KR20130081948A - Kit and method for detecting new influenza a virus - Google Patents

Kit and method for detecting new influenza a virus Download PDF

Info

Publication number
KR20130081948A
KR20130081948A KR1020120003075A KR20120003075A KR20130081948A KR 20130081948 A KR20130081948 A KR 20130081948A KR 1020120003075 A KR1020120003075 A KR 1020120003075A KR 20120003075 A KR20120003075 A KR 20120003075A KR 20130081948 A KR20130081948 A KR 20130081948A
Authority
KR
South Korea
Prior art keywords
syto
pcr
light
virus
influenza
Prior art date
Application number
KR1020120003075A
Other languages
Korean (ko)
Inventor
김성우
김선진
이동훈
김덕중
류호선
Original Assignee
나노바이오시스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 나노바이오시스 주식회사 filed Critical 나노바이오시스 주식회사
Priority to KR1020120003075A priority Critical patent/KR20130081948A/en
Publication of KR20130081948A publication Critical patent/KR20130081948A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes

Abstract

The present invention relates to a kit for detecting influenza and a method for simultaneously detecting several types of influenza using the same. Using the kit for detecting influenza according to one embodiment, it is possible to efficiently detect several kinds of swine flu simultaneously.

Description

Kit for detecting influenza A virus and method for detecting influenza A virus using the same {Kit and method for detecting new influenza A virus}

The present invention relates to a kit for influenza A virus detection and a method for detecting influenza A virus in real time using the same.

Since influenza A virus spreads rapidly through the respiratory tract mainly due to coughing or sneezing of an infected person, there is a need for a method for quickly and economically confirming the presence of influenza A virus in order to prevent the spread of rapid disease. Representative diagnostic methods of influenza A virus infection include commercially available enzyme immuno-assay (EIA), which detects antibodies that bind to recombinant influenza A virus proteins or peptides. Although immunological methods using antibodies can diagnose diseases with high accuracy, a large amount of samples are required, and in order to produce antibodies for each diagnosis, it is essential to produce proteins or peptides of viruses characteristic of all diseases. High antibody production costs are required. In addition, due to the nature of the protein, there are many difficulties in storage and use, and only one type or limited type of disease can be diagnosed at a time. Other methods include diagnosing diseases using cell cultures and DNA probes, but they all require a high level of skill and time. In order to remedy this drawback, various disease diagnosis kits using the PCR method have begun to be researched and developed. Diagnostic kits using PCR methods are increasing in demand in various fields due to their high accuracy, simplicity and rapidity.

In particular, the real-time PCR method, which is widely used in recent years, is a method to observe the increase of the PCR amplification product in real time in every cycle of the PCR and to detect and quantify the fluorescent substance reacting with the PCR amplification product. This method eliminates the need for additional electrophoresis, has excellent accuracy and sensitivity, has high recall, and can be automated, as compared with conventional PCR method after completion of the final step and staining on gel to confirm PCR amplification products after electrophoresis And the result can be quantified, and it is quick and easy, and it is excellent in biological safety due to harmful problems such as contamination by EtBr (Ethidium Bromide) and irradiation with ultraviolet ray, and it is possible to automatically check whether the specific gene is amplified There are advantages. Thus, quantitative results with high specificity, not qualitative results such as PCR or antigen / antibody, can be identified through real-time PCR methods. In addition, since the probe labeled with a fluorescent marker is used, the result can be confirmed even with a sample smaller than the amount of the sample used for the DNA chip or the antigen / antibody reaction.

Therefore, there is a need for the development of a method for detecting influenza A virus and a detection kit using a real-time PCR method in order to quickly and accurately diagnose the influenza A virus in a sample.

One embodiment is to provide a kit for influenza A virus detection comprising a primer set for detecting several types of influenza A virus in a PCR chip.

Another embodiment provides a method for detecting influenza A virus in real time using a kit for influenza A virus detection.

An aspect includes a first plate; A second plate disposed at an upper portion of the first plate and having at least one through-opening channel; And a third plate disposed on the upper portion of the second plate and having a through-hole inlet formed in one region of each of the at least one through-hole opening channel and a through-hole outlet portion formed in another region of the at least one through- In the at least one through-aperture channel,

(a) Matrix gene of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 1 and a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: GenBank ID number: GQ131025) set of primers for detecting;

(b) Hemagglutinin of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides in SEQ ID NO: 3 and a primer comprising at least 15 consecutive nucleotides in SEQ ID NO: 4 ) Primer set for detecting gene (GenBank ID number: GQ131023);

(c) Neuraminidase of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 5 and a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 6 A kit for detecting influenza A virus, each kit comprising at least one primer set selected from the group consisting of a primer set for detecting a gene (GenBank ID number: GQ1312185).

The term primer is a single stranded oligonucleotide that can serve as an initiation of template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers at suitable temperatures. Means. Suitable lengths of primers are typically 15 to 30 nucleotides, although varying depending on various factors, such as temperature and the use of the primer. Short primers may generally require lower temperatures to form a hybridization complex that is sufficiently stable with the template. The terms " forward primer "and" reverse primer "refer to primers that bind respectively to the 3 'and 5' ends of a constant region of a template amplified by a polymerase chain reaction. The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer set according to one embodiment does not need to have a perfectly complementary sequence to a nucleotide sequence that is a template, and it is interpreted that sufficient complementarity within a range capable of hybridizing to the nucleotide sequence and acting as a primer is sufficient. The design of such a primer can be easily carried out by those skilled in the art with reference to the nucleotide sequence of a polynucleotide to be a template. For example, a primer design program (for example, PRIMER 3, VectorNTI program) have. On the other hand, the primer according to one embodiment is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions for nucleic acid hybridization suitable for forming such double chain structures are described in Joseph Sambrook, et al., Molecular . Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985). For example, the primer may comprise at least 10 or at least 15 contiguous nucleotides in any one of SEQ ID NO: 1 to SEQ ID NO: 6, wherein the primer is selected from SEQ ID NO: 1 to SEQ ID NO: 6 It may be an oligonucleotide having either base sequence.

According to one embodiment, the at least one primer set comprises a first plate; A second plate disposed at an upper portion of the first plate and having at least one through-opening channel; And a third plate disposed on the upper portion of the second plate and having a through-hole inlet formed in one region of each of the at least one through-hole opening channel and a through-hole outlet portion formed in another region of the at least one through- Is included in the at least one through-aperture channel. For example, if a PCR chip for simultaneously detecting 15 types of primers is prepared, a PCR chip can be fabricated so that a total of 17 through-opening channels are included in the PCR chip, including a positive control group and a negative control group. Meanwhile, according to one embodiment, the PCR chip may be implemented with a light-transmitting material.

According to one embodiment, the first plate and the third plate are made of a material selected from the group consisting of polydimethylsiloxane, cycle olefin copolymer, polymethylmetharcylate, polycarbonate, polypropylene Wherein the second plate is made of a material selected from the group consisting of polypropylene carbonate, polyether sulfone, and polyethylene terephthalate and combinations thereof, and the second plate is made of a material selected from the group consisting of polymethyl methacrylate, polycarbonate, Polyamide, polyethylene, polypropylene, polyphenylene ether, polystyrene, polyoxymethylene, polyetheretherketone, polyetheretherketone, polyetheretherketone, polyetheretherketone, , Polytetrafluoroethylene, polytetrafluoroethylene, Selected from the group consisting of polyvinylchloride, polyvinylidene fluoride, polybutyleneterephthalate, fluorinated ethylenepropylene, perfluoralkoxyalkane, and combinations thereof. Or a thermosetting resin or a thermosetting resin material.

According to one embodiment, the through opening inlet of the third plate is from 0.01 mm to 10 mm in diameter, the through opening outlet is from 0.01 mm to 10 mm in diameter, and the thickness of the third plate is from 0.05 mm to 5 mm, The thickness of the second plate may be 10 μm to 1000 μm, the width of the through opening channel may be 0.01 mm to 10 mm, and the length of the through opening channel may be 10 mm to 100 mm.

According to one embodiment, the through-hole inlet portion of the third plate is 1.0 mm to 3.0 mm in diameter, the through-hole outlet portion has a diameter of 1.0 mm to 1.5 mm, the third plate has a thickness of 0.1 mm to 2 mm, Wherein the thickness of the second plate is 100 占 퐉 to 200 占 퐉, the width of the through-hole opening channel is 0.5 mm to 3 mm, and the length of the through-hole opening channel is 20 mm to 60 mm.

This can be controlled according to the amount of the PCR reaction solution contained in the through-hole opening channel.

According to one embodiment, the influenza A virus detectable from the kit may be, for example, but not limited to, influenza A virus subtype H1N1.

According to one embodiment, the kit may further comprise a mixture comprising dATP, dCTP, dGTP and dTTP, a DNA polymerase and a detectable label inside the through-channel. The DNA polymerase is for example Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus Heat stable DNA polymerase obtained from (Pfu).

 The term "detectable label" refers to an atom or molecule that specifically detects a molecule containing a label, among molecules of the same type without a label, such detectable labels being, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 660, Alexa Fluor 680, Cy2, Cy3.18, Cy3.5, Cy3.5, Alexa Fluor 430, Cy3, Cy5.18, Cy5.5, Cy5, Cy7, Oregon Green, Oregon Green 488-X, Oregon Green, Oregon Green 488, Oregon Green 500, Oregon Green 514, SYTO 11, SYTO 12, SYTO 13, SYTO 14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, SYTO 40, SYTO 41, SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59 SYTOX Blue, SYTOX Green, SYTOX Orange, SYBR Green, YO-PRO-100, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, 1, YO-PRO-3, YOYO-1, YOYO-3 and thiazo le orange), but the present invention is not limited thereto. In addition, the kit may include a buffer solution in the through-channel. Buffer solutions are compounds that are added to an amplification reaction that modifies the stability, activity, and / or lifetime of one or more components of the amplification reaction by modulating the pH of the amplification reaction. Such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES. In addition, the kit may comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP) and a DNA polymerase joiner.

According to one embodiment, the PCR chip may have two or more through opening channels, specifically, two or more through 17 or less through opening channels, which may be arbitrarily selected according to the type of influenza A virus or gene to be detected. Controllability is as described above.

Another aspect includes injecting a subject sample suspected of being infected with influenza A virus into one or more through opening inlets of the kit to perform real time PCR; And it provides a real-time detection method of influenza A virus comprising the step of confirming the presence or absence of influenza A virus in the target sample from the real-time PCR results.

The real-time detection method of the influenza A virus will be described in detail for each step as follows.

First, the method may be performed by injecting a target sample suspected of influenza A virus infection into one or more through-opening inlets of the kit to perform real-time PCR. In this step, the target sample suspected of influenza A virus infection may be first synthesized cDNA from the RNA of the sample. Since influenza viruses are viruses with RNA in the genome, reverse transcription is performed from the genomic RNA of the virus, from which the cDNA is synthesized, in order to obtain the template necessary for performing PCR to detect it. Reverse transcription reactions can be carried out using a variety of reverse transcriptase enzymes well known in the art, for example reverse transcriptase enzymes such as Invtrogen's SuperScript series and kits comprising the same. Thereafter, the synthesized cDNA may be injected into one or more through opening inlets of the kit to perform real-time PCR.

According to one embodiment, the real time PCR may be performed in a PCR device comprising a thermal block, a light transmissive column block, or two column blocks, respectively. The PCR device including the light-transmitting thermal block or two thermal blocks is manufactured by the present inventor and can perform real-time PCR, and a detailed description of the device will be given later.

The detection method according to one embodiment may be applied to a sample that is expected to be infected with influenza A virus. The sample includes, but is not limited to, bodily fluids such as cultured cells, blood, saliva, and the like.

According to one embodiment, the real-time PCR reaction can be performed using a real-time PCR apparatus developed by the present inventor. The real-time PCR method is a method for detecting and quantifying fluorescence which appears in real time every PCR cycle by the principle of DNA polymerase and FRET using a device in which a thermal cycler and a spectrophotometer are integrated. This method can distinguish specific amplification products from nonspecific amplification products and can easily obtain the results in an automated manner. In the method for detecting influenza A virus according to one embodiment, the real-time PCR reaction may be carried out under conventional conditions known in the art, for example, initial denaturation was performed at 95 ° C. for 10 minutes. After that, denaturation may be performed at 95 ° C. for 5 seconds, and annealing and elongation of the primer are performed 30 times at 72 ° C. for 20 seconds in total.

Finally, the presence or absence of influenza A virus in the target sample may be included from the real-time PCR result.

The presence or absence of the influenza A virus is C t, which is the number of cycles when a certain amount of PCR amplification products is amplified from a curve displayed by detecting a fluorescent labeling agent labeled on the PCR product amplified in the real time PCR process. Can be confirmed by calculating a value. The C t The calculation of the value can be performed automatically by the program included in the real-time PCR device.

According to one embodiment, the influenza A virus may be, but is not limited to, influenza A virus subtype H1N1.

Using an influenza A virus detection kit according to one embodiment, it is possible to detect influenza A virus in real time.

1 shows a light transmissive column block included in a PCR device according to an embodiment of the present invention.
Figure 2a shows the thermal distribution of the thermal block included in the conventional PCR device.
Figure 2B shows the thermal distribution of the light transmissive thermal block included in the PCR device according to one embodiment of the present invention.
FIG. 2C shows a temperature change with time of the light-transmitting thermal block included in the PCR apparatus according to an embodiment of the present invention.
FIG. 3A shows a light-transmitting thermal block included in a PCR apparatus according to an embodiment of the present invention in which a light absorbing layer is disposed in contact with a lower surface of a substrate, FIG. 3B illustrates a light- FIG. 3C shows a light-transmissive thermal block included in the PCR device according to one embodiment of the present invention. FIG. 3C is a schematic view of a light- Transparent antistatic layer included in the PCR device according to one embodiment of the present invention in which a light reflection preventing layer for contacting the light blocking layer is disposed in contact with the upper portion of the insulating protective layer.
4 shows that a PCR chip is arranged on a light-transmissive column block of a PCR apparatus according to an embodiment of the present invention including a light-providing portion and a light detecting portion.
Figure 5 shows the light providing portion of the PCR device according to one embodiment of the present invention in more detail.
FIG. 6 shows the optical detector of the PCR apparatus according to one embodiment of the present invention in more detail.
Figure 7 shows the optical path by a dichroic filter included in a PCR device according to one embodiment of the present invention.
8 shows a cross section of a light-transmitting PCR chip according to another embodiment of the present invention.
9 shows a cross section of a light-transmitting PCR chip according to another embodiment of the present invention in which a double-sided adhesive or a thermoplastic resin or a thermosetting resin is treated.
Figure 10 shows a PCR device comprising two column blocks according to another embodiment of the present invention.
11 shows each step of nucleic acid amplification reaction by movement of a chip holder of a PCR apparatus including two column blocks according to another embodiment of the present invention.
FIG. 12 shows a step of observing a nucleic acid amplification reaction in real time using a PCR apparatus including two column blocks according to another embodiment of the present invention.
13 is a matrix gene (GenBank ID number: GQ131025), hemagglutinin gene (GenBank ID number: GQ131023) and neurami using the kit for influenza A virus according to one embodiment of the present invention. The results of the simultaneous detection of the Neuraminidase gene (GenBank ID number: GQ1312185) are shown.

Hereinafter, one or more embodiments will be described in more detail by way of examples. However, these embodiments are intended to illustrate one or more embodiments, and the scope of the invention is not limited to these embodiments.

1 shows a light-transmissive thermal block 100 included in a PCR device according to an embodiment of the present invention.

A PCR apparatus according to an embodiment of the present invention includes a substrate 10, a heating layer 20 including conductive nanoparticles disposed on the substrate 10, an insulating protective layer 30 disposed on the heating layer, And a light-transmissive thermal block (100) having an electrode (40) connected to the heating layer, wherein the upper surface of the light-transmissive thermal block includes a contact portion (50) of the PCR chip in at least a part of the region.

The substrate 10 may be a light-transmissive plate material, and may be a light-transmissive glass or a light-transmitting plastic material. Although the substrate 10 is shown as a flat plate according to FIG. 1, it may have various shapes such as a semi-cylindrical shape and a hemispherical shape. In addition, the substrate 10 supports the heat generating layer 20.

The heating layer 20 serves as a heat source for the optically transparent thermal block 100 for performing the denaturation step of the PCR, the annealing step, and the extension (or amplification) step. The heating layer 20 is disposed on the substrate 10 and includes conductive nanoparticles (not shown). The conductive nanoparticle may be an oxide semiconductor material or a material to which an impurity selected from the group consisting of In, Sb, Al, Ga, C, and Sn is added to the oxide semiconductor material. In addition, the heat generating layer 20 may have a loose texture structure in which the conductive nanoparticles are physically linked to each other, and may generate a close-packed texture according to heat treatment conditions of a manufacturing process. It may also have a complete film state. In addition, since the conductive nanoparticles are dispersed in the solvent, the conductive nanoparticles can be easily laminated on the substrate 10, so that the thickness of the heating layer 20 can be easily controlled by controlling the number of layers . In addition, the conductivity of the heating layer 20 can be easily controlled by adjusting the concentration of the dispersion containing the conductive nanoparticles. An adhesion strengthening layer (not shown) may be formed between the substrate 10 and the heating layer 20 to strongly fix the heating layer 20 to the substrate 10. The adhesion reinforcing layer may be formed of silica or a polymer, may include conductive nanoparticles may also play the same role as the heating layer. In addition, the heating layer 20 may be transparent. For example, when the visible light ray has a wavelength of 400 to 700 nm and the heat generating layer including the conductive nanoparticles is formed to have a thickness of 1/4 or less of such a wavelength, for example, about 100 nm or less, .

The insulating protection layer 30 is for protecting the heating layer 20 physically and / or electrically, and may include an insulating material. For example, the insulating material may be selected from the group consisting of dielectric oxides, perylenes, nanoparticles, and polymer films. Meanwhile, the insulating protection layer 30 may be transparent.

The electrode 40 is directly or indirectly connected to the heating layer 20 to supply power to the heating layer 20. The electrode 40 may be made of various materials capable of supplying electric power, and may be selected from the group consisting of, for example, a metal material, a conductive epoxy, a conductive paste, a solder, and a conductive film. According to FIG. 1, the electrodes 40 are connected to both sides of the heating layer 20, but can be connected and arranged in various operable positions if power can be supplied to the heating layer 20. In addition, the electrode 40 may be electrically connected to a power source included in the PCR apparatus or disposed externally. For example, the electrode 40 directly contacts the heating layer 20 and connects the heating layer 20 to an external circuit (not shown) through a wiring (not shown) The terminals can be disposed so as to be stably fixed to the electrode 40.

The light-transmissive thermal block 100 includes a chip contact portion 50 in which a PCR chip (not shown) is in contact with at least a portion of the upper surface thereof. The PCR chip may be heated or cooled according to the heat supply or recovery of the light-transmitting heat block 100 by contacting the chip contact unit 50, thereby performing each reaction step of the PCR. In addition, the PCR chip may directly or indirectly contact the chip contact portion 50. [ Meanwhile, the PCR apparatus according to an exemplary embodiment of the present invention may further include modules for performing other PCR including the optically transparent thermal block, and the detailed modules not described herein may include modules It is premised that they are all within the scope.

The PCR device including the light-transmissive heat block 100 has many advantages over the conventional PCR device using a heat heater, ceramic heater, or metal heater as a heat block. First, since the conductive nanoparticles are used as the heat source, there is no fear of disconnection of the heating layer, and since the conductive nanoparticles are directly heated, high thermal efficiency and low power consumption can be obtained (for example, the light transmittance If the heat block is about 2X2 ㎝, it can generate heat with a voltage of about 12V.) Because it is not a metal material, it hardly oxidizes and corrodes, so it has excellent durability. In addition, since the light transmittance may be obtained when the substrate 10, the heating layer 20, and the insulating protective layer 30 are manufactured, the substrate 10, the heating layer 20, and the insulating layer may be included in the sample solution when implemented together with the light providing unit and the light detecting unit. Real-time monitoring of PCR with the fluorescent material is possible. In addition, since the thickness of the substrate 10, the heating layer 20, and the insulating protective layer 30 may be easily controlled, the light-transmissive thermal block 100 may be slimmed, thereby allowing the light-transmissive thermal block 100 to be reduced. It is possible to miniaturize the PCR device including the). In addition, since the conductive nanoparticles are uniformly distributed in the heating layer 20, uniform heat distribution and rapid temperature control of the light-transmissive thermal block 100 are possible, and thus the PCR result is high in detection efficiency, You can get it quickly. The uniformity of the heat distribution of the light transmitting thermal block 100 and the rapidity of the temperature control can be confirmed as an experimental result according to FIG. 2. Figure 2a shows the heat distribution of the heat block included in the conventional PCR device, Figure 2b shows the heat distribution of the light transmitting thermal block 100 included in the PCR device according to an embodiment of the present invention, Figure 2c Shows the temperature change with time of the light transmitting thermal block 100 included in the PCR device according to an embodiment of the present invention. The temperature distribution is observed by applying electric power to the calcite heater, the ceramic heater or the metal heater used as the thermal block in the conventional PCR apparatus, and the electrode 40 is placed on the light-transmissive thermal block 100 according to the embodiment of the present invention. The temperature distribution was observed by applying power. As a result, according to FIG. 2A, the temperature distribution on the existing heater is not uniform throughout the heater surface, but according to FIG. 2B, the temperature distribution on the light-transmissive thermal block 100 is observed to be overall uniform compared to FIG. 2A. It became. In addition, by applying power to the light-transmissive heat block 100 according to an embodiment of the present invention through the electrode 40, the temperature change of the light-transmissive heat block 100 with time was observed. As a result, the temperature rise was shown to be up to 17 ℃ / sec, which indicates that the temperature rise of the typical conventional heaters (for example, Bio-Rad's CFX96) is significantly higher than the maximum rise of 5 ℃ / sec. Can be.

3A shows a light-transmitting thermal block 100 included in a PCR apparatus according to an embodiment of the present invention in which a light absorbing layer 60 is disposed in contact with a lower surface of a substrate 10, 30 shows a light-transmissive thermal block 100 included in a PCR apparatus according to an embodiment of the present invention in which a light reflection preventing layer 70 is disposed in contact with an upper surface of the substrate 10, A layer 60 is disposed in contact with the insulating layer 30 and a light reflection preventing layer 70 for preventing reflection of light due to contact between the external air layer and the insulating protecting layer 30 is disposed in contact with the upper portion of the insulating protecting layer 30 Transparent thermal block 100 included in a PCR device according to one embodiment of the present invention.

In general, it is possible to measure and analyze the occurrence and extent of PCR products in real time using a fluorescent material while performing a PCR. Such PCR is called real time PCR. In the reaction, a fluorescent material as well as a reagent required for a PCR reaction is added to a PCR chip, and the fluorescent material emits light by light of a specific wavelength according to the generation of a PCR product, thereby inducing a measurable optical signal. Therefore, in order to accurately monitor the PCR product in real time, it is necessary to increase the sensing efficiency of the optical signal as much as possible. Since the light transmissive thermal block 100 has a light transmittance as a whole, the excitation light derived from the light source may be transmitted as it is, thereby increasing the sensing efficiency of the optical signal. However, some of the excitation light may be reflected on the transparent heat block 100 or reflected after passing through the transparent heat block 100 to act as noise of an optical signal. Therefore, preferably, the light absorbing material may be treated on the lower surface of the transparent heat block 100 to further increase the sensing efficiency. According to FIG. 3A, a light absorbing layer 60 is disposed in contact with a lower surface of the substrate 10, and the light absorbing layer 60 includes a light absorbing material. The light absorbing substance may be, for example, mica, but is not limited as long as it is a substance having a property of absorbing light. Therefore, the light absorbing layer 60 absorbs a part of the light derived from the light source, and the generation of reflected light acting as noise of the optical signal can be suppressed as much as possible. In addition, alternatively, the antireflective material may be treated on the upper surface of the light transmissive thermal block 100 to further increase the sensing efficiency. According to FIG. 3B, a light reflection prevention layer 70 is disposed in contact with the upper surface of the insulation protection layer 30, and the light reflection prevention layer 70 is combined with the insulation protection layer 30 to provide insulation protection and light reflection. Performs a protective function and includes an antireflective material. The anti-reflective material may be, for example, a fluoride such as MgF 2, an oxide such as SiO 2 or Al 2 O 3, but is not limited as long as the material has a property of preventing light reflection. In addition, more preferably, by treating the light absorbing material on the lower surface of the transparent heat block 100, and at the same time by treating the light reflection prevention material on the upper surface of the transparent heat block 100 to further increase the sensing efficiency. Can be. That is, for effective real-time PCR monitoring, the ratio of the optical signal to the noise should have the maximum possible value, and the ratio of the optical signal to the noise may be improved as the reflectance of the excitation light from the PCR chip is lower. For example, although the reflectance of the excitation light of conventional heaters of a general metallic material is about 20 to 80%, the light according to the present invention including the light absorbing layer 60 or the antireflective layer 70 according to FIG. 3a or 3b. In the case of using the transmissive thermal block 100, the light reflectance can be reduced to within 0.2% to 4%, and the light transmissive heat according to the present invention includes the light absorbing layer 60 and the antireflective layer 70 according to FIG. 3C. When the block 100 is used, the light reflectance can be reduced to 0.2% or less.

4 shows that a PCR chip is arranged on a light-transmissive column block of a PCR apparatus according to an embodiment of the present invention including a light-providing portion and a light detecting portion.

According to FIG. 4, the PCR apparatus includes a light providing unit 200 operably arranged to provide light to a PCR chip 900 disposed at the chip contact unit 50 and a PCR disposed at the chip contact unit 50. The apparatus may further include a light detector 300 which is operably arranged to receive light emitted from the chip 900. The light providing unit 200 is a module for providing light to the PCR chip 900, the light detector 300 receives the light emitted from the PCR chip 900 in the PCR chip 900 Module for measuring the PCR reaction performed. Light is emitted from the light providing unit 200, and the emitted light passes or reflects through the PCR chip 900, specifically, a reaction chamber (or channel) (not shown) of the PCR chip 900. In this case, the light detector 300 detects an optical signal generated by nucleic acid amplification in the reaction chamber (or channel). Therefore, according to the PCR device according to the embodiment of the present invention, the nucleic acid (fluorescent material bound) of the nucleic acid in the reaction chamber (or channel) during each cyclic step of the PCR in the PCR chip (900) By monitoring the result of the amplification reaction in real time, it is possible to measure and analyze in real time whether the target nucleic acid contained in the initial sample solution and the degree of amplification. In addition, the light providing unit 200 and the light detecting unit 300 may be all disposed above or below the light transmitting thermal block 900, or may be disposed respectively. However, the arrangement of the light providing unit 200 and the light detecting unit 300 may be varied in consideration of the arrangement relationship with other modules for optimal implementation of the PCR apparatus according to the present invention. Accordingly, the light providing unit 200 and the light detecting unit 300 may be disposed above the light transmitting thermal block.

FIG. 5 illustrates the optical device 200 of the PCR device according to one embodiment of the present invention in more detail.

According to FIG. 5, the light providing unit 200 may include a light emitting diode (LED) light source or a laser light source 210 and a first light filter 230 that selects light having a predetermined wavelength from light emitted from the light source. And a first aspherical surface including a first optical lens 240 for collecting light emitted from the first light filter, and arranged to spread light between the light source 210 and the first light filter 230. The lens 220 further includes. The light source 210 includes all light sources capable of emitting light, and according to an embodiment of the present invention, includes a light emitting diode (LED) light source or a laser light source. The first light filter 230 selects and emits light having a specific wavelength among incident light having various wavelength bands, and may be variously selected according to the predetermined light source 210. For example, the first light filter 230 may pass only light having a wavelength of 500 nm or less among the light emitted from the light source 210. The first optical lens 240 collects the incident light and increases the intensity of the emitted light. The first optical lens 240 may increase the intensity of light irradiated onto the PCR chip through the light transmitting thermal block 100. In addition, the light providing unit 200 further includes a first aspherical lens 220 disposed to spread light between the light source 210 and the first light filter 230. By adjusting the arrangement direction of the first aspherical lens 220, the light range emitted from the light source 210 is extended to reach the measurable area.

6 shows the optical detector 300 of the PCR apparatus according to an embodiment of the present invention in more detail.

According to FIG. 6, the light detector 300 has a second optical lens 310 for collecting light emitted from a PCR chip disposed at the chip contact portion, and has a predetermined wavelength in light emitted from the second optical lens. A second optical filter 320 for selecting light, and an optical analyzer 350 for detecting an optical signal from light emitted from the second optical filter, wherein the second optical filter 320 and the optical analyzer ( And further comprising a second aspherical lens 330 disposed between the second light filters 320 to accumulate the light emitted from the second light filter 320, and between the second aspherical lens 330 and the optical analyzer 350. A photodiode integrated circuit 340 disposed to remove noise of light emitted from the second aspherical lens 330 and to amplify the light emitted from the second aspherical lens 330. It includes more. The second optical lens 310 collects the incident light and increases the intensity of the emitted light. The second optical lens 310 increases the intensity of light emitted from the PCR chip through the optically transparent thermal block 100 to detect the optical signal. To facilitate. The second light filter 320 selects and emits light having a specific wavelength among incident light having various wavelength bands, and variously selects the light according to a predetermined wavelength of light emitted from the PCR chip through the light transmitting thermal block 100. Can be. For example, the second light filter 320 may pass only light in a wavelength range of 500 nm or less among predetermined light emitted from the PCR chip through the light transmitting thermal block 100. The optical analyzer 350 is a module that detects an optical signal from the light emitted from the second optical filter 320, and converts the fluorescent light expressed from the sample solution into an electrical signal to enable qualitative and quantitative measurement. . In addition, the light detector 300 includes a second aspherical lens 330 disposed between the second light filter 320 and the light analyzer 350 to integrate light emitted from the second light filter 320. It may further include. By adjusting the arrangement direction of the second aspherical lens 330, the light range emitted from the second light filter 320 is extended to reach the measurable area. In addition, the light detector 300 removes noise of light emitted from the second aspherical lens 330 between the second aspherical lens 330 and the optical analyzer 350, and removes the second aspherical surface. The device may further include a photodiode integrated circuit (PDIC) 340 disposed to amplify the light emitted from the lens 330. By using the photodiode integrated device 340, the PCR device can be further miniaturized, and noise can be measured to minimize a noise and to measure a reliable optical signal.

Figure 7 shows the optical path by the dichroic filter 400 included in the PCR device according to one embodiment of the present invention.

According to FIG. 7, the PCR apparatus may adjust one or more directions of light so that the light emitted from the light providing unit 200 reaches the light detecting unit 300, and at least one for separating light having a predetermined wavelength. The dichroic filter 400 further includes. The dichroic filter 400 is a module that reflects light at an angle that is selectively transmitted or selectively adjusted according to the wavelength. According to FIG. 7, the dichroic filter 400a is disposed to be inclined at an angle of about 45 degrees with respect to the optical axis of the light emitted from the light providing unit 200, and selectively transmits the light according to its wavelength and transmits the short wavelength component. Is reflected at right angles to reach the PCR chip 900 disposed on the transparent heat block 100. In addition, the dichroic filter 400b is disposed to be inclined at an angle of about 45 degrees with respect to the optical axis of the light reflected from the PCR chip 900 and the light transmissive thermal block 100, and the light is selectively short-wavelength component according to its wavelength. And the long wavelength component is reflected at right angles to reach the photo detector 300. The light reaching the light detector 300 is converted into an electric signal in the optical analyzer to indicate whether the nucleic acid is amplified and the degree of amplification.

Fig. 8 shows a cross-section of a light-transmissive PCR chip 900 according to another embodiment of the present invention.

According to Figure 8, a light-transmissive PCR chip 900 is placed on a chip contact 50 included in a light-transmissive thermal block 100 of a PCR device according to one embodiment of the invention described above, And the like. In addition, the light-transmissive PCR chip 900 may be a light-transmitting plastic material. The light-transmitting PCR chip further includes a first plate 910; A second plate (920) disposed on the first plate (910) and having a through-opening channel (921); And a through-hole opening 932 formed in one region of the through-hole opening channel 921 and a through-hole opening outlet 932 formed in another region of the third plate 920, Plate < / RTI >

The PCR chip 900 may include a nucleic acid such as double-stranded DNA, an oligonucleotide primer having a sequence complementary to a specific nucleotide sequence to be amplified, a DNA polymerase, deoxyribonucleotide triphosphates (dNTP), a PCR And a sample solution containing a PCR reaction buffer. The PCR chip 900 includes an inlet 931 for introducing the sample solution, an outlet 932 for discharging the sample solution after completion of the nucleic acid amplification reaction, and an outlet 932 for receiving the sample solution containing the nucleic acid to be amplified (Or channel) 921 as described above. When the PCR chip 900 contacts the optically transparent thermal block 100, the heat of the optically transparent thermal block 100 is transferred to the PCR chip 900 and the PCR reaction chamber of the PCR chip 900 (Or channel) 921 may be heated or cooled to maintain a constant temperature. In addition, the PCR chip 900 may have a planar shape as a whole, but is not limited thereto. In addition, the PCR chip 900 may be indirectly placed in contact with the light-transmitting thermal block 100 while being mounted on a separate chip holder (not shown). Therefore, in one embodiment of the present invention, the fact that the PCR chip 900 is disposed in the chip contact portion 50 of the light-transmitting thermal block 100 means that the PCR chip 900 is mounted on a separate chip holder Transmissive thermal block (100). In addition, the PCR chip 900 may be formed of a light-transmitting material, and preferably includes a light-transmitting plastic material. The PCR chip 900 can increase the heat transfer efficiency only by adjusting the thickness of the plastic using the plastic material, and the manufacturing process can be simplified to reduce the manufacturing cost. In addition, since the PCR chip 900 has a light transmitting property as a whole, it can be directly irradiated to the PCR chip in a state where it is disposed on the chip contact portion 50 of the light-transmitting heat block 100, And the degree of amplification can be measured and analyzed.

The first plate 910 is disposed on the second plate 920. The first plate 910 is adhered to the lower surface of the second plate 920 so that the through-hole opening channel 921 forms a PCR reaction chamber. The first plate 910 may be formed of a variety of materials, but it is preferable to use polydimethylsiloxane, cycle olefin copolymer, polymethylmetharcylate, polycarbonate a material selected from the group consisting of polycarbonate, polypropylene carbonate, polyether sulfone, and polyethylene terephthalate and combinations thereof. In addition, the upper surface of the first plate 910 may be treated with the hydrophilic material 922 to facilitate the PCR. A single layer containing a hydrophilic material 922 may be formed on the first plate 910 by the treatment of the hydrophilic material 922. The hydrophilic material may be various materials, but may be selected from the group consisting of a carboxyl group (-COOH), an amine group (-NH 2 ), a hydroxyl group (-OH), and a sulfone group (-SH) The treatment of the hydrophilic material can be carried out according to methods known in the art.

The second plate 920 is disposed on the first plate 910. The second plate 920 includes a through-opening channel 921. The through-hole opening channel 921 is connected to a through-opening inlet 931 formed in the third plate 910 and a portion corresponding to the through-opening outlet 932 to form a PCR reaction chamber. Therefore, the sample solution to be amplified is introduced into the through-hole opening channel 921, and the PCR reaction proceeds. In addition, the through-hole opening channel 921 may exist in two or more depending on the purpose and range of use of the PCR apparatus according to one embodiment of the present invention, and six through-opening channels 921 are illustrated according to FIG. 8 . The second plate 920 may be formed of a variety of materials. Preferably, the second plate 920 may be formed of a material such as polymethyl methacrylate, polycarbonate, cycloolefin copolymer, polyamide, polyethylene, polypropylene ), Polyphenylene ether, polystyrene, polyoxymethylene, polyetheretherketone, polytetrafluoroethylene, polyvinylchloride, polyvinylidene chloride, polyvinylidene chloride, A thermoplastic resin or a thermosetting resin selected from the group consisting of polyvinylidene fluoride, polybutyleneterephthalate, fluorinated ethylenepropylene, perfluoralkoxyalkane, and combinations thereof, or a thermosetting resin It can be resin material. Also, the thickness of the second plate 920 may vary, but may be selected from 100 μm to 200 μm. The width and length of the through-hole opening channel 921 may vary, but preferably the width of the through-hole opening channel 921 is selected from 0.5 mm to 3 mm, and the length of the through-hole opening channel 921 May be selected from 20 mm to 60 mm. The inner wall of the second plate 920 may be coated with a material such as silane series or bovine serum albumin in order to prevent DNA and protein adsorption. Can be carried out according to a known method.

The third plate 930 is disposed on the second plate 920. The third plate 930 includes a through opening inlet 931 formed in one region on the through opening channel 921 formed in the second plate 920 and a through opening outlet 932 formed in the other region. do. The through opening inlet 931 is a portion into which a sample solution containing a nucleic acid to be amplified is introduced. The through opening outlet 932 is a portion where the sample solution 932 flows out after the PCR reaction is completed. Accordingly, the third plate 930 covers the through-opening channel 921 formed in the second plate 920 to be described below, wherein the through-opening inlet 931 and the through-opening outlet 932 are the through-holes. It serves as an inlet and an outlet of the opening channel 921. In addition, the third plate 930 may be made of various materials, but preferably, polydimethylsiloxane, cycloolefin copolymer, polymethyl methacrylate, polycarbonate, polypropylene carbonate, polyether sulfone, and polyethylene It may be a material selected from the group consisting of telephthalate, and combinations thereof. In addition, the through opening inlet 931 may have various sizes, but preferably may be selected from a diameter of 1.0 mm to 3.0 mm. In addition, the through-opening outlet 932 may have various sizes, but preferably may be selected from a diameter of 1.0 mm to 1.5 mm. In addition, the through-opening inlet 931 and the through-opening outlet 932 are provided with separate cover means (not shown), so that the PCR reaction with respect to the sample solution in the through-opening channel 921 proceeds. The sample solution can be prevented from leaking. The cover means may be implemented in various shapes, sizes or materials. In addition, the thickness of the third plate may vary, but preferably may be selected from 0.1 mm to 2.0 mm. In addition, two or more through opening inlets 931 and through opening outlets 932 may be present.

9 shows a light-transmitting PCR chip according to another embodiment of the present invention in which a double-sided adhesive or a thermoplastic resin or a thermosetting resin 500 is treated. Specifically, the PCR chip according to Fig. 9 can be produced by a method including the following steps.

The light-transmissive PCR chip (100) is mechanically processed to form a through-opening inlet (931) and a through-opening outlet (932) to provide a third plate (930); The plate 930 having a size corresponding to the lower surface of the third plate 930 is inserted into the plate 930 from the portion corresponding to the through-hole inlet 931 of the third plate 930, Forming a through-opening channel 921 through mechanical machining to a portion corresponding to the first plate 932 to provide a second plate 920; Providing a first plate (910) by forming a surface embodied with a hydrophilic material (922) through surface treatment on the upper surface of the plate having a size corresponding to the lower surface of the second plate (920); And the lower surface of the third plate 930 are joined to the upper surface of the second plate 920 through a joining process and the lower surface of the second plate 920 is joined to the upper surface of the first plate 910 And a step of joining to the surface through a bonding step.

The through opening inlet 931 and through opening outlet 932 of the third plate 930 and the through opening channel 921 of the second plate 920 are injection molded, hot-embossing. Can be formed by a processing method selected from the group consisting of: casting, casting, and laser ablation. In addition, the hydrophilic material 922 on the surface of the first plate 910 may be treated by a method selected from the group consisting of oxygen and argon plasma treatment, corona discharge treatment, and surfactant application and known in the art. Can be done according to In addition, the lower surface of the third plate 930 and the upper surface of the second plate 920, the lower surface of the second plate 920 and the upper surface of the first plate 910 may be thermally bonded, It can be adhered by ultrasonic fusion, solvent bonding process and can be carried out according to methods known in the art. The double-sided adhesive or the thermoplastic resin 500 may be processed between the third plate 930 and the second plate 920 and between the second plate 920 and the third plate 910.

Figure 10 shows a PCR device comprising two column blocks according to another embodiment of the present invention.

The PCR device comprising the two column blocks comprises a first column block 1100 disposed on a substrate 1400; A second column block 1200 disposed on the substrate 1400 and spaced apart from the first column block 1100; And a chip holder 1300 mounted on the first column block 1100 and the second column block 1200 and capable of moving left and right and / or up and down by the driving means 1500 and equipped with the PCR chip 900 do.

The PCR device including the two column blocks may complete the first cycle by performing the two steps consisting of the extension step and the annealing and extension (or amplification) steps.

The PCR device including the two column blocks includes a first column block 1100 disposed on a substrate 1400 and a second column block 1100 disposed on the substrate 1400 and spaced apart from the first column block 1100. [ (1200).

The substrate 1400 does not change its physical and / or chemical properties due to heating and temperature maintenance of the first column block 1100 and the second column block 1200, And all materials having a material such that mutual heat exchange does not occur between the two column blocks 1200. For example, the substrate 1400 may comprise or be made of a material such as plastic.

The first column block 1100 and the second column block 1200 are for maintaining a temperature for performing a denaturation step, an annealing step, and an extension (or amplification) step for amplifying the nucleic acid. Accordingly, the first column block 1100 and the second column block 1200 may include or be operably coupled to various modules for providing and maintaining the required temperature required for each of the steps . Accordingly, when the chip holder 1300 equipped with the PCR chip 900 contacts one surface of each of the thermal blocks 1100 and 1200, the first thermal block 1100 and the second thermal block 1200 The contact surface with the PCR chip 900 can be entirely heated and maintained at a temperature so that the sample solution in the PCR chip 900 can be uniformly heated and maintained at a temperature. Conventionally, a PCR apparatus using a single column block has a temperature change rate in the single column block within a range of 3 to 7 ° C per second, while the PCR apparatus including the two column blocks includes a column block 1100, 1200 ) Is in the range of 20 to 40 ° C per second, which can greatly shorten the PCR reaction time.

In the first column block 1100 and the second column block 1200, heat lines (not shown) may be disposed therein. The hot wire may be drivably connected to various heat sources to maintain the temperature for performing the denaturation step, the annealing step and the extension (or amplification) step, and may be operably connected to various temperature sensors for monitoring the temperature of the hot wire . The heat lines are vertically and / or horizontally oriented with respect to the center points of the surfaces of the heat blocks 1100 and 1200 so as to maintain the internal temperatures of the first and second heat blocks 1100 and 1200 as a whole. And may be arranged to be symmetrical. The arrangement of the hot lines symmetrical in the up and down and / or left and right directions may be varied. In addition, a thin film heater (not shown) may be disposed in the first column block 1100 and the second column block 1200. The thin film heater may be vertically and / or horizontally oriented with respect to the center point of each of the heat blocks 1100 and 1200 in order to maintain the internal temperatures of the first and second thermal blocks 1100 and 1200 as uniform as a whole Can be spaced apart at regular intervals. The arrangement of the thin film heaters in the vertical direction and / or the horizontal direction may be various.

The first column block 1100 and the second column block 1200 may include a metal material such as an aluminum material or an aluminum material for uniform heat distribution and rapid heat transfer to the same area.

The first column block 1100 may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) step. For example, the first column block 1100 of the PCR device comprising the two column blocks can maintain 50 ° C to 100 ° C, preferably 90 ° C when the denaturation step is performed in the first column block The temperature can be maintained in the range of 55 to 75 DEG C in the case where the annealing and extension (or amplification) steps are performed in the first column block, Lt; RTI ID = 0.0 > 72 C. < / RTI > However, the present invention is not limited thereto, as long as it can perform the above-described denaturation step, or the annealing and extension (or amplification) step. The second thermal block 1200 may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) step. For example, the second column block 1200 of the PCR device comprising the two column blocks may maintain 90 ° C to 100 ° C when performing the denaturation step in the second column block, preferably 95 ° C ° C., and in the case where the annealing and extension (or amplification) steps are performed in the second thermal block 1200, the temperature can be maintained at 55 ° C. to 75 ° C., and preferably 72 ° C. can be maintained. However, the present invention is not limited thereto, as long as it can perform the above-described denaturation step, or the annealing and extension (or amplification) step. Accordingly, the first column block 1100 can maintain the denaturing temperature of the PCR reaction. If the denaturation temperature is lower than 90 ° C, denaturation of the nucleic acid that becomes the template of the PCR reaction occurs, The reaction efficiency may be lowered or the reaction may not occur. If the denaturation step temperature is higher than 100 ° C, the enzyme used in the PCR reaction may lose activity. Therefore, the denaturation step temperature may be 90 ° C to 100 ° C, 95 < 0 > C. Also, the second thermal block 1200 may maintain the annealing and extension (or amplification) temperature of the PCR reaction. If the extension (or amplification) step temperature is lower than 55 ° C, the specificity of the PCR reaction product may be lowered, and if the annealing and extension (or amplification) step temperature is higher than 75 ° C, extension by the primer may not occur The temperature of the annealing and the extension (or amplification) step may be 55 ° C to 75 ° C, preferably 72 ° C, since the PCR reaction efficiency is lowered.

The first column block 1100 and the second column block 1200 may be spaced apart from each other by a predetermined distance such that mutual heat exchange does not occur. Accordingly, in the nucleic acid amplification reaction which can be significantly influenced by a minute temperature change since heat exchange does not occur between the first column block 1100 and the second column block 200, Accurate temperature control of the annealing and extension (or amplification) stages is possible.

The PCR device including the two column blocks can be moved left and right and / or up and down by the driving means 1500 on the first column block 1100 and the second column block 1200, And a chip holder 1300 mounted thereon. In addition, the PCR chip 900 may be configured to receive a sample solution containing a nucleic acid to be amplified, which is in contact with one surface of the first column block 1100 or the second column block 1200 .

The PCR chip 900 has been described with reference to FIGS. When the PCR chip 900 contacts the first column block 1100 and the second column block 1200, the columns of the first column block 1100 and the second column block 1200 are connected to the PCR chip 900, and the sample solution contained in the reaction chamber (or channel) of the PCR chip 900 may be heated and maintained at a temperature. In addition, the PCR chip 900 may have a planar shape as a whole, but is not limited thereto. When the nucleic acid amplification reaction is performed by the PCR device including the two column blocks, the outer wall of the PCR chip 900 is connected to the chip holder 1300 so that the PCR chip 900 does not separate from the chip holder 1300. [ And may have a shape and a structure for being fixedly mounted in the inner space of the housing 1300.

The chip holder 1300 is a module in which the PCR chip 900 is mounted in a PCR apparatus including the two column blocks. The inner wall of the chip holder 1300 is connected to the PCR chip 900 so that the PCR chip 900 does not separate from the chip holder 1300 when the nucleic acid amplification reaction is performed by the PCR device including the two thermal blocks. As shown in FIG. The chip holder 1300 is driveably connected to the driving means 1500. In addition, the PCR chip 900 may be detachable from the chip holder 1300.

The driving means 1500 may include all means for making the chip holder 1300 equipped with the PCR chip 900 movable left and right and / or up and down on the first column block 1100 and the second column block 1200 . The chip holder 1300 on which the PCR chip 900 is mounted can reciprocate between the first column block 1100 and the second column block 1200 by the movement of the driving unit 1500 The chip holder 1300 on which the PCR chip 900 is mounted can be brought into contact with and separated from the first column block 1100 and the second column block 1200 by the upward and downward movement of the driving means 1500 have. The driving unit 1500 of the PCR apparatus including the two column blocks includes a rail 1510 extending in the left and right direction and a slider 1510 slidably moved in the left and right direction through the rail 1510, And a chip holder 1300 is disposed at one end of the connecting member 1520. [ The right and / or left and / or up and down movement of the driving means 1500 can be controlled by control means (not shown) drivably arranged inside or outside the PCR apparatus including the two thermal blocks, Means that the chip holder 1300 on which the PCR chip 900 is mounted for the annealing and extension (or amplification) steps of the denaturation step of the PCR and the chip holder 1300 on which the first column block 1100 and the second column block 1200 Contact and separation can be controlled.

11 shows each step of nucleic acid amplification reaction by movement of a chip holder of a PCR apparatus including two column blocks according to another embodiment of the present invention.

The nucleic acid amplification reaction by the PCR apparatus including the two column blocks is performed by the following steps. First, an oligonucleotide primer, a DNA polymerase, a deoxyribonucleotide triphosphate (dNTP) having a sequence complementary to a specific nucleotide sequence to be amplified, a nucleic acid such as double-stranded DNA, , And a PCR reaction buffer are introduced into the chip holder 1300, and the PCR chip 900 is mounted on the chip holder 1300. Thereafter, or concurrently, the first heat block 1100 is heated and maintained at a temperature for the denaturation step, for example, 90 ° C to 100 ° C, and preferably heated and maintained at 95 ° C. The second thermal block 1200 is heated and maintained at a temperature for annealing and extension (or amplification) steps, for example, 55 ° C to 75 ° C, and preferably heated and maintained at 72 ° C .

The PCR chip 900 is moved downward by controlling the connecting member 1520 of the driving unit 1500 so that the chip holder 1300 on which the PCR chip 900 is mounted is inserted into the first column block 1100) to perform the first denaturation step of the PCR (step x).

Thereafter, the PCR chip 900 is moved upward by controlling the connecting member 1520 of the driving unit 1500 so that the chip holder 1300, on which the PCR chip 900 is mounted, 1100 to terminate the first denaturing step of the PCR and control the connecting member 1520 of the driving unit 1500 to move the PCR chip 900 above the second column block 1200 (Step y).

Thereafter, the PCR chip 900 is moved downward by controlling the connecting member 1520 of the driving unit 1500 so that the chip holder 1300, on which the PCR chip 900 is mounted, 1100) to perform a first annealing and extension (or amplification) step of the PCR (step z).

Lastly, the PCR chip 900 is moved upward by controlling the connecting member 1520 of the driving means 1500 to move the chip holder 1300 on which the PCR chip 900 is mounted to the second row block ( 1200 to terminate the first annealing and extension (or amplification) step of the PCR, and control the connecting member 1520 of the driving means 1500 to control the PCR chip 900 to the first row block 1100. The nucleic acid amplification reaction is performed by repeating the steps x, y, and z after moving to (circulation step).

FIG. 12 shows a step of observing a nucleic acid amplification reaction in real time using a PCR apparatus including two column blocks according to another embodiment of the present invention.

The PCR apparatus including the two column blocks may further include a light source 1700 disposed between the first column block 1100 and the second column block 1200 and the light source 1700 may be disposed on the chip holder 1300. [ Or a light for detecting light emitted from the light source 1700 between the first column block 1100 and the second column block 1200 may be further disposed, A detection unit 1800 may be further disposed, and a light source 1700 may be further disposed on the chip holder 1300. The light detecting unit 1800 is disposed on the driving unit 1500 and the driving unit 1500 may include a penetrating unit 1530 for passing light emitted from the light source 1700. [

By the arrangement of the light source 1700 and the optical detector 1800, the extent to which the nucleic acid is amplified in the PCR chip 900 is detected in real time during the nucleic acid amplification reaction by the PCR apparatus including the two column blocks . In order to detect the amplification degree of the nucleic acid in the PCR chip 900, a separate fluorescent material may be further added to the sample solution to be introduced into the PCR chip 900. The light source 1700 is arranged to be as widely distributed as possible in the spaced space between the first column block 1100 and the second column block 1200 and is arranged to emit as much light as possible. The light source 1700 may be operably connected to a lens (not shown) for collecting light emitted from the light source 1700 and an optical filter (not shown) for filtering light of a specific wavelength band.

The step of detecting the amplification degree of the nucleic acid in the PCR chip 900 in real time during the nucleic acid amplification reaction by the PCR device including the two column blocks is performed in the following steps. After the completion of the first denaturation step of the PCR, the connection member 1520 of the driving unit 1500 is controlled to move the PCR chip 900 from the top of the first column block 1100 to the top of the second column block 1200 Or controlling the connecting member 1520 of the driving means 1500 after the first annealing and extension (or amplification) step of the PCR to control the PCR chip 900 in the second column block 1200 The chip holder 1300 on which the PCR chip 900 is mounted is controlled by the connecting member 1520 of the driving unit 1500 to move the chip holder 1300 on the first column block 1100, And then stops on a spaced-apart space between the column block 1100 and the second column block 1200. Thereafter, light is emitted from the light source 1700 and the emitted light passes through the reaction chamber (or channel) of the optically transparent PCR chip 900, specifically, the PCR chip 900. In this case, The optical detection unit 1800 detects an optical signal generated by amplification of a nucleic acid in the reaction chamber (or channel). In this case, the light that has passed through the optically transparent PCR chip 900 can pass through the driving unit 1500, specifically, the penetration unit 1530 disposed on the rail 1510 and reach the light output unit 1800 have.

Therefore, according to the PCR apparatus including the two thermal blocks, the reaction result by amplification of nucleic acid (phosphorescent substance bound) in the reaction chamber (or channel) during each cycle of the PCR reaction is performed. By monitoring in real time, the amount of target nucleic acid contained in the initial reaction sample can be measured and analyzed in real time.

Example  1: influenza A virus cDNA  synthesis

The genomic RNA of Influenza A virus H1N1 was distributed from the Centers for Disease Control. The reverse transcription reaction solution was prepared using Invitrogen's SupterScript III First-strand Synthesis System for RT-PCR kit together with the genomic RNA that was distributed, the reverse transcription reaction was performed, and cDNA was synthesized. The composition of the reverse transcription reaction solution and cDNA synthesis conditions used in the reverse transcription reaction are shown in Tables 1 and 2 below.

Item density Genomic RNA 5 ul or more Primer (2 uM) 0.1 uM 10 mM dNTPs mix 0.5 mM DEPC-treated water 20 ul 10X RT Buffer 1X 26 mM MgCl 2 2.5 mM RnaseOUT (40 U / ul) 40 U SuperScript III RT (200 U / ul) 200 U

process Temperature and time Denaturation 65 ℃, 5 minutes ice, 1 minute Annealing Reaction solution and Mixing cDNA synthesis 50 ° C, 90 minutes Terminal reaction 85 ° C., 5 minutes Remove RNA RNase H added, 37 ° C, 20 minutes

Example  2: for influenza A virus detection primer  Production and synthesis

The primers used for real-time detection of influenza A virus were made through Primer 3 with GC% of 40-60%, Tm value of 65-75 ° C, and commissioned by Genotech. Synthesized. A list of genes specifically amplified by the primers and respective influenza A viruses is shown in Table 3 below. In the table below, primer names quoted the name of the gene of interest.

Gene name Name of the primer Base sequence Product size (bp) Matrix Protein 1 (M) NBS-M-F AAGCCGAGATCGCGCAGAGACTGGA (SEQ ID NO: 1) 155
NBS-M-R ACTGGGCACGGTGAGCGTGAACACA (SEQ ID NO: 2) Hemagglutinin (HA) NBS-HA-F GCTGGATCCTGGGAAATCCAGAGTG (SEQ ID NO: 3) 212
NBS-HA-R GTTCGAGTCATGATTGGGCCATGAA (SEQ ID NO: 4) Neuraminidase (NA) NBS-NA-F ATCAGAGGGCGACCCAAAGAGAACA (SEQ ID NO: 5) 118
NBS-NA-R TAAATGGCAACTCAGCACCGTCTGG (SEQ ID NO: 6)

In order to confirm specific detection of primers against influenza A virus, PCR was performed using the cDNA of the influenza A virus synthesized in Example 1 as a template. Table 4 and Table 6 show the composition of the PCR reaction solution used in the PCR reaction and the PCR conditions performed. Each PCR reaction solution was added distilled water to the following composition so that the total volume was 50 μl.

Item density 10X PCR buffer (Kosomogin Tec) 1X 10 mM dNTPs 1 mM Template (cDNA) 1 ng Primer (forward / reverse) 1 uM Taq Polymerase (Cosmogyn Tech) 1

Reaction temperature Reaction time 95 (denaturation) 10 seconds 72 (annealing & extension) 10 seconds

(2 steps, 30 cycles)

After PCR, 3 ul of each reaction solution was subjected to electrophoresis on 1% agarose gel to identify the PCR reaction product. Thus, specific primers present in each influenza A virus were identified by the primer sets shown in Table 3 above. After detection, the remaining 47 ul was subjected to electrophoresis on 1% agarose gel, and then a DNA fragment of the PCR reaction product was extracted using a gel extraction kit (Invitrogen). Each of the extracted DNA fragments was cloned into a StrataClone PCR cloning kit (Stratagene). Each of the cloned vectors was transformed into E. coli and plated on LB plates containing ampicillin / X-gal / IPTG and incubated at 37 ° C. Then, only the colonies containing the cloned vector so as to contain the PCR amplification product were selected and cultured in LB medium. Then, the plasmid DNA was extracted using plasmid DNA miniprep kit (Qiagen). The extracted plasmid DNA was commissioned by Cosmojin Tech Co., Ltd. to analyze the nucleotide sequence of the cloned gene. As a result, each base sequence was confirmed to match the base sequence of the gene to be amplified.

Example  3: Light transmittance Heat block  Or two Heat block  Each containing PCR  Device and Light transmittance PCR  Real-time Detection of Influenza A Virus Using a Chip

A real-time PCR device prepared by the present inventors using a primer set capable of detecting an influenza A virus as described in Table 3 as a template and influenza A virus synthesized in Example 1 (optical Real time PCR was performed using a PCR device including a transparent heat block) and a light transmitting PCR chip. The composition of the reaction solution for the real time PCR and the reaction conditions of the real time PCR are described in Tables 6 and 7 below. Each PCR reaction solution was made to have a total volume of 12 ul by adding distilled water to the following composition, and the reaction solution for detecting different types of influenza A virus was injected into the through-opening inlets of different through-opening channels in the PCR chip. . In this example, six through-open channels were arranged on the PCR chip to simultaneously detect several genes of six types of influenza A virus. As a negative control template, Salmonella, a food poisoning bacterium that is not associated with influenza A virus instead of cDNA The genome DNA of enterica was used.

Item density 10X PCR buffer 1X 10 mM dNTPs 1 mM Template (genomic DNA) 0.6 ng Primer (forward / reverse) 1 uM Taq polymerase 3U SYBR Green Dye 1X

Reaction temperature Reaction time 95 (denaturation) 5 seconds 72 (annealing & extension) 14 seconds

(2 steps, 30 cycles)

As shown in Figure 13, it was confirmed that each influenza A virus can be detected in real time using the kit of the present invention according to one embodiment. In addition, it was confirmed from the electrophoretic photograph of the PCR amplification product of FIG. 13 that the gene of each influenza A virus was specifically detected by the primer set.

<110> NANOBIOSYS INC. <120> Kit and method for detecting new influenza A virus <130> PN089983 <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer (NBS-M-F) <400> 1 aagccgagat cgcgcagaga ctgga 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer (NBS-M-R) <400> 2 actgggcacg gtgagcgtga acaca 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer (NBS-HA-F) <400> 3 gctggatcct gggaaatcca gagtg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer (NBS-HA-R) <400> 4 gttcgagtca tgattgggcc atgaa 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer (NBS-NA-F) <400> 5 atcagagggc gacccaaaga gaaca 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer (NBS-NA-R) <400> 6 taaatggcaa ctcagcaccg tctgg 25

Claims (11)

A first plate; A second plate disposed over the first plate and having at least one through opening channel; And a third plate disposed on an upper portion of the second plate and having a through opening inlet formed in each region on the one or more through opening channels and a through opening outlet formed in the other region. In the at least one through opening channel,
(a) Matrix gene of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 1 and a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: GenBank ID number: GQ131025) set of primers for detecting;
(b) Hemagglutinin of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides in SEQ ID NO: 3 and a primer comprising at least 15 consecutive nucleotides in SEQ ID NO: 4 ) Primer set for detecting gene (GenBank ID number: GQ131023);
(c) Neuraminidase of a novel influenza virus consisting of a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 5 and a primer comprising at least 15 consecutive nucleotides of SEQ ID NO: 6 ) A kit for detecting influenza A virus, each kit comprising one or more primer sets selected from the group consisting of primer sets for detecting a gene (GenBank ID number: GQ1312185). The kit of claim 1, wherein the PCR chip is made of a light transmissive material. The method of claim 1, wherein the first and third plates are formed from a material selected from the group consisting of polydimethylsiloxane, cycle olefin copolymer, polymethylmetharcylate, polycarbonate, Wherein the second plate is made of a material selected from the group consisting of polypropylene carbonate, polyether sulfone, and polyethylene terephthalate and combinations thereof, and the second plate is made of a material selected from the group consisting of polymethyl methacrylate, polycarbonate, Polyamide, polyethylene, polypropylene, polyphenylene ether, polystyrene, polyoxymethylene, polyetheretherketone, polyetheretherketone, polyetheretherketone, polyetheretherketone, , Polytetrafluoroethylene, poly Polyvinylchloride, polyvinylidene fluoride, polybutyleneterephthalate, fluorinated ethylenepropylene, perfluoroalkoxyalkane, and combinations thereof A kit comprising a thermoplastic or thermosetting resin or a thermosetting resin material. The method of claim 1, wherein the through opening inlet of the third plate has a diameter of 0.01 mm to 10 mm, the through opening outlet has a diameter of 0.01 mm to 10 mm, the thickness of the third plate is 0.05 mm to 5 mm, The thickness of the second plate is 10 μm to 1000 μm, the width of the through opening channel is 0.01 mm to 10 mm, and the length of the through opening channel is 10 mm to 100 mm. The kit of claim 1, wherein the influenza A virus is influenza A virus subtype H1N1. The kit of claim 1, wherein the kit further comprises a mixture comprising dATP, dCTP, dGTP and dTTP, a DNA polymerase and a detectable label inside the through opening channel. The method of claim 6, wherein the detectable label is Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660 , Alexa Fluor 680, Cy2, Cy3.18, Cy3.5, Cy3, Cy5.18, Cy5.5, Cy5, Cy7, Oregon Green, Oregon Green 488-X, Oregon Green, Oregon Green 488, Oregon Green 500, Oregon Green 514, SYTO 11, SYTO 12, SYTO 13, SYTO 14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, SYTO 40, SYTO 41 , SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, SYTOX The kit is selected from the group consisting of Blue, SYTOX Green, SYTOX Orange, SYBR Green, YO-PRO-1, YO-PRO-3, YOYO-1, YOYO-3 and thiazole orange. The kit of claim 1, wherein the PCR chip has two or more through opening channels. Injecting a target sample suspected of infection with the influenza A virus at one or more through opening inlet of the kit of any one of claims 1 to 8 to perform a real-time PCR; And
Checking the presence or absence of influenza A virus in the target sample from the real-time PCR results. The method of claim 9, wherein the real-time PCR is performed in a PCR device comprising a single heatblock, a light transmissive heatblock, and two heatblocks. The method of claim 9, wherein the influenza A virus is influenza A virus subtype H1N1.
KR1020120003075A 2012-01-10 2012-01-10 Kit and method for detecting new influenza a virus KR20130081948A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120003075A KR20130081948A (en) 2012-01-10 2012-01-10 Kit and method for detecting new influenza a virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120003075A KR20130081948A (en) 2012-01-10 2012-01-10 Kit and method for detecting new influenza a virus

Publications (1)

Publication Number Publication Date
KR20130081948A true KR20130081948A (en) 2013-07-18

Family

ID=48993448

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120003075A KR20130081948A (en) 2012-01-10 2012-01-10 Kit and method for detecting new influenza a virus

Country Status (1)

Country Link
KR (1) KR20130081948A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150022263A (en) 2013-08-22 2015-03-04 고려대학교 산학협력단 Kit for determining infection of influenza A virus
KR20150022262A (en) 2013-08-22 2015-03-04 고려대학교 산학협력단 Kit for determining infection of influenza A virus

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150022263A (en) 2013-08-22 2015-03-04 고려대학교 산학협력단 Kit for determining infection of influenza A virus
KR20150022262A (en) 2013-08-22 2015-03-04 고려대학교 산학협력단 Kit for determining infection of influenza A virus

Similar Documents

Publication Publication Date Title
Tian et al. A fully automated centrifugal microfluidic system for sample-to-answer viral nucleic acid testing
KR101368463B1 (en) Device for amplify nucleic acid comprising two heating block
KR101456646B1 (en) Kit and method for detecting food-borne bacteria
RU2385940C1 (en) Method for real-time detection of nucleic acids by polymerase chain reaction and device for implementation thereof
CA2682761C (en) Methods for rapid multiplexed amplification of target nucleic acids
CN106661533B (en) Multiplex PCR chip and multiplex PCR device comprising same
JP3899360B2 (en) DNA amplification equipment
KR101483493B1 (en) PCR device for detecting food-borne bacteria, and and method for detecting food-borne bacteria using the same
US9399793B2 (en) Device for detecting nucleic acids
JP2005204592A (en) Full automatic gene-analyzing system
KR102078085B1 (en) High-speed real-time PCR device based on lap-on-a-chip for detecting food-borne bacteria to agrifood, and method for detecting food-borne bacteria to agrifood using the same
KR101835073B1 (en) Fluidic PCR chip comprising heating block of repetitively disposed heater unit and PCR apparatus comprising the same
KR20130081948A (en) Kit and method for detecting new influenza a virus
KR20130086893A (en) Device for polymerase chain reaction to amplify nucleic acid comprising light transmitting heating block
KR102028381B1 (en) PCR device using the primer set for detecting food-borne bacteria, and method for detecting food-borne bacteria using the same
KR20130134040A (en) Pcr device for detecting foot-and-mouth disease by serotype, and method for detecting foot-and-mouth disease using the same
US20210053059A1 (en) High-speed polymerase chain reaction analysis plate
KR20130091025A (en) Pcr device for detecting new influenza a virus, and method for detecting new influenza a virus using the same
KR20130091027A (en) Pcr device for detecting mycobacterium tuberculosis, and method for detecting mycobacterium tuberculosis using the same
KR101544089B1 (en) Micro chip for detecting food-borne bacteria, real-time PCR device comprising the same, and method for detecting food-borne bacteria using the same
KR20180023545A (en) Primer and Probe Set for Detecting Atypical Pneumonia, PCR Device Using Same, and Method for Detecting Atypical Pneumonia
KR20180023544A (en) Primer and Probe Set for Detecting Typical Pneumonia, PCR Device Using Same, and Method for Detecting Typical Pneumonia
KR20130091026A (en) Pcr device for detecting mycobacterium tuberculosis, and method for detecting mycobacterium tuberculosis using the same
KR20120045909A (en) Apparatus and method for detecting multiplex target nucleic acids in real time
KR20130085227A (en) Pcr device for detecting foot-and-mouth disease, and method for detecting foot-and-mouth disease using the same

Legal Events

Date Code Title Description
WITN Withdrawal due to no request for examination