacc tgcggatccg 240

caggtcactg tgacctagat ccgcaggtca ctgtgaccta gatctgatat catcgatgaa 300

ttcgggctat aaaagggggt ggggggagct cggccctcat tctggagacg gatcctctag 360

agtcgacctg caggcatgcc tcgaggatat caagatctgg cctcggcggc caagcttggc 420

aatccggtac tgttggtaaa gccaccatgg aagatgccaa aaacattaag aagggcccag 480

cgccattcta cccactcgaa gacgggaccg ccggcgagca gctgcacaaa gccatgaagc 540

gctacgccct ggtgcccggc accatcgcct ttaccgacgc acatatcgag gtggacatta 600

cctacgccga gtacttcgag atgagcgttc ggctggcaga agctatgaag cgctatgggc 660

tgaatacaaa ccatcggatc gtggtgtgca gcgagaatag cttgcagttc ttcatgcccg 720

tgttgggtgc cctgttcatc ggtgtggctg tggccccagc taacgacatc tacaacgagc 780

gcgagctgct gaacagcatg ggcatcagcc agcccaccgt cgtattcgtg agcaagaaag 840

ggctgcaaaa gatcctcaac gtgcaaaaga agctaccgat catacaaaag atcatcatca 900

tggatagcaa gaccgactac cagggcttcc aaagcatgta caccttcgtg acttcccatt 960

tgccacccgg cttcaacgag tacgacttcg tgcccgagag cttcgaccgg gacaaaacca 1020

tcgccctgat catgaacagt agtggcagta ccggattgcc caagggcgta gccctaccgc 1080

accgcaccgc ttgtgtccga ttcagtcatg cccgcgaccc catcttcggc aaccagatca 1140

tccccgacac cgctatcctc agcgtggtgc catttcacca cggcttcggc atgttcacca 1200

cgctgggcta cttgatctgc ggctttcggg tcgtgctcat gtaccgcttc gaggaggagc 1260

tattcttgcg cagcttgcaa gactataaga ttcaatctgc cctgctggtg cccacactat 1320

ttagcttctt cgctaagagc actctcatcg acaagtacga cctaagcaac ttgcacgaga 1380

tcgccagcgg cggggcgccg ctcagcaagg aggtaggtga ggccgtggcc aaacgcttcc 1440

acctaccagg catccgccag ggctacggcc tgacagaaac aaccagcgcc attctgatca 1500

cccccgaagg ggacgacaag cctggcgcag taggcaaggt ggtgcccttc ttcgaggcta 1560

aggtggtgga cttggacacc ggtaagacac tgggtgtgaa ccagcgcggc gagctgtgcg 1620

tccgtggccc catgatcatg agcggctacg ttaacaaccc cgaggctaca aacgctctca 1680

tcgacaagga cggctggctg cacagcggcg acatcgccta ctgggacgag gacgagcact 1740

tcttcatcgt ggaccggctg aagagcctga tcaaatacaa gggctaccag gtagccccag 1800

ccgaactgga gagcatcctg ctgcaacacc ccaacatctt cgacgccggg gtcgccggcc 1860

tgcccgacga cgatgccggc gagctgcccg ccgcagtcgt cgtgctggaa cacggtaaaa 1920

ccatgaccga gaaggagatc gtggactatg tggccagcca ggttacaacc gccaagaagc 1980

tgcgcggtgg tgttgtgttc gtggacgagg tgcctaaagg actgaccggc aagttggacg 2040

cccgcaagat ccgcgagatt ctcattaagg ccaagaaggg cggcaagatc gccgtgaatt 2100

ctcacggctt ccctcccgag gtggaggagc aggccgccgg caccctgccc atgagctgcg 2160

cccaggagag cggcatggat agacaccctg ctgcttgcgc cagcgccagg atcaacgtct 2220

aaggccgcga ctctagagtc ggggcggccg gccgcttcga gcagacatga taagatacat 2280

tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat 2340

ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag ttaacaacaa 2400

caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt tttaaagcaa 2460

gtaaaacctc tacaaatgtg gtaaaatcga taaggatccg tttgcgtatt gggcgctctt 2520

ccgctgatct gcgcagcacc atggcctgaa ataacctctg aaagaggaac ttggttagct 2580

accttctgag gcggaaagaa ccagctgtgg aatgtgtgtc agttagggtg tggaaagtcc 2640

ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccagg 2700

tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag 2760

tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc gcccagttcc 2820

gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc 2880

tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct aggcttttgc 2940

aaaaagctcg attcttctga cactagcgcc accatgaccg agtacaagcc taccgtgcgc 3000

ctggccactc gcgatgatgt gccccgcgcc gtccgcactc tggccgccgc tttcgccgac 3060

taccccgcta cccggcacac cgtggacccc gaccggcaca tcgagcgtgt gacagagttg 3120

caggagctgt tcctgacccg cgtcgggctg gacatcggca aggtgtgggt agccgacgac 3180

ggcgcggccg tggccgtgtg gactaccccc gagagcgttg aggccggcgc cgtgttcgcc 3240

gagatcggcc cccgaatggc cgagctgagc ggcagccgcc tggccgccca gcagcaaatg 3300

gagggcctgc ttgcccccca tcgtcccaag gagcctgcct ggtttctggc cactgtagga 3360

gtgagccccg accaccaggg caagggcttg ggcagcgccg tcgtgttgcc cggcgtagag 3420

gccgccgaac gcgccggtgt gcccgccttt ctcgaaacaa gcgcaccaag aaaccttcca 3480

ttctacgagc gcctgggctt caccgtgacc gccgatgtcg aggtgcccga gggacctagg 3540

acctggtgta tgacacgaaa acctggcgcc taatgatcta gaaccggtca tggccgcaat 3600

aaaatatctt tattttcatt acatctgtgt gttggttttt tgtgtgttcg aactagatgc 3660

tgtcgaccga tgcccttgag agccttcaac ccagtcagct ccttccggtg ggcgcggggc 3720

atgactatcg tcgccgcact tatgactgtc ttctttatca tgcaactcgt aggacaggtg 3780

ccggcagcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 3840

gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 3900

cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 3960

gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 4020

aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 4080

ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 4140

cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 4200

ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 4260

cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 4320

agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 4380

gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct 4440

gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 4500

tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 4560

agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 4620

agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 4680

atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gcggccgcaa 4740

atgctaaacc actgcagtgg ttaccagtgc ttgatcagtg aggcaccgat ctcagcgatc 4800

tgcctatttc gttcgtccat agtggcctga ctccccgtcg tgtagatcac tacgattcgt 4860

gagggcttac catcaggccc cagcgcagca atgatgccgc gagagccgcg ttcaccggcc 4920

cccgatttgt cagcaatgaa ccagccagca gggagggccg agcgaagaag tggtcctgct 4980

actttgtccg cctccatcca gtctatgagc tgctgtcgtg atgctagagt aagaagttcg 5040

ccagtgagta gtttccgaag agttgtggcc attgctactg gcatcgtggt atcacgctcg 5100

tcgttcggta tggcttcgtt caactctggt tcccagcggt caagccgggt cacatgatca 5160

cccatattat gaagaaatgc agtcagctcc ttagggcctc cgatcgttgt cagaagtaag 5220

ttggccgcgg tgttgtcgct catggtaatg gcagcactac acaattctct taccgtcatg 5280

ccatccgtaa gatgcttttc cgtgaccggc gagtactcaa ccaagtcgtt ttgtgagtag 5340

tgtatacggc gaccaagctg ctcttgcccg gcgtctatac gggacaacac cgcgccacat 5400

agcagtactt tgaaagtgct catcatcggg aatcgttctt cggggcggaa agactcaagg 5460

atcttgccgc tattgagatc cagttcgata tagcccactc ttgcacccag ttgatcttca 5520

gcatctttta ctttcaccag cgtttcgggg tgtgcaaaaa caggcaagca aaatgccgca 5580

aagaagggaa tgagtgcgac acgaaaatgt tggatgctca tactcgtcct ttttcaatat 5640

tattgaagca tttatcaggg ttactagtac gtctctcaag gataag 5686

Claims

1. A method for constructing MDA-MB-231 cell line with estrogenic activity, comprising the steps of:

(c) Transfecting the pCMV-ESR2 into an MDA-MB-231 cell, and stably screening to obtain a cell strain MDA-MB-231-ESR2 which overexpresses ER beta gene and GFP fluorescent protein;

2. The method of claim 1, wherein in step (c) the overexpression plasmid pCMV-ESR2 is transfected into MDA-MB-231 cells using Lipofectamine 2000.

3. The method of claim 2, wherein in step (c) Lipofectamine 2000 is mixed with pCMV-ESR2 in a volume to mass ratio of 2.

4. The method of claim 1, wherein step (c) employs G418 for stable screening.

5. The method of claim 1, wherein step (d) is performed using puromycin for stability screening.

6. The MDA-MB-231 cell line having estrogenic activity prepared according to the method of any one of claims 1-5.

7. Use of the MDA-MB-231 cell line with estrogenic activity according to claim 6 for the detection of estrogenic compounds.

8. Use according to claim 7 for the detection of estrogenic compounds in cosmetic products.

9. Use according to claim 7 for the detection of 0.1-10 μ g of an oestrogen compound.