CN115505488A - Reciprocating type microfluidic PCR chip and use method and application thereof - Google Patents

Reciprocating type microfluidic PCR chip and use method and application thereof Download PDF

Info

Publication number
CN115505488A
CN115505488A CN202211378017.1A CN202211378017A CN115505488A CN 115505488 A CN115505488 A CN 115505488A CN 202211378017 A CN202211378017 A CN 202211378017A CN 115505488 A CN115505488 A CN 115505488A
Authority
CN
China
Prior art keywords
fluorescence detection
temperature zone
reaction
zone
temperature
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211378017.1A
Other languages
Chinese (zh)
Inventor
张弓
余卓
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Chi Biotech Co ltd
Original Assignee
Shenzhen Chi Biotech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Chi Biotech Co ltd filed Critical Shenzhen Chi Biotech Co ltd
Priority to CN202211378017.1A priority Critical patent/CN115505488A/en
Publication of CN115505488A publication Critical patent/CN115505488A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/502715—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip characterised by interfacing components, e.g. fluidic, electrical, optical or mechanical interfaces
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/50273—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip characterised by the means or forces applied to move the fluids
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/508—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above
    • B01L3/5085—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above for multiple samples, e.g. microtitration plates
    • B01L3/50851—Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above for multiple samples, e.g. microtitration plates specially adapted for heating or cooling samples
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/06—Fluid handling related problems
    • B01L2200/0694—Creating chemical gradients in a fluid
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00—Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/10—Integrating sample preparation and analysis in single entity, e.g. lab-on-a-chip concept
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/06—Auxiliary integrated devices, integrated components
    • B01L2300/0627—Sensor or part of a sensor is integrated
    • B01L2300/0654—Lenses; Optical fibres
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/16—Surface properties and coatings
    • B01L2300/168—Specific optical properties, e.g. reflective coatings
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/18—Means for temperature control
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/18—Means for temperature control
    • B01L2300/1805—Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks
    • B01L2300/1827—Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks using resistive heater
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00—Moving or stopping fluids
    • B01L2400/04—Moving fluids with specific forces or mechanical means
    • B01L2400/0475—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure
    • B01L2400/0487—Moving fluids with specific forces or mechanical means specific mechanical means and fluid pressure fluid pressure, pneumatics

Abstract

The application relates to the fields of biology, analytical chemistry and medical detection, in particular to a reciprocating microfluidic PCR chip and a using method and application thereof. The reciprocating type microfluidic PCR chip comprises a linear type reaction flow channel, gas chambers, a gas chamber temperature control device and a fluorescence detection device, wherein the gas chambers are positioned at two ends of the reaction flow channel and are communicated with fluid of the reaction flow channel; the linear reaction flow channel is provided with a sample adding port and comprises a first temperature zone, a second temperature zone and a fluorescence detection zone, the fluorescence detection zone is located between the first temperature zone and the second temperature zone, the reaction system completes a plurality of PCR thermal cycles through reciprocating movement among the first temperature zone, the fluorescence detection zone and the second temperature zone, the fluorescence detection device is configured to be aligned with the fluorescence detection zone, and when the reaction system passes through the fluorescence detection zone, the fluorescence detection device performs fluorescence detection on the reaction system.

Description

Reciprocating type microfluidic PCR chip and using method and application thereof
Technical Field
The application relates to the fields of biology, analytical chemistry and medical detection, in particular to a reciprocating type microfluidic PCR chip and a using method and application thereof.
Background
The Polymerase Chain Reaction (PCR) has a wide range of applications, it can exponentially amplify nucleic acids, and it is used in biology and medicine, especially in the field of nucleic acid detection. The current nucleic acid detection is convenient and fast, generally uses a real-time fluorescence PCR of a 96-hole/384-hole plate, but the instrument is heavy, the power consumption is very large, the movement and the deployment are difficult, a special PCR clean laboratory and professional personnel are required for operation, the cost is very high, the detection is more suitable for large batch detection, and the field rapid detection of a small amount of samples is difficult to realize. Meanwhile, PCR requires 95 ℃ denaturation, so that the PCR can not be directly operated in a plateau environment (the plateau pressure is low, and the boiling point of water is less than 95 ℃).
The microfluidic chip carries out the reaction in the flow channel, and solves the problem of easy environmental pollution, so that some on-chip PCR schemes are proposed. Among them, the bending flow channel type on-chip PCR scheme disclosed in patent application publication No. CN112680341A, which is easier to implement and lower in cost, is a scheme in which a reaction liquid is driven by the air pressure of a high-pressure gas cylinder to flow through a bending flow channel, and repeatedly passes between a 95 ℃ temperature zone and a 60 ℃ temperature zone, thereby completing an amplification thermal cycle. The high air pressure can ensure that the whole reaction system has enough pressure intensity, and further can directly run on plateau. However, this method also has its disadvantages: (1) The chip area is large, and about 4 x 7cm is needed at present, which brings about three problems that (1 a) the chip surface is covered with a plurality of heating areas with large range, and the chip has different temperatures, so that the chip made of plastic materials is easy to crack or bond to fail due to the expansion caused by heat and contraction caused by cold; (1 b) continued reduction in device size and power consumption is difficult; (1c) The width of the flow channel cannot be too narrow, otherwise, the surface tension is too large, the whole flow channel is very long, and the liquid can be driven by very large air pressure, so that higher requirements on chip materials and processes are provided, and the manufacturing cost is increased. (2) The excitation light is required to illuminate all cycles simultaneously, and the camera performs imaging to capture the fluorescence brightness of each cycle, which requires a more complicated optical system, increases the volume and cost of the system, and requires frequent calibration, which is inconvenient in use. (3) Parallel detection is difficult to carry out, and the problem caused by expansion with heat and contraction with cold is aggravated by the parallel design of a plurality of flow channels, so that bonding is easy to lose efficacy, and crosstalk is generated among different flow channels; and the widening of the distance between the flow channels enables only 2 parallel flow channels to be distributed on the chip, the parallelism is low, and a plurality of markers are difficult to detect simultaneously. (4) Because the temperature zone is fixed, if RT-PCR (for example, detection of new coronavirus) needs to be carried out for detecting RNA, the Reverse Transcription (RT) step usually needs 37-45 ℃, the temperature difference with the PCR is larger, the RT step needs to be completed outside a chip, and a manual operation step is added; or the special RT area of the chip is increased, so that the expansion and contraction caused by different temperature areas on a large chip are more severe. (5) The high-pressure gas cylinder is used as a consumable material, the use is troublesome, and the personal injury is possibly caused when the risk of bursting is avoided.
Disclosure of Invention
In order to solve the problems in the related art, the application provides a reciprocating microfluidic PCR chip and a using method and application thereof.
The reciprocating type micro-fluidic PCR chip solves the problems, can complete real-time fluorescent PCR in a straight short flow channel, and can support a full-automatic reverse transcriptase-polymerase chain reaction (RT-PCR) step without extra space.
In a first aspect, the invention provides a reciprocating type microfluidic PCR chip, which comprises a linear type reaction flow channel, gas chambers, a gas chamber temperature control device and a fluorescence detection device, wherein the gas chambers are positioned at two ends of the linear type reaction flow channel and are communicated with fluid of the linear type reaction flow channel; be provided with the sample loading port on the linear type reaction runner, linear type reaction runner includes first warm area, second warm area and fluorescence detection area, fluorescence detection area is located between first warm area and the second warm area, and the reaction system is through at first warm area, a plurality of thermal cycles that PCR was accomplished to reciprocating motion between fluorescence detection area and the second warm area, and fluorescence detection device configures to and aligns with the fluorescence detection area, and fluorescence detection device carries out fluorescence detection to the reaction system when the reaction system passes through the fluorescence detection area.
The reaction system is driven by the air pressure difference of the chambers at two sides and moves back and forth among the first temperature zone, the fluorescence detection zone and the second temperature zone. The air pressure of the two chambers is determined by the temperature controlled by the temperature control device. When the device needs to operate on plateau, the temperature of the gas chambers on two sides can be simultaneously increased to increase the gas pressure in the reaction flow channel, so that the boiling point is increased to more than 95 ℃, and the normal denaturation step can be ensured.
In some embodiments, the fluorescence detection device comprises an excitation light emitter and a fluorescence detector, and the excitation light emitter and the fluorescence detector are located on one side or two opposite sides of the linear reaction flow channel.
In some embodiments, the linear reaction channel further comprises a third temperature zone, and the reaction system performs a plurality of thermal cycles of PCR by reciprocating between the first temperature zone, the fluorescence detection zone, the second temperature zone, and the third temperature zone.
In some embodiments, the temperature of the first temperature zone is configured to be 50-72 ℃ and the temperature of the second temperature zone is configured to be 85-98 ℃.
In some embodiments, the temperature of the first temperature zone is configured to be 50-72 ℃, 51-71 ℃, 52-70 ℃, 53-69 ℃, 54-68 ℃, 55-67 ℃, 56-66 ℃, 57-65 ℃, 58-64 ℃, 59-63 ℃, 60-62 ℃, or 61 ℃, including any values and ranges therebetween.
In some embodiments, the temperature of the second temperature zone is configured to be 85-98 ℃, 86-97 ℃, 87-96 ℃, 88-95 ℃, 89-94 ℃, 90-93 ℃ or 91-92 ℃, including any values and ranges therebetween.
In some embodiments, the temperature of the third temperature zone is configured to be 50-72 ℃.
In some embodiments, the temperature of the third temperature zone is configured to be 50-72 ℃, 51-71 ℃, 52-70 ℃, 53-69 ℃, 54-68 ℃, 55-67 ℃, 56-66 ℃, 57-65 ℃, 58-64 ℃, 59-63 ℃, 60-62 ℃, or 61 ℃, including any values and ranges therebetween.
In some embodiments, the linear reaction flow channel is made of one or more materials selected from the group consisting of: polycarbonate, polyethylene, cyclic olefin copolymers and cyclic olefin polymers.
In some embodiments, the linear reaction flow channel has a cross-section selected from circular or rectangular, and the cross-section has an area of 0.005 to 0.15mm 2 。
In some embodiments, the cross-sectional area is 0.005 to 0.15mm 2 。
In some embodiments, the ratio of the length of the first temperature zone to the length of the second temperature zone is (0.2-6): 1.
in some embodiments, the length of the third temperature zone is configured to be equal to the length of the first temperature zone.
In some embodiments, the reaction flow channel can simultaneously accommodate one or more reaction systems to react simultaneously, with the reaction systems separated by mineral oil.
In some embodiments, the reaction flow channel can accommodate 1-5 reaction systems simultaneously.
In a second aspect, the present application provides a method of using the reciprocating microfluidic PCR chip of claim 1, comprising the steps of:
1) Injecting a reaction system into the linear reaction flow channel through the sample adding port;
2) Heating the temperature of the second temperature zone to 37-45 ℃, and moving the reaction system to the second temperature zone by adjusting the pressure in the gas chamber to perform reverse transcription reaction;
3) Rapidly heating the second temperature zone to 85-98 deg.C, and simultaneously heating the first temperature zone to 50-72 deg.C;
4) Controlling the reciprocating movement of the reaction system in the reaction flow channel by controlling the pressure in the gas chamber to complete a plurality of thermal cycles of the PCR; the fluorescence detection device detects the fluorescence of the reaction system when the reaction system passes through the fluorescence detection area.
In some embodiments, in step 2), the temperature of the second temperature zone is heated to 37-45 ℃, 38-44 ℃, 39-43 ℃, 40-42 ℃ or 41 ℃, including any values and ranges therebetween.
In some embodiments, in step 3), the second temperature zone is rapidly heated to 85-98 ℃, 86-97 ℃, 87-96 ℃, 88-95 ℃, 89-94 ℃, 90-93 ℃ or 91-92 ℃, including any values and ranges therebetween.
In some embodiments, in step 3), the first temperature zone is heated to 50-72 ℃, 51-71 ℃, 52-70 ℃, 53-69 ℃, 54-68 ℃, 55-67 ℃, 56-66 ℃, 57-65 ℃, 58-64 ℃, 59-63 ℃, 60-62 ℃ or 61 ℃, including any values and ranges therebetween.
In a third aspect, the present application provides a PCR detector comprising a reciprocating microfluidic PCR chip according to some embodiments of the present application.
In a fourth aspect, the present application provides the use of a reciprocating microfluidic PCR chip according to some embodiments of the present application in PCR detection.
In summary, the present application includes at least one of the following beneficial technical effects:
1. the reciprocating type microfluidic PCR chip enables the PCR reaction to be carried out on one short linear flow channel in a reciprocating mode, multiple PCR cycles can be completed, the equipment is small in size, low in energy consumption, flexible in use scene and convenient to carry, and the reciprocating type microfluidic PCR chip is suitable for detecting a single sample or a small amount of samples;
2. the reciprocating type microfluidic PCR chip can complete real-time fluorescent PCR in a linear short flow channel, and RT can be performed in a full-automatic manner by utilizing the second temperature zone, so that full-automatic seamless connection of RT and PCR can be realized, manual intervention is reduced, and a full-automatic RT-PCR step can be supported without extra space;
3. a high-pressure gas cylinder is not needed, the volume and the type of consumables are reduced, the cost is reduced, and the risk of explosion of the high-pressure gas cylinder is avoided;
4. because the liquid drops of each circulation PCR reaction system pass through the same place, a camera is not needed for shooting, and only simple point laser excitation and photodiode receiving are used, so that light paths and optical elements can be greatly reduced, the sensitivity and the signal-to-noise ratio are improved, the processing pressure of a single chip microcomputer is greatly reduced, and the volume and the cost of the elements are reduced.
Drawings
The following drawings are merely exemplary and are not limiting, and for clarity are not necessarily drawn to scale.
Fig. 1 is a sectional view of a reciprocating microfluidic PCR chip according to example 1 of the present application.
FIG. 2 is a cross-sectional view of a reciprocating microfluidic PCR chip according to example 2 of the present application.
FIG. 3 is a schematic view of a linear reaction channel including three reaction systems.
FIG. 4 is a graph showing the cycle number measured versus fluorescence value for the novel corona qRT-PCR assay of example 4.
FIG. 5 is a graph showing the cycle number and fluorescence value of the E.coli qPCR assay of example 5.
Description of the reference numerals: 1. reciprocating microfluidic PCR chips; 2. a linear reaction flow channel; 3. a gas chamber; 4. a gas chamber temperature control device; 5. a fluorescence detection device; 6. a sample addition port; 7. a first temperature zone; 8. a second temperature zone; 9. a fluorescence detection zone; 10. a reaction system; 11. an excitation light emitter; 12. a fluorescence detector; 13. a third temperature zone; 14. a first temperature zone temperature control device; 15. a second temperature zone temperature control device; 16. a third temperature zone temperature control device; 17. a mineral oil.
Detailed Description
The technical solution of the present application is further described in detail below with reference to the accompanying drawings and examples. The examples are not intended to limit the present application but merely to explain the present application.
The materials used in the examples are all commercially available unless otherwise specified. Where specific procedures, experimental conditions, and equipment or devices used are not indicated in the examples, one of ordinary skill in the art can perform the procedures, experimental conditions, equipment or devices according to the routine use in the art, which is within the scope of the present application.
Example 1
Referring to fig. 1, an embodiment 1 provides a reciprocating microfluidic PCR chip 1, including a linear reaction flow channel 2, a gas chamber 3 located at two ends of the linear reaction flow channel and in fluid communication with the linear reaction flow channel, a gas chamber temperature control device 4 arranged at the periphery of the gas chamber 3, and a fluorescence detection device 5; be provided with sample loading port 6 on linear type reaction runner 2, linear type reaction runner 2 includes first warm area 7, second warm area 8 and fluorescence detection zone 9, fluorescence detection zone 9 is located between first warm area 7 and second warm area 8, reaction system 10 is through at first warm area 7, a plurality of thermal cycles of PCR are accomplished to reciprocating motion between fluorescence detection zone 9 and the second warm area 8, fluorescence detection device 5 configures to and aligns with fluorescence detection zone 9, fluorescence detection device 5 carries out fluorescence detection to reaction system 10 when reaction system 10 passes through fluorescence detection zone 9.
The fluorescence detection means 9 comprises an excitation light emitter 11 and a fluorescence detector 12, and the excitation light emitter 11 and the fluorescence detector 12 are located on one side or opposite sides of the linear reaction flow channel 2. The excitation light emitter 11 and the fluorescence detector 12 are in an emission type light path when located at one side of the linear reaction flow channel 2, and the excitation light emitter 11 and the fluorescence detector 12 are in a transmission type light path when located at two opposite sides of the linear reaction flow channel 2.
The temperature of the first temperature zone 7 is configured to be 50-72 deg.C, 51-71 deg.C, 52-70 deg.C, 53-69 deg.C, 54-68 deg.C, 55-67 deg.C, 56-66 deg.C, 57-65 deg.C, 58-64 deg.C, 59-63 deg.C, 60-62 deg.C or 61 deg.C, including any value and range therebetween. The temperature of the second temperature zone 8 is configured to be 85-98 deg.C, 86-97 deg.C, 87-96 deg.C, 88-95 deg.C, 89-94 deg.C, 90-93 deg.C or 91-92 deg.C, including any values and ranges therebetween.
In this embodiment, the linear reaction channel 2 is made of one or more materials selected from the following materials: polycarbonate, polyethylene, cyclic olefin copolymers and cyclic olefin polymers.
The cross section of the linear reaction flow channel 2 is selected from a circle or a rectangle, and the area of the cross section is 0.005-0.15mm 2 。
The ratio of the length of the first temperature zone 7 to the length of the second temperature zone 8 is (0.2-6): 1.
alternatively, the linear reaction channel 2 may simultaneously accommodate one or more reaction systems 10 to be simultaneously reacted, and referring to fig. 3, fig. 3 shows that three reaction systems 10a, 10b and 10c are simultaneously present in the linear reaction channel 2, which are separated by the mineral oil 17.
After all the PCR reaction systems 10 are added, the sample adding port 6 is closed, the gas temperature change in the gas chambers 3 at two sides is used for driving the whole system to move left and right, and the whole system reciprocates in each temperature area to finish PCR circulation. During the PCR cycle, each PCR reaction system 10 passes through the fluorescence detection zone 9 in sequence, and the fluorescence intensity is detected by the fluorescence detector 12.
The working principle of the temperature control device of each temperature zone is as follows:
the PVC film resistor is used for heating, and a thermocouple or a digital temperature sensor (such as LM75, DS18B20 and the like) is used for measuring temperature and is controlled by the singlechip. When the temperature is higher than the set value, the resistance power supply is switched off to stop heating, and when the temperature is lower than the set value, the resistance power supply is switched on to continue heating, so that the set temperature is maintained.
It should be noted that, since the primers and the template to be detected inevitably remain in a very small amount on the wall of the flow channel and may enter other droplets, it is preferable that the primers of the plural PCR reaction systems 10 detected in series in the same flow channel are different from each other to avoid crosstalk. The different reaction system 10 droplets may be distinguished by different fluorescent colors, or the morphology of the droplets may be monitored using a camera to determine whether the several reaction systems 10 have passed through the detector.
Example 2
Referring to fig. 2, an embodiment 2 provides a reciprocating microfluidic PCR chip 1, which is a variation of the reciprocating microfluidic PCR chip 1 of the embodiment 1, and includes a linear reaction flow channel 2, a gas chamber 3 located at two ends of the linear reaction flow channel and in fluid communication with the linear reaction flow channel, a gas chamber temperature control device 4 disposed at the periphery of the gas chamber 3, and a fluorescence detection device 5; be provided with sample loading port 6 on linear type reaction runner 2, linear type reaction runner 2 includes first warm area 7, second warm area 8, third warm area 13 and fluorescence detection zone 9, fluorescence detection zone 9 is located between first warm area 7 and second warm area 8, reaction system 10 accomplishes a plurality of thermal cycles of PCR through at first warm area 7, fluorescence detection zone 9, reciprocating motion between second warm area 8 and the third warm area 13, fluorescence detection device 5 aligns with fluorescence detection zone 9, fluorescence detection device 5 carries out fluorescence detection to reaction system 10 when reaction system 10 passes through fluorescence detection zone 9.
The fluorescence detecting means 9 includes an excitation light emitter 11 and a fluorescence detector 12, and the excitation light emitter 11 and the fluorescence detector 12 are located on one side or opposite sides of the linear reaction flow channel 2. When the excitation light emitter 11 and the fluorescence detector 12 are located on one side of the linear reaction flow channel 2, the emission light emitter 11 and the fluorescence detector 12 are located on two opposite sides of the linear reaction flow channel 2, and the emission light emitter 11 and the fluorescence detector 12 are located on two opposite sides of the linear reaction flow channel 2.
The temperature of the first temperature zone 7 is configured to be 50-72 deg.C, 51-71 deg.C, 52-70 deg.C, 53-69 deg.C, 54-68 deg.C, 55-67 deg.C, 56-66 deg.C, 57-65 deg.C, 58-64 deg.C, 59-63 deg.C, 60-62 deg.C or 61 deg.C, including any value and range therebetween.
The temperature of the second temperature zone 8 is configured to be 85-98 deg.C, 86-97 deg.C, 87-96 deg.C, 88-95 deg.C, 89-94 deg.C, 90-93 deg.C or 91-92 deg.C, including any values and ranges therebetween.
The temperature of the third temperature zone 13 is configured to be 50-72 deg.C, 51-71 deg.C, 52-70 deg.C, 53-69 deg.C, 54-68 deg.C, 55-67 deg.C, 56-66 deg.C, 57-65 deg.C, 58-64 deg.C, 59-63 deg.C, 60-62 deg.C or 61 deg.C, including any value and range therebetween.
The structure in fig. 2 is a modification of the structure in embodiment 1, in which a third temperature zone 13 is added to the right side of the second temperature zone 8, and the temperature of the third temperature zone 13 is configured to be the same as that of the first temperature zone 7. In such a configuration, one cycle of reciprocation of the reaction system 10 may pass through two cycles during the reciprocation of the first temperature zone 7 to the third temperature zone 13. Because the reaction system 10 stays in the first temperature zone 7 and the third temperature zone 13 for a longer time in one cycle, and stays in the second temperature zone 8 for a shorter time, the design can enable the reaction system 10 to pass through the second temperature zone 8 linearly and rapidly without waiting for the temperature change of the temperature control device of the gas chamber 3, thereby effectively reducing the time and realizing the ultra-fast cycle of 15 seconds in one cycle.
The linear reaction flow channel 2 is made of one or more materials selected from the following materials: polycarbonate, polyethylene, cyclic olefin copolymers and cyclic olefin polymers.
The cross section of the linear reaction flow channel 2 is selected from a circle or a rectangle, and the area of the cross section is 0.005-0.15mm 2 。
The ratio of the length of the first temperature zone 7 to the length of the second temperature zone 8 is (0.2-6): 1.
the length of the third temperature zone 13 is configured to be equal to the length of the first temperature zone 7.
The linear reaction channel 2 can simultaneously accommodate one or more reaction systems 10 to react simultaneously, and referring to fig. 3, fig. 3 shows that three reaction systems 10a, 10b and 10c are simultaneously present in the linear reaction channel 2, and they are separated by mineral oil 17.
After all the PCR reaction systems 10 are added, the sample adding port 6 is closed, the gas temperature change in the gas chambers 3 at two sides drives the whole system to move left and right, and the whole system reciprocates in each temperature zone to complete the PCR cycle. During the PCR cycle, each PCR reaction system 10 passes through the fluorescence detection region 9 in turn, and the fluorescence intensity is detected by the fluorescence detector 12.
The working principle of the temperature control device of each temperature zone is as follows:
the PVC film resistor is used for heating, and a thermocouple or a digital temperature sensor (such as LM75, DS18B20 and the like) is used for measuring temperature and is controlled by the singlechip. When the temperature is higher than the set value, the resistance power supply is switched off to stop heating, and when the temperature is lower than the set value, the resistance power supply is switched on to continue heating, so that the set temperature is maintained.
It should be noted that, since the primers and the template to be detected inevitably remain in a very small amount on the wall of the flow channel and may enter other droplets, it is preferable that the primers of the plural PCR reaction systems 10 detected in series in the same flow channel are different from each other to avoid crosstalk. The different reaction system 10 droplets may be distinguished using different fluorescent colors or the morphology of the droplets may be monitored using a camera to determine if the several reaction system 10 passes the detector.
Example 3
The present embodiment provides a method for using a reciprocating microfluidic PCR chip 1, comprising the steps of:
1) Injecting the reaction system 10 into the linear reaction flow channel 2 through the sample adding port 6;
2) Heating the second temperature zone 8 to 37-45 ℃, and moving the reaction system 10 to the second temperature zone 8 by adjusting the pressure in the gas chamber 3 for reverse transcription;
3) Rapidly heating the second temperature zone 8 to 85-98 ℃, and simultaneously heating the first temperature zone 7 to 50-72 ℃;
4) Controlling the reciprocating movement of the reaction system 10 in the reaction flow channel by controlling the pressure in the gas chamber 3 to complete a plurality of thermal cycles of the PCR; the fluorescence detection means 5 detects fluorescence of the reaction system 10 when the reaction system 10 passes through the fluorescence detection zone 9.
In step 2), the second temperature zone 8 is heated to 37-45 ℃, 38-44 ℃, 39-43 ℃, 40-42 ℃ or 41 ℃, including any values and ranges therebetween.
In step 3), the second temperature zone 8 is rapidly heated to 85-98 deg.C, 86-97 deg.C, 87-96 deg.C, 88-95 deg.C, 89-94 deg.C, 90-93 deg.C, or 91-92 deg.C, including any values and ranges therebetween.
In step 3), the first temperature zone 7 is heated to 50-72 ℃, 51-71 ℃, 52-70 ℃, 53-69 ℃, 54-68 ℃, 55-67 ℃, 56-66 ℃, 57-65 ℃, 58-64 ℃, 59-63 ℃, 60-62 ℃ or 61 ℃, including any values and ranges therebetween.
If the third temperature range 13 is present, the temperature setting of the third temperature range 13 is synchronized with the first temperature range 7.
It is noted that step 2) may be omitted if the detection does not require a reverse transcription step.
Example 4: new corona qRT-PCR assay
Detecting the target artificial synthesized new coronavirus (SARS-COV-2) N gene full length RNA, and simulating the extracted new coronavirus genome.
Samples of virus N gene, sample 1 and sample 2, were prepared, both at different dilution times of virus N gene, with the concentration of sample 1 being about 100 times higher than sample 2, and NC being a blank (water). The primer adopts the following steps: f, GGGGAACTTCCTGCTAGAAT, and R, CAGACATTTTTTGCTCATCAAGCTG. The reverse transcriptase adopts NEB Protoscript II, and the PCR mix adopts NEB SYBR Green Supermix.
The method for detecting the virus N by using the reciprocating microfluidic PCR chip 1 described in the embodiment 1 comprises the following steps:
1) Respectively injecting a sample 1, a sample 2 and a blank control (NC) into the three linear reaction flow channels 2 through the sample injection port 6;
2) Heating the second temperature zone 8 to 37 ℃, moving the sample 1, the sample 2 and a blank control (NC) to the second temperature zone 8 by adjusting the pressure of the gas chamber 3 to perform a reverse transcription reaction for 15 minutes;
3) The second temperature zone 8 is rapidly heated to 95 ℃ for 5 minutes to inactivate the reverse transcriptase and simultaneously perform the initial denaturation phase of the PCR; simultaneously heating the first temperature zone 7 to 60 ℃;
4) Controlling the reciprocating movement of the sample 1, the sample 2 and the blank control (NC) in the reaction flow channel by controlling the pressure of the gas in the gas chamber 3 to complete a plurality of thermal cycles of PCR; in each PCR cycle, 95 ℃ lasted 30 seconds, 60 ℃ lasted 60 seconds. The fluorescence detection device 5 detects fluorescence of sample 1, sample 2 and blank control (NC) as they pass through the fluorescence detection zone 9, and records fluorescence values from cycle 12 onward. The results are shown in FIG. 4.
From FIG. 4, it can be seen that new coronavirus RNA was detected in both sample 1 and sample 2, and the concentration of sample 1 was about 100 times higher than that of sample 2 (close to the difference of 7 Ct values), which was not detected in the blank control.
Example 5: coli qPCR detection
The genomic DNA of E.coli K-12 BW25113 strain was detected as a target.
A sample of genomic DNA of E.coli K-12 BW25113 strain was prepared, sample 1, NC is blank (water). The primer adopts the following steps: f is GCCTCGCCTGGAGAATGA, and R is CCTGAGACTGCGGTGGAA. The PCR mix used NEB SYBR Green Supermix.
The method for detecting the genome DNA of the Escherichia coli K-12 BW25113 strain by using the reciprocating microfluidic PCR chip 1 described in the embodiment 1 comprises the following steps:
1) Respectively injecting a sample 1 and a blank control (NC) into three linear reaction flow channels 2 through a sample injection port 6;
2) The second temperature zone 8 is heated to 95 ℃ to carry out the initial denaturation reaction of the PCR; simultaneously heating the first temperature zone 7 to 60 ℃;
3) Controlling the reciprocating movement of the sample 1 and the blank control (NC) in the reaction flow channel by controlling the pressure of the gas in the gas chamber 3 to complete a plurality of thermal cycles of PCR; in each PCR cycle, 95 ℃ lasted 30 seconds, 60 ℃ lasted 75 seconds. The fluorescence detection device 5 detects the fluorescence of the sample 1 and the blank control (NC) as they pass through the fluorescence detection zone 9, and records the fluorescence values from the 12 th cycle onward. The results are shown in FIG. 5.
It can be seen from the figure that E.coli could be detected from the sample, but not from the blank.
The specific embodiments are only for explaining the present application and are not limiting to the present application, and those skilled in the art can make modifications to the embodiments without inventive contribution as required after reading the present specification, but all the embodiments are protected by patent law within the scope of the claims of the present application.

Claims (10)

1. A reciprocating microfluidic PCR chip (1) is characterized in that: the device comprises a linear reaction flow channel (2), gas chambers (3) which are positioned at two ends of the linear reaction flow channel and are communicated with the linear reaction flow channel, a gas chamber temperature control device (4) arranged at the periphery of the gas chambers (3), and a fluorescence detection device (5); be provided with sample injection port (6) on linear type reaction runner (2), linear type reaction runner (2) are including first warm-area (7), second warm-area (8) and fluorescence detection zone (9), fluorescence detection zone (9) are located first warm-area (7) with between second warm-area (8), reaction system (10) through first warm-area (7) fluorescence detection zone (9) with reciprocating motion accomplishes a plurality of thermal cycles of PCR between second warm-area (8), fluorescence detection device (5) configure into with fluorescence detection zone (9) aim at, pass through as reaction system (10) fluorescence detection zone (9) time fluorescence detection device (5) are right reaction system (10) carry out fluorescence detection.
2. A reciprocating microfluidic PCR chip (1) according to claim 1, characterized in that: the fluorescence detection device comprises an excitation light emitter (11) and a fluorescence detector (12), wherein the excitation light emitter (11) and the fluorescence detector (12) are positioned on one side or two opposite sides of the linear reaction flow channel (2).
3. A reciprocating microfluidic PCR chip (1) according to claim 1, characterized in that: the linear reaction flow channel (2) further comprises a third temperature zone (13), and the reaction system (10) completes a plurality of thermal cycles of PCR through reciprocating movement among the first temperature zone (7), the fluorescence detection zone (9), the second temperature zone (8) and the third temperature zone (13).
4. The reciprocating microfluidic PCR chip (1) according to claim 3, characterized in that: the temperature of the first temperature zone (7) is set to be 50-72 ℃; the temperature of the second temperature zone (8) is configured to be 85-98 ℃; the temperature of the third temperature zone (13) is configured to be 50-72 ℃.
5. The reciprocating microfluidic PCR chip (1) according to any of claims 1-4, characterized in that: the ratio of the length of the first temperature zone (7) to the length of the second temperature zone (8) is (0.2-6): 1.
6. the reciprocating microfluidic PCR chip (1) according to claim 5, wherein: the length of the third temperature zone (13) is configured to be equal to the length of the first temperature zone (7).
7. The reciprocating microfluidic PCR chip (1) according to any of claims 1-4, characterized in that: the reaction flow channel can simultaneously accommodate one or more reaction systems (10) to react simultaneously, and the reaction systems (10) are separated by mineral oil (17).
8. A method of using a reciprocating microfluidic PCR chip (1) according to claim 1 or 2, characterized in that: the method comprises the following steps:
1) Injecting the reaction system (10) into the linear reaction flow channel (2) through the sample adding port (6);
2) Heating the temperature of the second temperature zone (8) to 37-45 ℃, and moving the reaction system (10) to the second temperature zone (8) by adjusting the pressure in the gas chamber (3) to perform a reverse transcription reaction;
3) Rapidly heating the second temperature zone (8) to 85-98 ℃, and simultaneously heating the first temperature zone (7) to 50-72 ℃;
4) Controlling the reciprocating movement of the reaction system (10) in the linear reaction flow channel by controlling the pressure in the gas chamber (3) to complete a plurality of thermal cycles of PCR; the fluorescence detection device (5) performs fluorescence detection on the reaction system (10) when the reaction system (10) passes through the fluorescence detection area (9).
9. A PCR detector is characterized in that: comprising a reciprocating microfluidic PCR chip (1) according to any of the claims 1 to 7.
10. Use of a reciprocating microfluidic PCR chip (1) according to any of the claims 1 to 7 in PCR detection.
CN202211378017.1A 2022-11-04 2022-11-04 Reciprocating type microfluidic PCR chip and use method and application thereof Pending CN115505488A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211378017.1A CN115505488A (en) 2022-11-04 2022-11-04 Reciprocating type microfluidic PCR chip and use method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211378017.1A CN115505488A (en) 2022-11-04 2022-11-04 Reciprocating type microfluidic PCR chip and use method and application thereof

Publications (1)

Publication Number Publication Date
CN115505488A true CN115505488A (en) 2022-12-23

Family

ID=84513258

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211378017.1A Pending CN115505488A (en) 2022-11-04 2022-11-04 Reciprocating type microfluidic PCR chip and use method and application thereof

Country Status (1)

Country Link
CN (1) CN115505488A (en)

Similar Documents

Publication Publication Date Title
US11781181B2 (en) Nucleic acid amplification device, nucleic acid amplification method, and chip for nucleic acid amplification
US6660228B1 (en) Apparatus for performing heat-exchanging, chemical reactions
CN109844091B (en) Reaction processing container and reaction processing device
CN102199529A (en) Biochip hybridization system
EP3239288B1 (en) Pcr apparatus comprising sliding means
CN101679932A (en) Digital microfluidics based apparatus for heat-exchanging chemical processes
US20120295341A1 (en) Thermal treatment apparatus and fluid treatment method with fluidic device
Qiu et al. A large volume, portable, real-time PCR reactor
KR20170074662A (en) Gene Diagnostic Apparatus
US10245590B2 (en) High-speed real-time PCR device based on lab-on-a-chip for detecting food-borne bacteria to agrifood, and methods for detecting food-borne bacteria to agrifood using the same
CN115505488A (en) Reciprocating type microfluidic PCR chip and use method and application thereof
US20210053059A1 (en) High-speed polymerase chain reaction analysis plate
CN115747040A (en) Reciprocating type multi-channel PCR chip and using method and application thereof
CN111500436B (en) Reaction treatment vessel
JP2020198867A (en) Reaction processing vessel
KR101544089B1 (en) Micro chip for detecting food-borne bacteria, real-time PCR device comprising the same, and method for detecting food-borne bacteria using the same
KR20130081948A (en) Kit and method for detecting new influenza a virus
WO2020129116A1 (en) Reaction treatment device, reaction treatment vessel, and reaction treatment method
US20230285977A1 (en) Nucleic acid amplification device, nucleic acid amplification method, and sample solution position control method
US20220145360A1 (en) Nucleic acid amplification method
CN118006456A (en) Continuous digital PCR device and system
Sayers et al. A real-time continuous flow polymerase chain reactor for DNA expression quantification
IE84897B1 (en) A microfluidic analysis system

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination