CN115443908A

CN115443908A - Method for improving genetic transformation efficiency of plants

Info

Publication number: CN115443908A
Application number: CN202211279677.4A
Authority: CN
Inventors: 康向阳; 夏宇飞; 任勇谕; 杜康; 李赟; 杨珺
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2022-01-04
Filing date: 2022-10-19
Publication date: 2022-12-09
Anticipated expiration: 2042-10-19
Also published as: CN115443908B

Abstract

The invention discloses a method for improving the genetic transformation efficiency of plants, which comprises the steps of carrying out differentiation culture treatment on a plant explant receptor material and then carrying out genetic transformation on the receptor material subjected to differentiation culture treatment. The invention carries out differentiation culture on the cut receptor material, timely observes the development state of the cut of the material under a stereoscopic microscope, observes the cell morphology of the receptor material under the microscope through paraffin sections, determines the cell cycle S phase through EdU staining and fluorescence quantitative PCR, accurately judges the genetic transformation time and carries out the genetic transformation treatment in time. The method accurately determines the optimal processing period of genetic transformation of the receptor material, and carries out timely genetic transformation on different plants based on the principles of formation of leaf bud primordium and different development processes of different plant receptor materials under the condition of in vitro culture, thereby realizing the target gene transformation or modification of the leaf bud primordium, improving the genetic transformation rate, stability and repeatability of the plants and obtaining genetically transformed plants with high transformation rate.

Description

Method for improving genetic transformation efficiency of plants

Technical Field

The invention relates to a genetic transformation method, in particular to a method for improving the genetic transformation efficiency of plants, and belongs to the technical field of plant biology.

Background

Genetic transformation refers to a process of introducing an exogenous or endogenous target gene into a recipient plant genome by a certain genetic transformation method, or modifying a specific target gene of the recipient plant genome by means of a gene editing tool. There are two main genetic transformation methods, one is Agrobacterium-mediated method (Agrobacterium-mediated method), which mainly uses Agrobacterium tumefaciens Ti plasmid to integrate the target gene or editing tool into the genome of recipient plant to achieve expression or modification, among which the Leaf disc transformation method (Leaf disc transformation) invented by Horsch et al (1985) is most commonly used; the second is the particle gun method (particle Bombardment), which is a method of expressing or modifying a target gene or an editing tool into the genome of a recipient plant by using high-speed microprojectiles (Sanford et al, 1987). In addition, there are a pollen-tube path method (polen-tube path) established by Zhou Guangyu et al (1983), a nanomaterial transformation method, and the like. The efficient genetic transformation technology is a key technical link for realizing molecular design breeding such as transgenosis, gene editing and the like.

The establishment of a stable and efficient plant genetic transformation system is a prerequisite for realizing molecular design breeding. Since Zambryski et al (1983) successfully obtained transgenic tobacco by using Agrobacterium tumefaciens Ti plasmid as a transformation vector, the construction and research of genetic transformation systems of different plants and different genotypes of the same plant have been explored, a series of genetic transformation systems of important plants, flowers and plants, forest trees, fruit trees and the like are established, and transgenic plants with different excellent characters are obtained (Wangxin et al fruit tree transgenic research progress [ J ]. Shanxi agricultural science, 2016,44 (01): 123-125+130; wangliping et al soybean genetic transformation method and regeneration system research progress [ J ]. Guangdong agricultural science, 2020,47 (03): 16-27; diCan et al, development status of transgenic crops worldwide [ J ]. Scientific and transmission, 2020,12 (24): 29-31+48; zhang Yuan et al, research progress of agrobacterium mediated gramineous forage grass genetic transformation [ J ]. Shanghai university (Nature edition), 2021,50 (01): 21-27). However, in general, the genetic transformation rate of plants is relatively low, and there is a major problem in that a large number of adventitious buds can be obtained, but relatively few adventitious buds in which genetic transformation is achieved after detection. Only if the cause of the problem of low genetic transformation rate is found, a method for effectively solving the related problem can be provided.

It is generally considered that regeneration of plant in vitro culture receptor materials such as plant leaves and stem segments is mostly generated by transferring parenchyma cells, epidermal cells and vascular bundle sheath cells around vascular bundles in incisions and their vicinities to a dedifferentiation state and carrying out cell division to generate meristematic cell clusters (cytohistological observation of callus formation of tea leaves [ J ]. Tea leaves, 1995 (02): 11-13; dunxin et al, physiological and biochemical changes (brief report) during dedifferentiation and redifferentiation of strawberry in vitro leaves [ J ]. Plant physiological communication, 2000 (03): 209-211; pengliping et al, establishment of Isatis indigotica ex leaf high-frequency regeneration system [ J ]. Anhui institute of science and technology, 2007 (04): 14-17). Most of adventitious bud regeneration is that some regions of non-embryogenic callus are activated to express WUS and CUC2 genes under the regulation and control of cytokinin with higher concentration, so that leaf bud primordial cells are induced to form, and then adventitious buds are regenerated (Gordon et al, 2007. The plant genotype obviously influences the regeneration capacity of explants, and the regeneration capacity of different varieties of the same species has great difference; and explant material of different ages showed different adventitious bud regeneration rates. This is mainly due to the different explant materials responding differently to different induction media and other conditions.

From the aspect of inducing chromosome doubling of somatic cells of in vitro cultured plants, the difference of the development states of explants with different genotypes is an important reason for inconsistent chromosome doubling conditions of the somatic cells. The research finds that the regeneration capacity of the leaves with different genotypes has obvious difference when the colchicine solution is applied for treatment under the same culture condition. Xu et al (Xu Congping, et al. In Vitro tetraploid Plants regeneration from leaf explants of multiple genes in Populus [ J ]. Plant Cell Tissue & organic Culture An International Journal on Vitro Culture of high Plants, 2016.) also found that the optimal conditions for chromosome doubling of progeny sterile seedlings of poplar hybrids of different genotypes were not the same. The development state of the explant during the in vitro culture is not only related to the culture conditions such as culture components, light, temperature, etc., but also depends on the differentiation culture time of the explant (Cai X, kang, xy. In vitro tetraploid introduction from leaf explants of Populus pseudo-simonii kit [ J ]. Plantant CELL REP, 2011).

The same problem should exist with differences in the genetic transformation rates of different plant materials. Since the effective treatment period for chromosome doubling is near the metaphase of mitosis in a cell, genetic transformation should be earlier than the effective treatment period for chromosome doubling.

It is well known that homologous recombination typically occurs after the S phase of the cell cycle, a process of DNA replication. Due to the fact that response time differences exist between different plants, different genotypes of the same plant and different age materials of the same genotype to the induction of the culture conditions, the difference exists in the optimum transformation time of the receptor materials of different sources. Therefore, the transformation efficiency of different genotypes of the same plant is different, for example, the genetic transformation efficiency of soybean is between 0% and 29.3%, and generally between 2% and 6% (Wangliping et al, the research on the genetic transformation method and regeneration system of soybean advances [ J ]. Guangdong agricultural science, 2020,47 (03): 16-27). For this reason, although a great deal of research is conducted on aspects such as explant selection, agrobacterium strain and bacterial liquid concentration, infection concentration and infection time, illumination and co-culture time, acetosyringone and hormone treatment conditions, and the like, genetic transformation systems of related plants are continuously optimized, the genetic transformation rate still fluctuates greatly, and a stable and efficient genetic transformation system is difficult to establish. Although studies have suggested that culturing dedifferentiated callus prior to Agrobacterium transformation or biolistic transformation could improve the physiological activity of the receptor and facilitate optimal transformation efficiency (Vain et al, 1993; zhang Yue et al, 2021), no indication is given as to the reason for the improvement in transformation efficiency, nor is any technical approach proposed as to how to differentiate the differentiation and culture time.

Disclosure of Invention

The invention aims to provide a method for improving the plant genetic transformation rate aiming at the technical problems of low genetic transformation efficiency, large fluctuation, difficult establishment of a stable and efficient genetic transformation system and the like in the existing plant genetic transformation process. The method of the invention relatively accurately controls the time for carrying out the genetic transformation of the target gene based on the development state of the receptor material, and obviously improves the genetic transformation rate of the plant. According to the method, the chromatin activation period of the leaf bud primordial cells, namely the optimal period of genetic transformation of the receptor material cells, is judged immediately according to the incision and the cell development state of the receptor material of the plants such as leaves, stem segments and the like which are cultured in vitro and the identification of the S period of the cell cycle, the timeliness of the genetic transformation such as agrobacterium infection or gene gun transformation and the like is enhanced, the ratio of the obtained target gene genetic transformation plants is obviously improved, and the stability of the obtained genetic transformation system can be ensured.

The technical problem to be solved by the invention is realized by the following technical scheme:

a method for improving the genetic transformation rate of plant includes such steps as differential culture of the aseptic explant receptor material; then the receptor material after the differential culture treatment is subjected to genetic transformation treatment.

The sterile plant explant receptor material is an in vitro sterile plant receptor material, and comprises leaves and stem sections of in vitro cultured plants, preferably leaves.

In particular, the explant recipient material is a sterile leaf disc of a plant, an incised or scratched leaf, a stem section from which axillary buds are excised, or the like.

Wherein the sterile plant receptor material is a leaf or stem section with nicks or cuts.

In particular, a leaf disc is manufactured by using a puncher; or shearing the vein perpendicularly by utilizing a shearing tool (such as scissors and a blade), and shearing off the main vein of the vein to form a sterile vein with a cut or a scratch; or the internode stem tip of the excised axillary bud between the sterile seedling leaves is cut off by a cutting tool (such as scissors) to form a sterile stem segment with an incision or scratch.

The incision or scratch is created by cutting the leaf blade out of the wound perpendicular to the main vein of the leaf blade; or cutting off the leaf space of the aseptic seedling by using a cutting tool (such as scissors) to cut off the internode of the axillary bud to form a stem section wound.

Particularly, for the middle part of the blade, the main vein is sheared and cut off perpendicular to the main vein, but the blade is not sheared off, and the shearing part of the middle part of the blade is basically in an axisymmetric structure along the main vein of the blade.

In particular, the plants are selected from poplar and tobacco.

In particular, the poplar is selected from silver adenophora poplar 84K; the tobacco is common tobacco.

Particularly, the plant explant receptor material is leaf and stem sections of silver-gland poplar 84K; tobacco lamina.

Wherein the differentiation culture treatment is to inoculate a sterile plant explant receptor material into a differentiation culture medium for differentiation culture.

The method comprises inoculating sterile plant receptor materials such as cut in-vitro culture leaf and stem into a differentiation culture medium, and performing differentiation treatment on the leaf and stem to induce formation of leaf bud primordium.

In particular, the differentiation medium for the differentiation culture treatment is: MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + agar 6g/L + sucrose 30g/L.

Particularly, when the plant receptor material is silver adenophora poplar 84K, the differentiation culture medium for differentiation culture is MS minimal medium + NAA 0.03-0.05mg/L +6-BA 0.3-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; when the plant receptor material is tobacco, the differentiation culture medium for differentiation culture is MS basic culture medium + NAA 0.01-0.02mg/L +6-BA 0.1-0.3mg/L + agar 6g/L + sucrose 30g/L; preferably MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + agar 6g/L + sucrose 30g/L.

In particular, the culture conditions of the differentiation culture treatment are: the culture temperature is 25 +/-2 ℃; the illumination is 1500-2500lx, preferably 2000lx; the illumination period is 10-16h light/8-14 h dark, preferably 16h light/8 h dark.

Wherein the genetic transformation treatment comprises the transformation treatment of the plant explant receptor material after the differentiation culture treatment; then inoculating the transformed receptor material on a selective differentiation culture medium and a selective rooting culture medium in sequence to perform selective culture of resistant plants.

Particularly, the genetic transformation treatment comprises the step of transforming the plant explant receptor material subjected to the differential culture treatment by adopting an agrobacterium infection method or a gene gun method; then the receptor material after transformation treatment is sequentially inoculated on a selective differentiation culture medium and a selective rooting culture medium to carry out selective culture on the resistant plants.

The agrobacterium infection method or the gene gun method is a conventional technical method. When the agrobacterium-mediated transformation is adopted for transformation treatment, the agrobacterium transforms a plant expression vector with a target gene to be genetically transformed, and the target gene to be genetically transformed is integrated into a plant receptor material. Genetic transformation is the integration of a gene of interest into the genome of a differentiation culture recipient material.

Wherein the conversion treatment comprises the following steps:

a) Soaking the plant receptor material subjected to differentiation culture treatment in an infecting bacterial solution, then taking out the plant receptor material and sucking the infecting bacterial solution on the surface of the receptor material;

b) And (3) inoculating the receptor material of the surface-infected bacterial liquid sucked dry into an infection-co-culture medium for infection-co-culture.

In particular, the soaking time in the infected bacterial liquid in the step A) is at least 10min, preferably 10-15min; the infection-co-culture medium in step B) is: MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + agar 6g/L + sucrose 30g/L.

The dip-co-culture medium in the dip-co-culture process is the same as a differentiation medium for differentiation culture of the receptor material.

In particular, the target gene to be genetically transformed can be a functional gene or transcription factor for growth and development, reproduction, stress resistance and the like.

In particular, the target gene to be genetically transformed is MYC2, SDD1, BZIP53 and other genes. In addition to the MYC2, SDD1, and BZIP53 genes, other transcription factors are suitable for use in the present invention.

Particularly, when the sterile plant receptor material is silver gland poplar 84K, the infection-co-culture medium is MS minimal medium + NAA 0.03-0.05mg/L +6-BA 0.3-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; when the sterile plant receptor material is tobacco, the infection-co-culture medium is MS minimal medium + NAA 0.01-0.02mg/L +6-BA 0.1-0.3mg/L + agar 6g/L + sucrose 30g/L; preferably MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + agar 6g/L + sucrose 30g/L.

The culture conditions for infection-co-culture were as follows: the co-culture temperature is 25 +/-2 ℃; dark culture is carried out for 2-3 days (usually 2 days).

The culture conditions such as culture temperature and light irradiation for the differentiation culture are the same as those in the prior art. The screening of the target gene transformed bud, the culture medium for rooting culture, the culture condition, the identification of the transgenic plant and the like are common methods, and the existing known methods in the field are all suitable for the invention.

Inoculating the receptor material on a selective differentiation culture medium, and carrying out screening culture on the resistant buds; and then inoculating the resistant bud to a selective rooting medium for rooting culture.

Wherein the selective differentiation medium is: MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L.

In particular, when the sterile plant receptor material is silver adenophora poplar 84K, the selective differentiation medium is as follows: MS minimal medium + NAA 0.03-0.05mg/L +6-BA 0.3-0.5mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L; when the sterile plant receptor material is tobacco, the selective differentiation medium is: MS minimal medium + NAA 0.01-0.02mg/L +6-BA 0.1-0.3mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/L; preferably MS + NAA 0.01mg/L +6-BA 0.2mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L.

In particular, the culture conditions for the resistant shoot selection treatment were as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. The culture time for the resistant bud selection is 1-3 weeks, usually (2. + -. 0.5) weeks.

In particular, before the resistant bud selection treatment, the method further comprises the step of washing the plant receptor material after the dip-co-culture treatment, wherein the washing treatment comprises the following steps: placing the plant receptor material subjected to infection treatment in distilled water containing cefuroxime and washing for at least 20min; then rinsed with distilled water at least 3 times for at least 2min each.

Wherein the concentration of the cefuroxime in the distilled water containing the cefuroxime is 40-260mg/L.

Particularly, when the receptor material is silver gland poplar 84K, the concentration of the cefuroxime in the distilled water containing the cefuroxime is 40-55mg/L, preferably 50mg/L; when the receptor material is tobacco, the concentration of the cefuroxime in the distilled water containing the cefuroxime is 240-260mg/L, preferably 250mg/L.

In particular, the washing time with distilled water containing cefuroxime is 20-30min, preferably 25min.

Wherein, when the sterile plant receptor material is silver adenophora poplar 84K, the selected rooting culture medium is 1/2MS minimal medium + NAA 0.01-0.03mg/L + IBA 0.03-0.05mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/L, preferably 1/2MS minimal medium + NAA 0.02mg/L + IBA 0.05mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L.

Wherein, when the sterile plant receptor material is tobacco, the selected rooting medium is as follows: MS minimal medium + IBA 0.3-0.5mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/, preferably MS minimal medium + IBA 0.4mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L.

In particular, the rooting culture conditions are as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. The rooting culture time is 2-4 weeks.

Wherein, before the genetic transformation treatment, the method also comprises the following steps of carrying out microscopic observation on the receptor material subjected to the differential culture treatment, and determining the development state of cells at the incision or scratch part of the receptor material; or the receptor material treated by differential culture is dyed by EdU, and the development state or development stage of the cells at the cut or scratch part of the receptor material is observed and determined; or carrying out fluorescent quantitative PCR detection on the receptor material subjected to differential culture treatment, carrying out fluorescent quantitative PCR detection on the expression condition of the cell cycle S-phase related genes of the receptor material, and then carrying out genetic transformation treatment on the receptor material.

In particular, microscopic observation of the subject material treated by the differential culture also includes determination of the morphology of the cut or scratched portion of the subject material.

In particular, the genetic transformation treatment is performed when the state of cell development at the incision or scratch site of the receptor material is observed as a state in which the bud primordial cell develops to the chromatin activation stage but does not yet develop to the mitosis stage, i.e., when the leaf bud primordial cell develops to the S stage of the cell cycle.

Before EdU staining treatment, incubation culture is carried out on the receptor material after differential culture treatment, wherein the culture medium for incubation culture is a differential culture medium containing 10 mu M EdU (5-Ethynyl-2 'deoxyuridine, 5-ethyl-2' -deoxyuridine).

The differentiation culture medium is MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + agar 6g/L + sucrose 30g/L.

When the plant receptor material is silver adenophora poplar 84K, the differentiation culture medium is MS minimal medium + NAA 0.03-0.05mg/L +6-BA 0.3-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; when the plant receptor material is tobacco, the differentiation culture medium is MS minimal medium + NAA 0.01-0.02mg/L +6-BA 0.1-0.3mg/L + agar 6g/L + sucrose 30g/L; preferably MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + agar 6g/L + sucrose 30g/L.

In particular, the culture conditions of the incubation culture are: the culture temperature is 25 +/-2 ℃; the illumination is 1500-2500lx, preferably 2000lx; the illumination period is 10-16h light/8-14 h dark, preferably 16h light/8 h dark.

In particular, edU staining of the recipient material, further comprising determining the number of S-phase cells at the incision in the recipient material; performing fluorescence quantitative PCR detection on the receptor material, wherein relevant genes including real-time fluorescence quantitative PCR detection comprise CDKB1;2, CDKD1;1 and CYCD6;1.

before genetic transformation treatment, observing the receptor material after differential culture treatment, determining the incision development state and the cell activation state under the anatomical condition of the receptor material, and then carrying out genetic transformation treatment on the receptor material. When the cells at the incision part of the receptor material reach the optimal treatment period of genetic transformation, the receptor material is timely subjected to genetic transformation treatment.

Before genetic transformation treatment, the receptor material is subjected to EdU staining, the corresponding period when the number of S-phase cells at the incision of the receptor material is maximum is determined, and then the receptor material is subjected to genetic transformation treatment. When the cells at the incision part of the receptor material reach the optimal treatment period of genetic transformation, the receptor material is timely subjected to genetic transformation treatment.

Before genetic transformation treatment, performing real-time fluorescent quantitative PCR detection on the receptor material to determine CDKB1 in the receptor material; 2, CDKD1;1 and CYCD6;1 is in the highest expression level, and then the recipient material is genetically transformed. When the cells at the incision part of the receptor material reach the optimal treatment period of genetic transformation, the receptor material is timely subjected to genetic transformation treatment.

Particularly, before the genetic transformation treatment, a body type microscope or a magnifier is adopted to observe the development state of the scratch or the cut of the receptor material subjected to the differentiation culture treatment; and observing the development state of the cells of the receptor material under an optical microscope by paraffin section.

Determining the period of the plant recipient material incision where the number of cells in the S phase of the cell cycle is the greatest by edU staining the recipient treatment prior to genetic transformation treatment; and (3) carrying out fluorescence quantitative PCR detection on the receptor treatment, and determining the time of the highest expression quantity of the related gene by the fluorescence quantitative PCR.

Wherein the relevant gene is CDKB1; 2. CDKD1;1 or CYCD6;1.

Through EdU staining, when a large number of cells emit green fluorescence and the number of cells in the S phase of the cell cycle is the maximum, genetic transformation is carried out on the receptor material; or determining the gene CDKB1 detected in the receptor material by a real-time fluorescent quantitative PCR method; 2, CDKD1;1 or CYCD6;1, i.e., the number of cells in the S phase of the cell cycle is the largest, the recipient material is genetically transformed.

In particular, when the receptor material is observed to develop until the bud primordial cell chromatin begins to activate, the receptor material is genetically transformed by applying an agrobacterium infection method or a gene gun method. The receptor material develops until the bud primordial cell chromatin begins to activate, in the S phase of the cell cycle.

In particular, when a transparent yellowish brown bulge begins to appear at the incision site of the recipient material and a small cell with thick cytoplasm, enlarged nucleus and darkened color is observed under paraffin section, the recipient material bud primordial cell chromatin begins to be activated and enters the S phase of the cell cycle, and the above-described genetic transformation treatment is preferably performed.

The cut parts of aseptic plant receptor materials such as leaves, stem segments and the like are cultured in vitro, transparent yellow brown bulges begin to appear, small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin sections, and when the receptor material cells are in the S phase of the cell cycle, the optimal period for applying genetic transformation is provided.

Observing the incision development of sterile plant receptor materials (in vitro culture leaves, stem sections and the like) by adopting a stereomicroscope; the development state of cells under the condition of paraffin section of the differentiation culture receptor material is observed by adopting an optical microscope, and the optimal period of genetic transformation treatment is selected when the bud primordial cells develop to the chromatin activation period but do not develop to the mitosis period (namely, the leaf bud primordial cells are in the S phase of the cell cycle).

When transparent yellow brown bulges appear at cut parts of sterile plant receptor materials such as leaves and stem sections in vitro culture, and small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under a paraffin section, the window period is the genetic transformation window period of the receptor material cells, namely when leaf bud primordial cells formed by cut differentiation of the sterile plant receptor materials such as the leaves and the stem sections in vitro culture are in the S period of the cell cycle, the window period is the optimal period for applying agrobacterium infection of a plant expression vector with a target gene or performing genetic transformation by adopting a gene gun method and the like.

The optimal treatment period of genetic transformation of the receptor material cells is that when the receptor material leaf bud primordial cells are in the chromatin activation period, transparent yellow brown bulges begin to appear at the incision parts of the receptor material, small cells with thick cytoplasm, enlarged nucleus and deepened color are observed under paraffin sections, or when the receptor material cells are in the cell cycle S period, agrobacterium infection of a plant expression vector with a target gene is applied or genetic transformation is carried out by adopting methods such as a gene gun method and the like.

The invention provides a method for improving the genetic transformation efficiency of plants, which comprises the steps of carrying out differentiation culture on a receptor material; in the differentiation culture process, judging the incision of the receptor material and the development state and period of cells; and (3) carrying out genetic transformation treatment on the receptor material.

The method comprises the steps of carrying out differentiation culture on a receptor material, judging the genetic transformation period, carrying out timely genetic transformation treatment, inducing cluster buds, screening transformed plants and the like.

The genetic transformation conditions and related operations (such as culture of tissue culture seedlings, preparation of vectors, identification of positive seedlings and the like) in the technical scheme of genetic transformation involved in the invention are the same as the conventional operations of genetic transformation of other plants in the prior art.

The genetic transformation period is judged by inoculating the sterile plant receptor materials such as isolated culture leaves, stems and the like which create cuts or partial scratches on a proper differentiation culture medium of the plant for culture and inducing the formation of leaf bud primordium;

in the differentiation culture process of the plant sterile receptor materials such as the in vitro culture leaves, stem sections and the like for creating the cut, a body type microscope or a magnifying glass is adopted to observe the cut development state of the in vitro receptor materials, and an optical microscope is adopted to observe the development state of paraffin section cells of the receptor materials. When the plant sterile receptor materials such as leaves, stem segments and the like are cultured in vitro, transparent yellow brown bulges appear at the cut parts, and small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under a paraffin section, the cell is in the chromatin activation stage of the leaf bud primordial cells, or the receptor material cells are determined to be in the S stage of the cell cycle through EdU staining or fluorescent quantitative PCR.

The technical links of cluster bud induction, transformed plant screening and the like adopt the conventional technical method in the field.

All the above mentioned methods are used for explant isolated culture, agrobacterium infection or genetic transformation by gene gun method, transformed plant detection, etc. by the techniques known or familiar to those skilled in the art.

Compared with the prior art, the invention has the following advantages:

the invention carries on microscope observation to the shape change of the cut of the receptor material and the development state of the receptor material cell, according to the shape change of the cut of the receptor material of different differentiation culture plants and the development state of the cell under the condition of the paraffin section of the receptor material, the development period of the leaf bud primordium is accurately judged, namely, the cut of the in vitro culture leaf begins to appear transparent yellow brown bulge, when observing the small cell with thick cytoplasm, enlarged nucleus and deepened color under the paraffin section; the cut part of the stem section cultured in vitro begins to lose water and shrink, the outer edge is obviously expanded, and when a large number of small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under a paraffin section (namely, the bud primordial cells develop to the chromatin activation period but not to the mitosis period, and the leaf bud primordial cells are in the cell cycle S phase), the optimal treatment period of genetic transformation is provided. Genetic transformation of the recipient material at this stage avoids the blindness of genetic transformation.

The method of the invention starts to generate transparent yellow brown bulges at the incision part of the receptor material, small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin section, when the receptor material cells are in the S phase of the cell cycle, the genetic transformation is carried out at the right time for the best time of implementing genetic transformation, namely the best treatment time of the genetic transformation of the receptor material cells, and then through the technical links of adventitious bud regeneration culture, propagation and the like, a large amount of stable genetic transformation plants with high transformation rate can be obtained. The method is based on the principle that the leaf bud primordium of different plant receptor materials is formed and the development process is different under the condition of in vitro culture, through observing the incision form and the cell development state of the receptor materials after culture, the genetic transformation is applied when the plant receptor material cells are in the S phase of the cell cycle, the target gene transformation or modification of most leaf bud primordium is realized when the leaf bud primordium cells are induced to develop to the chromatin activation phase, and the genetic transformation rate, the stability and the repeatability of the plants are obviously improved.

The method of the invention overcomes the problems that when the prior art directly applies genetic transformation treatment after cutting the receptor materials of the plant in vitro culture leaves, stem segments and the like, the genetic transformation efficiency is greatly fluctuated, and a stable and efficient genetic transformation system is difficult to establish due to different time for differentiating the leaf bud primordial cells of the in vitro culture receptor materials of different genotypes of different plants or the same plant or different time for entering a DNA replication period of the leaf bud primordial cells caused by the difference of culture conditions. The method ensures that the genetic transformation is processed in the receptor material leaf bud primordial cell chromatin activation period, namely the optimal processing period of the genetic transformation based on the proper processing period judgment of the genetic transformation, and obviously enhances the timeliness of the genetic transformation, so that the genetic transformation rate is not influenced by the difference of culture environment, species or genotype, and an important methodology foundation is laid for the high-efficiency genetic transformation of plants.

The method is based on the development state of the plant receptor material, the incision morphological change of the in vitro plant receptor material is observed through a stereoscopic microscope or a magnifying glass, the development state of cells under the paraffin section condition of the receptor material is observed through an optical microscope, or the EdU staining is used for determining the development of the cells of the receptor material to the S phase of the cell cycle, or the expression quantity of genes (CDKB 1;2, CDKD1 and CYCD6; 1) related to the cell development to the S phase of the cell cycle is detected through real-time fluorescence PCR detection, the genetic transformation time of a target gene is accurately controlled, the optimal processing time of the genetic transformation of the cells of the plant receptor material is accurately mastered according to the incision morphological change of the plant receptor material, the development state of leaf bud primordial cells, the number of the cells at the S phase or the expression condition of the related genes at the S phase, the genetic transformation time of the applied genetic transformation is accurately controlled, and the genetic transformation efficiency of the plant is obviously improved.

The method of the invention is different for different plants or different genotype receptor materials of the same plant, the formation of leaf bud primordium and the development process are different, only when the leaf bud primordium cells of the induced plant receptor materials develop to the S phase of the cell cycle, namely transparent yellow brown bulges begin to appear at the cut parts of the receptor materials, and small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin sections; when the greatest number of cells in S phase at the incision of the recipient material was observed by EdU staining; detecting CDKB1 in the plant receptor material by fluorescent quantitative PCR; 2. CDKD1;1 or CYCD6;1 when the plant is expressed obviously at high level, the genetic transformation is applied in time, thus realizing the transformation or modification of the target gene of the leaf bud primordium and obviously improving the genetic transformation rate, stability and repeatability of the plant.

Drawings

FIG. 1 is the stereomicroscope observation picture of the leaf differentiation culture day 3 of the silver adenophora poplar 84K in vitro culture;

FIG. 1A is a view of a paraffin section of Japanese poplar 84K isolated culture leaf cultured by differentiation culture at day 3;

FIG. 1B is the EdU staining pattern of the leaf of Populus argentea 84K isolated culture on day 3 of differentiation culture;

FIG. 1C shows the fluorescence quantitative PCR detection of CDKB1 in isolated culture leaf of Populus alba 84K; 2, CDKD1;1 and CYCD6; 1;

FIG. 2 is a stereomicroscope image of the stem section of the 84K isolated culture of Populus tremuloides at day 4 of the differentiation culture;

FIG. 2A is a view of a 4 th paraffin slice obtained by differentiation culture of 84K isolated culture stem of Populus tremuloides;

FIG. 2B is the EdU staining pattern of the isolated culture stem section of Populus argentifolia 84K at day 4 of differentiation culture;

FIG. 2C shows the fluorescence quantitative PCR detection of CDKB1 in isolated culture stem segments of Populus alba 84K; 2, CDKD1;1 and CYCD6;1 in the expression level;

FIG. 3 is a stereomicroscope image of the tobacco in vitro culture leaf on the 2 nd day of differentiation culture;

FIG. 3A is a view showing the differentiation culture of 2 nd fraxinus serrulata slice of tobacco in vitro culture lamina;

FIG. 3B is a staining pattern of EdU at day 2 of the differentiation culture of tobacco in vitro culture leaves;

FIG. 3C shows the fluorescence quantitative PCR detection of CDKB1 in tobacco in vitro culture leaves; 2, CDKD1;1 and CYCD6; 1;

FIG. 4 is the DNA agarose gel electrophoresis detection of Populus deltoides 84K tissue culture seedlings;

FIG. 5 shows DNA agarose gel electrophoresis detection of tobacco tissue culture seedlings.

Detailed Description

The invention is further described below in conjunction with specific embodiments, and the advantages and features of the invention will become more apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 Experimental materials and culture media

1. Experimental Material

1. The invention takes the sterile leaves and stem segments of the 84K tissue culture seedling of the silver glandular poplar and the sterile leaves of the tobacco tissue culture seedling as plant receptor materials for genetic transformation.

2. Plant growth regulator

The plant growth regulating substances used in the present invention are alpha-naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), indole-3-butyric acid (IBA).

3. Culture medium

(1) The composition or preparation method of the MS basic culture medium;

TABLE 1 MS culture medium (Murashige and Skoog, 1962)

Weighing the required agar and sucrose according to the amount of the required culture medium, pouring the agar and sucrose into sterile water with the volume of 3/4 of the volume of the culture medium to be prepared, adding an MS basic culture medium, fixing the volume to the final volume of the culture medium, measuring the alkalinity of the cultured amino acid by using a pH meter, and adjusting the pH value to 5.8-6.0 by using 1mol/L NaOH or 1mol/L HCl.

(2) Differentiation medium:

adding 0.005-0.05mg/L NAA, 0.1-0.5 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium, adjusting pH value to 5.8-6.0, and sterilizing at 121 deg.C for 15min, wherein:

silver gland poplar 84K: adding 0.05mg/L NAA, 0.5 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium; tobacco: 0.01mg/L NAA, 0.2 mg/L6-BA, 6g/L agar and 30g/L sucrose were added to the MS minimal medium.

(3) Infection-co-culture medium:

same as differentiation medium.

(4) Selecting a differentiation medium:

adding 0.005-0.05mg/L NAA, 0.1-0.5 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium, adjusting pH value to 5.8-6.0, sterilizing at 121 deg.C for 15min, adding 20-40mg/L kanamycin (Kan) and 150-250mg/L timentin (Tim) when the medium is cooled to below 50 deg.C, wherein:

silver gland poplar 84K: adding 0.05mg/L NAA, 0.5 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121 deg.C for 15min, cooling the medium to below 50 deg.C, adding 30mg/L kanamycin and 200mg/L timentin; tobacco: adding 0.01mg/L NAA, 0.2 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121 deg.C for 15min, and adding 30mg/L kanamycin and 200mg/L timentin when the medium is cooled to below 50 deg.C.

(5) Selection of rooting medium

Silver gland poplar 84K: adding 0.02mg/L NAA, 0.05mg/L IBA, 6g/L agar and 30g/L sucrose into 1/2MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121 deg.C for 15min, cooling the medium to below 50 deg.C, adding 30mg/L kanamycin and 200mg/L timentin; tobacco: adding 0.4mg/L IBA, 6g/L agar and 30g/L sucrose into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121 deg.C for 15min, cooling the medium to below 50 deg.C, adding 30mg/L kanamycin and 200mg/L timentin.

(6) Liquid suspension culture medium of genetic transformation infecting bacteria:

YEB liquid medium: 10g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, 20g/L agar, adding water to a constant volume of 1L, sterilizing at 121 ℃ for 15min, and adding 50mg/L kanamycin (Kan) and 25mg/L rifampicin (Rif) when the culture medium is cooled to below 50 ℃.

LB liquid medium: 5g/L of yeast extract, 10g/L of peptone, 10g/L of sodium chloride and 20g/L of agar, adding water to fix the volume to 1L, and sterilizing at 121 ℃ for 15min.

Example 2 differentiation and culture of Populus alba 84K in vitro leaf receptor Material, morphological dissection Observation and cell cycle S phase discrimination

1. Differentiation culture of silver adenophora poplar 84K

Cutting off the leaves of the 84K tissue culture seedlings of the silver adenophora populus growing for 4 weeks, cutting off the main vein perpendicular to the main vein by using a pair of scissors in a super clean workbench, cutting off wounds at the root part, the middle part and the tip part of each leaf, wherein the main vein is cut off and the middle part of each leaf is perpendicular to the main vein, but the leaves are not cut off, and the cut parts at the middle part of each leaf basically form an axisymmetric structure along the main vein of each leaf;

then, the cut leaves are respectively spread on culture dishes (with the diameter of 9 cm) filled with solid differentiation medium for culture (namely differentiation culture), wherein: the differentiation medium is: MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; the culture conditions are as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic observation of silver gland poplar 84K receptor material

2-1, stereoscopic microscope observation:

in the differentiation culture process, the in vitro culture leaves processed at different culture times are respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, the incision morphological characteristics of the 5 processed in vitro culture leaves at different culture times are recorded, and the callus appearance period is observed. Wherein: the leaf incision morphological change characteristics of the isolated culture under different culture time are shown in the table 2; microscopic observation on day 3 of culture is shown in FIG. 1.

2-2, observation by an optical microscope:

the leaves cultured for different times are cut into small pieces of 0.5cm multiplied by 0.5cm, then the small pieces are quickly placed into a penicillin bottle filled with FAA stationary liquid (5 mL of 38% formaldehyde, 5mL of glacial acetic acid and 90mL of 50% ethanol), air in the bottle is sucked out by a needle cylinder (the material is sunk into the bottom of the bottle, and the stationary liquid can be quickly infiltrated into the material), and then the bottle is placed in a refrigerator at 4 ℃ for storage. The method comprises the steps of dehydrating materials in 70% ethanol (1 h), 80% ethanol (1 h) and 100% ethanol (1/3 h) in sequence during flaking, and then performing transparency and wax immersion treatment on the materials in a 1/2 xylene +1/2 alcohol solution (1.2 h), a pure xylene solution (0.5 h), a 1/2 xylene +1/2 paraffin (60 ℃, overnight), a pure paraffin (2 h) and a pure paraffin (2 h). Pouring the paraffin-impregnated material into a pre-stacked kraft paper box for embedding, and adjusting the position of the material in time by using tweezers to enable the material to be in the same plane. The wax block was cooled, trimmed with a razor blade, sliced (thickness 8 μm), and then subjected to dewaxing and transparentization. The section staining method comprises the following steps: carrying out 1% safranine staining solution (24 h), washing with tap water (10 min), 50% ethanol (2 min), 70% ethanol (2 min), 85% ethanol (2 min), 95% ethanol (2 min), 0.1% fast green staining (dropping staining for 10-20 s), 95% ethanol (2 min) and 100% ethanol (2 min), and preparing the 84K leaf paraffin sections of the populus argentifolia. All materials were observed under an Olympus BX-51 microscope and photographed. The anatomical characteristics of the leaves cultured ex vivo at different culture times are shown in Table 2, and the observation of paraffin sections under an optical microscope is shown in FIG. 1A.

TABLE 2 morphological dissection characteristics of 84K isolated culture leaf blades in different culture times

3. Cell cycle S phase identification

3-1, edU staining

The EdU staining method can accurately locate cells in the S phase of the cell cycle and enable the cells to emit green fluorescence. The invention adopts an EdU staining method to stain the 84K leaves of the silver adenophora populus cultured in vitro at different time and observe the distribution condition of the fluorescence signal.

Placing 84K leaf materials of the populus argentis subjected to differential culture for 1d, 2d, 3d, 4d and 5d in the step 1) on a differential medium (MS minimal medium +6g/L agar +30g/L sucrose +0.05mg/L NAA +0.5 mg/L6-BA) containing 10 mu M EdU (5-Ethynyl-2 'deoxyuridine, 5-ethyl-2' -deoxyuridine), respectively, and performing incubation culture under incubation culture conditions: the culture temperature is 25 +/-2 ℃; the illumination is 2000lx (typically 1500-2500 lx); the light period is 16h light/8 h dark (usually 10-16h light/8-14 h dark).

After incubation and culture of the leaves for 24h, washing the incubated and cultured leaf materials with PBS for 3 times, fixing the incubated and cultured leaf materials with paraformaldehyde fixing solution with the concentration of 4%, then carrying out light-proof treatment for 30min, and then washing the incubated and cultured leaf materials with PBS for 3 times; then treating with 0.5% Triton X-100 for 15min to promote EdU infiltration into cells; then according to

The fluorescence agent was added at the steps described in the 488Click-iT EdU Imaging Kits (BN 16015, biorigin, beijing) instructions and the fluorescence display treatment was carried out (i.e., 1mL of Click-iT reaction mixture (860. Mu.L of 1 XClick-iT EdU reaction buffer + 40. Mu.L of CuSO4+ 2. Mu.L of CuSO 4) was added

488Azide +100 μ L1 × reaction buffer solution additive) to the permeation-promoted leaf material, incubating for 30min at room temperature in the dark, and washing the leaves with PBS2 times), after removal of the washing solution, the column was examined in a confocal laser microscope (Leica TCS SP8; leica, wetzlar, germany) under the following observations: the number of cells stained by EdU (green fluorescence), chloroplast autofluorescence signal (red fluorescence), bright field (no fluorescence signal, only cell contour and morphology are shown), and co-localization (green fluorescence from EdU and red fluorescence from chloroplast and bright field, superimposed images of the three) under the channel were imaged and analyzed for the difference in the number of cells in the S phase of the cell cycle in the leaves cultured at different times.

The results showed that only a very small amount of green fluorescent S phase cells were observed in the leaf of Populus alba 84K on day 1 of differentiation culture, and a little more S phase cells began to appear on day 2 of culture. When the silver gland poplar 84K leaves are cultured on the 3 rd day, a large number of S-phase cells appear and are in a DNA replication phase, and the quantity of the S-phase cells reaches a peak value and is uniformly distributed at the cut parts of the leaves. At day 4 of culture with the silver adenophora poplar 84K leaf, the number of cells in S phase began to decrease, and it was presumed that a large number of cells began to enter G2 phase or division phase. When the silver gland poplar 84K leaves are cultured on the 5 th day, the number of cells in the S phase is obviously reduced, and the cells are scattered at the edges of the incision. In conclusion, it is assumed that the 84K leaf of Populus tremuloides is most suitable for genetic transformation at day 3 of culture. The number of cells in the EdU staining S phase of the poplar 84K leaf of silver gland on day 3 of differentiation culture is shown in FIG. 1B.

3-2, fluorescent quantitative PCR detection

And (3) separating and extracting total RNA from the 84K leaves of the populus argentis after differentiation culture of 0d, 1d, 2d, 3d, 4d and 5d in the step 1) by using a plant total RNA extraction kit (Tiangen, china, cat DP 432). The quality and concentration of RNA was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, waltham, mass., USA). First strand cDNA was synthesized from total RNA using a cDNA synthesis kit (Tiangen, china, cat KR 106). Use of

A Top Green qPCR SuperMix (TRANSGEN, china, cat AQ 132-22) kit and a reaction system thereof carry out real-time quantitative polymerase chain reaction (RT-qPCR) on an Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument and determine PagCDKB1; 2. PagCDKD1;1And PagCYCD6;1 in the expression level;

the reaction system of Top Green qPCR SuperMix kit is shown in Table 3.

TABLE 3

Reaction system of Top Green qPCR SuperMix kit

The reaction conditions for RT-qPCR are shown in Table 4.

TABLE 4 reaction conditions for RT-qPCR

Gene-specific primers were obtained by direct query of primer data qPrimerDB (https:// biodb. Swu. Edu. Cn/qPrimerDB) (see Table 5). The 2- Δ Δ Ct method was used to calculate the relative expression level of the gene. PagACTIN is an internal reference gene whose Ct value is used as a control to calculate PagCDKB1; 2. PagCDKD1;1 and PagCYCD6;1 in the expression level.

Table 5 RT-qPCR primers table:

the result shows that the cyclin kinase PagCDKB1 which acts in the S phase when the 84K poplar leaves are subjected to differential culture for 0-5 days; 2. PagCDKD1;1 and the cyclin PagCYCD6;1, and reached a peak at day 3, which was presumed to be most suitable for genetic transformation, and the specific expression results are shown in FIG. 1C.

The results in FIG. 1C show that 3 genes, which are expressed in the highest amount on day 3 of differentiation culture, are consistent with the purpose of EdU staining and indicate the S phase of the cell cycle, and since the highest expression of these three genes is the S phase, the S phase of the cell cycle can be determined by detecting the expression of these 3 genes, and genetic transformation can be performed at this time.

Example 2A differentiation culture of Populus alba 84K isolated stem segment receptor material, morphological dissection observation and differentiation of cell cycle S phase

1. Differential culture

Cut the silver gland poplar 84K tissue culture seedling plant of 4 weeks of growth, cut the internode stem segment of two leaves with the scissors in the superclean bench, cut off the axillary bud simultaneously, then in tiling the stem segment after cuting respectively to the culture dish (diameter is 9 cm) that is equipped with solid differentiation medium, cultivate (differentiation culture promptly), wherein: the differentiation culture medium is as follows: MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; the culture conditions were as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic examination of the receptor Material

2-1, observing by a body type microscope:

during the differentiation culture process, the isolated culture stem segments treated at different culture times were respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, and the incision morphological characteristics of the isolated culture stem segments treated at 5 different culture times and the period of callus appearance were recorded, wherein: the shape change of the cut of the isolated culture stem section on the 4 th day of the differentiation culture is shown in figure 2; the cut morphology of the stem sections cultured ex vivo at different culture times is shown in Table 6.

2-2, observation by an optical microscope:

internodal stem sections cultured for different periods between two leaves were quickly placed in penicillin vials containing FAA fixative (5 mL 38% formaldehyde +5mL glacial acetic acid +90mL 50% ethanol), and then paraffin sections of the stem sections were prepared according to the "step 2-2, optical microscopy" method of example 2. All materials were observed under an Olympus BX-51 microscope and photographed. Wherein: the development state of the stem section cut paraffin section cells is shown in table 6 in vitro culture at different culture time, and paraffin section observation under an optical microscope is shown in fig. 2A.

TABLE 6 morphological dissection characteristics of 84K isolated culture stem segments at different culture times

3. Cell cycle S phase identification

3-1, edU staining

The method adopts an EdU staining method to stain the silver gland poplar 84K stem segments cultured in vitro at different time and observe the distribution condition of fluorescence signals.

Placing the stem segment materials of the poplar 84K with silver gland cultured for 1d, 2d, 3d, 4d and 5d in the step 1) on a differentiation medium (MS basic medium +6g/L agar +30g/L sucrose +0.05mg L-1NAA +0.5mg L-1-BA) containing 10 mu M EdU respectively, and performing incubation culture under the culture conditions of incubation culture: the culture temperature is 25 +/-2 ℃; the illumination is 2000lx (typically 1500-2500 lx); the light period is 16h light/8 h dark (usually 10-16h light/8-14 h dark).

After the stem section incubation culture for 24 hours, the subsequent steps were the same as in step 3-1) of example 2 except that the incubated stem section material was washed 3 times with PBS.

Finally, the observation was carried out under a laser confocal microscope (Leica TCS SP8; leica, wetzlar, germany): the number of cells stained by EdU (green fluorescence), chloroplast autofluorescence signal (red fluorescence), bright field (no fluorescence signal, only cell contour and morphology are shown), and co-localization (green fluorescence from EdU and red fluorescence from chloroplast and bright field, superimposed images of the three) under the channel were imaged and analyzed for the difference in the number of cells in the S phase of the cell cycle in the 84K poplar stem segment cultured at different times.

The result of EdU staining of the stem segments of Populus alba 84K showed that the cells in the S phase of the cell cycle began to appear after 1 day of differentiation culture and gradually increased from day 1 to day 4 to reach the maximum amount at day 4. However, by day 5, the number of S phase cells decreased. Therefore, the genetic transformation treatment effect is supposed to be the best after the 84K stem section of the populus argentifolia is cultured for 4 days. The number of cells in the S phase of the grown Populus alba 84K stem section EdU stained on day 4 is shown in FIG. 2B.

3-2, fluorescent quantitative PCR detection

The subsequent steps and reaction system, reaction conditions and primers were the same as those in step 3-2 of example 2, except that total RNA was isolated from the 84K stem segments of Populus tremuloides after differentiation culture 0d, 1d, 2d, 3d, 4d and 5d in step 1) using a plant total RNA extraction kit (Tiangen, china, cat DP 432), respectively.

The results show that PagCDKB1;2,pagcdkd1;1 and PagCYCD6;1 is expressed in the highest level when the cell cycle of a large number of cells is in S phase, namely, the 4 th day of differentiation culture. The expression level of the stem of the 84K poplar was gradually increased on days 1-4, and decreased on day 5. Therefore, the genetic transformation treatment effect is supposed to be the best after the silver gland poplar 84K stem section is cultured for 4 days. The expression level results are shown in FIG. 2C.

The results in FIG. 2C show that all 3 genes expressed in the highest amounts on day 4 of culture, which is consistent with the goal of EdU staining, are indicative of cell cycle S phase, since the phase in which these three genes are expressed in the highest amounts is S phase, and thus genetic transformation is most appropriate. The optimal conversion treatment period for the stem segments here is day 4.

Example 2B tobacco Ex vivo leaf receptor Material differentiation culture, morphological dissection Observation and cell cycle S phase discrimination

1. Differentiation culture of receptor material

Cutting 2 nd, 3 rd and 4 th completely unfolded leaves of the aseptic tobacco seedlings with the age of about 15d in a super clean bench, cutting the leaves into 2 pieces by 1 knife of longitudinal main vein cutting of the leaves, and cutting 2 knives longitudinally on each leaf without completely cutting the leaves;

the cut leaves are spread on a culture dish (with the diameter of 12 cm) filled with a solid differentiation medium for culture (namely differentiation culture), wherein the differentiation medium is as follows: MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + agar 6g/L + sucrose 30g/L; the culture conditions were as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic examination of leaf receptor material

2-1, stereoscopic microscope observation:

in the process of tobacco leaf differentiation culture, the in vitro culture leaves processed at different culture times are respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, the incision morphological changes of the 5 processed in vitro culture leaves at different culture times are recorded, and the callus appearance period is observed. Wherein: the cut morphology changes of the leaf blades cultured in vitro at different differentiation culture time are shown in the table 4; the incision morphology changes on day 2 of differentiation culture under a stereomicroscope are shown in FIG. 3.

2-2, optical microscope observation:

tobacco leaves cultured for different periods of time by differentiation were cut into small pieces of 0.5cm × 0.5cm, and then quickly placed into penicillin vials containing FAA fixative (5 mL of 38% formaldehyde +5mL of glacial acetic acid +90mL of 50% ethanol), followed by preparation of paraffin sections of tobacco leaves by the method of "step 2-2, optical microscopy" of example 2. All materials were observed under an Olympus BX-51 microscope and photographed. Wherein: the characteristics of the tobacco leaf cells cultured in vitro at different culture times are shown in Table 7, and the observation of the paraffin section under an optical microscope is shown in FIG. 3A.

TABLE 7 morphological characteristics of tobacco leaves cultured in vitro at different culture times

3. Cell cycle S phase identification

3-1, edU staining

And adopting an EdU staining method to stain tobacco leaves cultured in vitro at different time and observing the distribution condition of fluorescence signals.

Respectively placing tobacco leaf pieces subjected to differentiation culture 1d, 2d, 3d, 4d and 5d in the step 1) on a differentiation culture medium (MS minimal medium +6g/L agar +30g/L sucrose +0.05mg L-1NAA +0.5mg L-1-BA) containing 10 mu M EdU, respectively carrying out incubation culture, wherein the incubation culture conditions are as follows: the culture temperature is 25 +/-2 ℃; the illumination is 2000lx (typically 1500-2500 lx); the light period is 16h light/8 h dark (usually 10-16h light/8-14 h dark).

The subsequent steps were the same as in step 3-1) of example 2, except that after incubation of tobacco leaves for 24 hours, the incubated leaf material was washed 3 times with PBS.

Finally, the number of cells stained by EdU (green fluorescence), chloroplast autofluorescence signal (red fluorescence), bright field (no fluorescence signal, only shows cell contour and morphology), and co-localization (green fluorescence emitted by EdU, red fluorescence emitted by chloroplast and bright field, and superposition images of the three) under a laser confocal microscope (Leica TCS SP8; leica, wetzlar, germany) are respectively observed and photographed, and the cell number difference of the S phase of the cell cycle in tobacco leaves cultured at different times is analyzed.

The result of EdU staining of tobacco leaves showed that S-phase cells appeared from day 1 and a large number of S-phase cells appeared on day 2, reaching a peak. The number of green-fluorescing S-phase cells decreased again on subsequent days 3-5. In conclusion, it is assumed that the tobacco leaves are best treated by genetic transformation at the 2 nd day of differentiation culture. The number of EdU stained S phase cells from tobacco leaves at day 2 of culture is shown in FIG. 3B.

3-2, fluorescent quantitative PCR detection

The following steps, reaction system and reaction conditions were the same as in step 3-2 of example 2, "fluorescent quantitative PCR assay" except that total RNA was isolated from tobacco leaves cultured at 0d, 1d, 2d, 3d, 4d and 5d in step 1) using a plant total RNA extraction kit (Tiangen, china, cat DP 432), respectively.

Wherein: gene-specific primers were obtained by direct query of primer data qPrimerDB (https:// biodb. Swu. Edu. Cn/qPrimerDB) (see Table 8). The 2- Δ Δ Ct method was used to calculate the relative expression level of the gene. NtACTIN is an internal reference gene, and the Ct value thereof is used as a control, thereby calculating NtCDKB1;2, ntcdkd1;1 and NtCYCD6;1 in the expression level.

TABLE 8 RT-qPCR primers

Name of primer	Primer sequences
		NtActin-F	CCACACAGGTGTGATGGTTG
NtActin-R	GTGGCTAACACCATCACCAG
		NtCDKB1；2-F	ATAAAGCAAAGGACAAGGCGA
NtCDKB1；2-R	ACACAGAGGAGACGAACGAT
		NtCDKD1；1-F	TCTTCCTCTCACCTGCGGAT
NtCDKD1；1-R	GGCAAAGACCTGGTGAGTGA
		NtCYCD6；1-F	CTAAAAGCCAGAGCCACTGAGA
NtCYCD6；1-R	CGTGAGAAGCACAGAGAAGAG

The results show that NtCDKB1, which functions in S phase; 2, ntcdkd1;1 and NtCYCD6;1 the highest expression level on day 2 of culture. Wherein, ntCDKB1;2, minimal expression at day 0, and NtCDKD1;1 and NtCYCD6; the expression level of 1 increases from day 0 to day 2 and decreases again from day 2 to day 5. Therefore, we speculate that the tobacco leaves are best treated by genetic transformation at the 2 nd day of culture. The expression level is shown in FIG. 3C.

The results in FIG. 3C show that all 3 genes expressed in the highest amounts on day 2 of culture, which is consistent with the goal of EdU staining, are indicative of cell cycle S phase, since the phase in which these three genes are expressed in the highest amounts is S phase, and thus genetic transformation is most appropriate. The optimum conversion treatment period for the tobacco lamina herein is day 2.

Example 3 genetic transformation of 84K leaves of Populus alba

1. Preparation of infection bacterial liquid

According to the existing preparation method of the impregnation bacteria in the field

Constructing a target gene (MYC 2) on an expression vector (PBI 121) by adopting a seamless cloning method to obtain a vector plasmid (MYC 2-PBI 121) with a target gene segment; then transformed into the GV3101 Agrobacterium competent form (from Diego biosciences); then picking up single clone on the plate, using the sequence of 35S on the expression vector (PBI 121) as an upstream primer F and a sequence on the target gene as a downstream primer R, carrying out colony PCR detection, then picking up positive single colony, inoculating into 50ml (each bottle) of YEB liquid culture medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, adding water to fix the volume to 1L, sterilizing at 121 ℃ for 15 min), carrying out liquid suspension culture, wherein the liquid suspension culture temperature is 28 ℃ (usually 27-29 ℃); the rotating speed is 180-200rpm; culturing until the bacterial liquid is uniform and consistent, and the OD of the bacterial liquid ₆₀₀ To 0.6 to 0.8 (usually OD) ₆₀₀ 0.6-0.8) to obtain the infection bacterial liquid.

The target gene for genetic transformation in the method of the present invention is an isolated DNA molecule (plasmid and chromosomal DNA) of homologous or heterologous, i.e., a gene transferred into a plant to be genetically transformed, and in the specific embodiment of the present invention, a transcription factor, a functional gene for growth, development, reproduction, stress resistance, etc., are used as the target gene, wherein the target gene in the embodiment is exemplified by transcription factor MYC2, and other functional genes or transcription factors, such as BZIP53, are all suitable for the present invention.

The expression vector in the embodiment of the present invention is exemplified by PBI121, and other expression vectors known in the art except PBI121 are suitable for the present invention, such as pCambia1304, praklii, etc.

The GV3101 Agrobacterium strain competence transformation steps are as follows:

firstly: taking agrobacterium tumefaciens strain preserved at the temperature of minus 80 ℃, and inserting the agrobacterium tumefaciens strain into ice when the agrobacterium tumefaciens strain is in an ice-water mixed state after the agrobacterium tumefaciens strain is partially melted at room temperature;

then: adding 0.01-1 μ g plasmid DNA (which is a vector plasmid with a target gene fragment obtained after a target gene is constructed on a PBI121 vector, the transformation efficiency is high, the amount of the added plasmid is preferably determined by a preliminary experiment before the first use) into each 100 μ l of agrobacterium infection state, stirring the tube bottom, uniformly mixing, and then sequentially standing on ice for 5min, liquid nitrogen for 5min, 37 ℃ water bath for 5min and ice bath for 5min;

and then: adding 700 μ L of LB medium (5 g/L yeast extract, 10g/L peptone, 10g/L sodium chloride, adding water to fix volume to 1L, sterilizing at 121 deg.C for 15 min) or YEB liquid medium without antibiotics, and shake-culturing at 28 deg.C for 2-3 h.

Then: centrifuging at 6000rpm for 1min, discarding part of supernatant, collecting about 100 μ l of supernatant, slightly blowing off the centrifuged precipitate, re-suspending the precipitate, coating on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-4 days until the plate is full of bacterial colony; wherein:

the LB or YEB plate culture medium containing the corresponding antibiotics comprises the following components: LB or YEB plate medium contains 50 mu g/ml Kan or 50 mu g/ml Kan and 20 mu g/ml Rif or 50 mu g/ml Rif; when the plate only contains 50 mu g/ml Kan, culturing at 28 ℃ for 48 h; adding Kan 50 μ g/ml and Rif 20 μ g/ml simultaneously into the plate, and culturing at 28 deg.C for 60 hr; if the plate used contains 50. Mu.g/ml of Rif, 28 ℃ incubation is required for 72-90h.

2. Infestation treatment

Respectively soaking the isolated leaves of the silver gland poplar 84K which are not subjected to differentiation culture (0 day) and are subjected to differentiation culture for different time periods (1, 2, 3, 4 and 5 days) in the infected bacterial liquid prepared in the step 1) for 15min (usually 10-15 min); then taking out the leaves and sucking the bacterial liquid on the surfaces of the leaves by using sterile filter paper; and then, respectively spreading the leaves into culture dishes (the diameter is 9 cm) filled with infection-co-culture mediums, and carrying out infection treatment under dark conditions, wherein: the infection-co-culture medium is: MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + agar 6g/L + sucrose 30g/L; infection-co-culture conditions: the co-culture temperature is 25 +/-2 ℃; dark culture for 2-3 days (usually 2 days) to obtain infection-isolated leaf.

3. Screening treatment of resistant shoots

Respectively placing infection-isolated leaves subjected to infection treatment for 2-3 days in distilled water containing cefuroxime for washing for 25min (usually 20-30 min), wherein the concentration of the cefuroxime in the distilled water containing the cefuroxime is 50mg/L (usually 40-55 mg/L); then washing with distilled water for 3-5 times, each time for 2min, and sucking water with sterilized filter paper; then, the leaves are respectively paved into culture dishes filled with selective differentiation culture media, screening treatment of resistant buds is carried out, and the selective differentiation culture media are as follows: MS minimal medium + NAA 0.05mg/L +6-BA 0.5mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L; the culture conditions for the resistant bud selection treatment were as follows: the culture temperature is 25 +/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the resistant bud is screened and cultured for about 1 week, the wound of the leaf begins to deform, the leaf is waved, and the resistant bud grows out about 2 weeks.

4. Rooting culture of resistant buds

When the resistant buds growing on the selective differentiation culture medium grow to 1-2cm, respectively shearing the resistant buds by using sterile scissors, respectively inoculating the resistant buds to a selective rooting culture medium, and carrying out rooting culture, wherein the selective rooting culture medium comprises: 1/2MS minimal medium + NAA 0.02mg/L + IBA 0.05mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. The rooting culture time is 2-4 weeks, and the regeneration plant is obtained.

In the pretreatment process, the infection treatment is carried out according to the incision morphological change of the receptor material and the developmental state of the primordial cells of the receptor material, and the number of the obtained regeneration plants is shown in the table 5. And when 3-4 completely unfolded leaves grow out from the regeneration plant, carrying out DNA detection on the regenerated plant.

5. Detection of resistant positive plants

DNA detection was carried out on plants obtained by the cultivation of the green roots, according to the operation of a novel plant genome DNA extraction kit (DP 320-03, tiangen Biochemical technology, beijing) Ltd.).

Grinding 1-2 leaves of the regenerated plant obtained after screening antibiotics with liquid nitrogen, extracting DNA with a novel plant genome DNA extraction kit of Tiangen Biochemical technology Co., ltd, and placing the collected DNA at-20 deg.C for use.

PCR amplification was performed using the extracted DNA as a template, and 10ul Taq enzyme and 8ul ddH were added to the PCR tube ₂ Performing PCR detection on a system with the total volume of 20ul of DNA, O, 0.5ul of primer F/R and 1ul of DNA, wherein an upstream primer F for PCR amplification is designed and synthesized according to a vector (PBI 121) sequence, and a downstream primer R is designed and synthesized according to a gene (MYC 2) sequence; f: CTATCCTTCGCAAGACCCTTC; r: GTTCTGCATTCTTTGAAAAA AT.

The PCR amplification primer is designed and synthesized according to the conventional method known in the art, namely, the upstream primer is designed and synthesized according to the gene sequence of the expression vector; the downstream primer is designed and synthesized according to the gene sequence of the target gene.

In this example, the upstream primer F was designed and synthesized based on the sequence of expression vector PBI121, and the downstream primer R was designed and synthesized based on the sequence of target gene MYC 2. The forward primer F is suitable for genetic transformation of all genes using PBI121 as a vector, and can be used as long as the vector is the same, because the primer is designed from the PBI121 vector sequence. However, the downstream primer R can be used only for the target gene, and since the sequence of each target gene is different, the downstream primer is also different.

PCR program, pre-denaturation at 94 ℃ for 4min, entering a cyclic amplification stage: cycling 30 times at 94 ℃ 30s,55 ℃ 30s,72 ℃ for 1 min; preserving the temperature at 72 ℃ for 5min, finishing the reaction, and storing the PCR product at 4 ℃.

Carrying out electrophoretic separation on the PCR product in 1.2% agarose gel at a constant voltage of 140V for 30min, detecting a target gene strip by using a gel imager, and judging that the plant is positive if the strip which accords with the length (1416 bp) of the target gene exists after electrophoretic detection; the electrophoresis detection is shown in figure 4, wherein the

marks

1, 2, 3, 4, 6 and 7 in figure 4 are positive; 5.8, 9 are false positives; 10 is a negative control (control 1), P is a positive control (control 1A), and M is Maker. The positive genetic transformation efficiency was calculated according to the formula (1), the measurement results are shown in Table 9, and the formula (1) is as follows:

genetic transformation efficiency (%) = number of positive seedlings/number of rooted seedlings x100% (1)

Example 3A genetic transformation of 84K Stem segments of Populus alba

1. Preparation of infection bacterial liquid

Same as in step 1) of example 3.

2. Infestation treatment

Soaking the 84K isolated stem segments of the populus tomentosa which are not subjected to differentiation culture (day 0) and are subjected to differentiation culture for different time (

days

1, 2, 3, 4 and 5) in the infecting bacterium solution prepared in the step 1) for 15min (usually 10-15 min); then taking out the stem section, and sucking the bacterial liquid on the surface of the stem section by using filter paper; then, the stem segments were spread in petri dishes (diameter 9 cm) containing infection-co-culture medium, respectively, and infection-co-culture treatment was performed under dark conditions, in which: the infection-co-culture medium was the same as in example 3; the culture conditions for infection-co-culture were as follows: the co-culture temperature is 25 +/-2 ℃; the infected-isolated stem sections were obtained by dark culture for 2-3 days (usually 2 days).

3. Screening for resistant shoots

Respectively placing the infection-co-cultured infection-isolated stem segments for 2-3 days in distilled water containing the cefuroxime for washing for 25min (usually 20-30 min), wherein the concentration of the cefuroxime in the distilled water containing the cefuroxime is 50mg/L (usually 45-55 mg/L); then respectively washing with distilled water for 3-5 times, each time for 2min, and sucking water with sterilized filter paper; then, the stem segments are respectively paved into culture dishes filled with selective differentiation culture media, screening culture of resistant buds is carried out, and the resistant buds are screened, wherein the selective differentiation culture media are the same as those in the embodiment 3; the culture conditions for the selection culture of the resistant buds are as follows: the culture temperature is 25 +/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the resistant bud is screened and cultured for about 1 week, the wound of the stem section begins to expand, and the resistant bud grows out about 2 weeks.

4. Rooting culture of resistant buds

Same as in step 4 of example 3.

5. Detection of Positive plants

Same as in step 5 of example 3. Positive genetic transformation efficiencies were calculated according to the formula (1), and the results are shown in Table 9.

Example 4 genetic transformation of tobacco leaves

1. Preparation of infection bacterial liquid

Constructing a target gene (BZIP 53) onto an expression vector (PBI 121) by adopting a seamless cloning method to obtain a vector plasmid (BZIP 53-PBI 121) with a target gene segment; then transformed into a GV3101 agrobacterium competent state; then picking up single clone on the plate, using 35S on an expression vector (PBI 121) as an upstream primer F and a sequence on a target gene as a downstream primer R to perform colony PCR detection, then picking up positive single colony and inoculating to 50ml (each bottle) of YEB liquid culture medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, water to be constant volume to 1L, sterilizing at 121 ℃ for 15 min) added with 50mg/L kanamycin and 25mg/L rifampicin, performing liquid suspension culture, wherein the temperature of the liquid suspension culture is 28 ℃ (usually 27-29 ℃); the rotating speed is 180-200rpm; culturing until the bacterial liquid is uniform and consistent, and the bacterial liquid OD ₆₀₀ To an OD of 0.6 to 0.8 (usually OD) ₆₀₀ 0.6-0.8) to obtain the infection bacterial liquid.

2. Infestation treatment

Soaking the tobacco excised leaves which are not subjected to differential culture (0 day) and are subjected to differential culture for different time (1, 2, 3, 4 and 5 days) in the example 2B in the infected bacterial liquid prepared in the step 1) for 15min (usually 10-15 min) in a super clean bench; then taking out the leaves and sucking the bacterial liquid on the surfaces of the leaves by using sterile filter paper; and respectively spreading the leaves into culture dishes (the diameter is 12 cm) containing a tobacco co-culture differentiation culture medium, and carrying out infection-co-culture treatment under dark conditions, wherein the infection-co-culture medium is as follows: MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + agar 6g/L + sucrose 30g/L; infection-coculture conditions were as follows: the co-culture temperature is 25 +/-2 ℃; dark culturing for 2-3 days to obtain infection-isolated leaf.

3. Screening for resistant shoots

Respectively placing the infection-isolated leaves which are subjected to infection co-culture for 2-3 days into distilled water containing the cefuroxime for washing for 20min (usually 20-30 min), wherein the concentration of the cefuroxime in the distilled water containing the cefuroxime is 250mg/L (usually 240-260 mg/L); then respectively washing with distilled water for 3-5 times, each time for 2min, and absorbing water on the surface of the leaves with sterile filter paper; then, the leaves are respectively paved into culture dishes filled with selective differentiation culture media, screening treatment of resistant buds is carried out, and the selective differentiation culture media are as follows: MS minimal medium + NAA 0.01mg/L +6-BA 0.2mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L; the culture conditions for the selection culture of the resistant buds are as follows: the culture temperature is 25 +/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; after the resistant bud is screened and cultured for about 10 days, the wound of the leaf begins to deform, the leaf is waved, and the callus and the bud are gradually grown and differentiated about 30 days.

4. Rooting culture of resistant buds

When the bud in the selective differentiation medium grows to about 1-2cm, shearing the bud by using sterile scissors, and then respectively inoculating the bud to a selective rooting medium for rooting culture, wherein the selective rooting medium comprises the following components: MS minimal medium + IBA 0.4mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25+ -2 deg.C, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. The rooting culture time is about 20d, and a regeneration plant is obtained.

During the pretreatment, the amount of the regenerated plants obtained by the dip dyeing treatment was determined according to the different states of callus development at the cut, as shown in Table 6. And when 3-4 completely unfolded leaves grow out from the plant, carrying out DNA detection on the plant.

5. Detection of Positive plants

DNA detection of plants obtained by the root growth culture was carried out according to the operation of a novel plant genome DNA extraction kit (DP 320-03, kyoto Biochemical technology, beijing, ltd.).

Taking 1 leaf blade which is completely expanded by the regeneration plant obtained after the antibiotic screening, adding liquid nitrogen and fully grinding. The novel plant genome DNA extraction kit (DP 320-03) of Beijing Tiangen Biochemical technology Co., ltd is used for extracting DNA according to the operation of the instruction, and the collected DNA is placed at-20 ℃ for standby.

PCR amplification was performed using the extracted DNA as a template, and 10ul Taq enzyme and 8ul ddH were added to the PCR tube ₂ Performing PCR detection on a system with the total volume of 20ul of DNA, O, 0.5ul of primer F/R and 1ul of DNA, wherein an upstream primer F for PCR amplification is designed and synthesized according to a vector (PBI 121) sequence, and a downstream primer R is designed and synthesized according to a gene (BZIP 53) sequence; f: CTATCCTTCGCAAGACCCTTC; r: TGAATTGTGGCCGTTTTAC.

In this example, the upstream primer F was designed and synthesized based on the sequence of the expression vector PBI121, and the downstream primer R was designed and synthesized based on the sequence of the target gene BZIP 53.

PCR program, pre-denaturation at 94 ℃ for 4min, entering the cyclic amplification stage: cycling 30 times at 94 ℃ 30s,55 ℃ 30s,72 ℃ for 1 min; preserving the temperature at 72 ℃ for 5min, finishing the reaction, and storing the PCR product at 4 ℃.

Carrying out electrophoretic separation on the PCR product in 1.2% agarose gel at constant voltage of 140V for 20min, using a gel imager to check a target gene band, and judging the plant to be positive if a band which accords with the length (432 bp) of the target gene is observed in the gel electrophoresis; the electrophoresis detection is shown in FIG. 5, wherein the

markers

1, 2, 3, 5, 6, 9 and 10 in FIG. 5 are positive; 4. 7, 8 are false positives; 11 is a negative control (control 2), P is a positive control (control 2A), and M is Maker.

Positive genetic transformation efficiency was calculated according to the formula (1), and the results are shown in Table 9.

Comparative example 1 PCR amplification of wild type Populus alba 84K

Grinding 84K leaves of wild type populus argentis by liquid nitrogen, extracting DNA by using a kit (DP 320-03), and performing PCR amplification by using the genomic DNA of the wild type populus argentis 84K as a negative control template, wherein a PCR amplification system and an amplification program are the same as those of the PCR amplification of the resistance positive plants screened in the example 3. The electrophoresis detection is shown in FIG. 4. Positive genetic transformation efficiency was calculated according to the formula (1), and the results are shown in Table 9.

Control example 1A PCR amplification of silver Populus glandulifera 84K Positive control

And (3) carrying out PCR amplification by using DNA of MYC2-PBI121 vector plasmid in the step 1 of preparing infection bacterial liquid in the example 3 as a template, wherein a PCR amplification system and an amplification program are the same as those of the PCR amplification of the plant with the positive resistance selected in the example 3. The electrophoresis detection is shown in FIG. 4. Positive genetic transformation efficiency was calculated according to the formula (1), and the results are shown in Table 9.

Control example 2 PCR amplification of wild type tobacco

And (3) extracting DNA from wild tobacco leaves to be used as a negative control template for PCR amplification, wherein a PCR amplification system and an amplification procedure are the same as those of the PCR amplification of the resistance positive plants screened in the example 4. The electrophoresis detection is shown in FIG. 5. Positive genetic transformation efficiency was calculated according to the formula (1), and the results are shown in Table 9.

Control example 2A PCR amplification of tobacco Positive control

And (3) performing PCR amplification by using DNA of the BZIP53-PBI121 vector plasmid in the step 1 of preparing the infection bacterial liquid in the example 4 as a template, wherein a PCR amplification system and an amplification program are the same as those of the PCR amplification of the resistance positive plant screened in the example 4. The electrophoresis detection is shown in FIG. 5. Positive genetic transformation efficiency was calculated according to the formula (1), and the results are shown in Table 9.

TABLE 9 genetic transformation rates of poplar and tobacco at different differentiation culture times

As can be seen from Table 9: the infection conversion efficiency of the 84K leaf of the silver adenophora japonica on the 3 rd day is the highest and can reach 86.58%; the genetic transformation efficiency of the 84K stem section of the populus argentifolia is highest at the 4 th day of culture and can reach 77.83%; and when the tobacco is cultured on the 2 nd day, the infected tobacco leaf has the highest conversion efficiency which can reach 57.33 percent.

The results show that when the incision part of the leaf of the receptor plant material to be genetically transformed begins to appear transparent yellow brown bulges under the observation of a stereoscopic microscope, and small cells without vacuoles, thick cytoplasm, enlarged cell nucleus and deepened color are observed under a paraffin section; or the cut part of the stem segment of the receptor plant material begins to lose water and shrink, the outer edge is obviously expanded, more small cells with thick cytoplasm are observed under a paraffin section, the cell nucleus is enlarged and the color is deepened, and when the leaf bud primordial cells are in the cell cycle S phase, the optimum treatment period for the genetic transformation of the receptor material cells is obtained, the genetic transformation is carried out on the receptor material at the moment, the genetically transformed plant can be stably and efficiently obtained, the problems of unstable genetic transformation efficiency and the like in the prior art can be solved, and the remarkable improvement of the genetic transformation efficiency is ensured.

The invention carries out differentiation culture on the plant sterile receptor material creating the wound (with the incision or the wound), observes and distinguishes the morphological characteristics of the incision in real time and the bud primordial cell development state of the receptor material under the paraffin section, and carries out the genetic transformation treatment in due time according to the incision morphology of the receptor material, the cell development state and the cell number in the S phase of the cell cycle. The method can relatively accurately judge the genetic transformation time, namely the optimal treatment period of the genetic transformation of the receptor material cells, and carry out the genetic transformation treatment in time to obtain the genetic transformation plants.

The method is based on the principle that the formation of the leaf bud primordium of different plant receptor materials and the development process are different under the condition of in vitro culture, and effectively distinguishes that the plant receptor materials are applied with genetic transformation when the leaf bud primordium cells are induced to develop to the chromatin activation stage (namely, the leaf bud primordium cells are in the S stage of the cell cycle), realizes the target gene transformation or modification of most leaf bud primordium, and obviously improves the genetic transformation rate, the stability and the repeatability of the plant.

Claims

1. A method for improving the genetic transformation efficiency of plants is characterized by comprising the steps of firstly carrying out differentiation culture treatment on sterile plant explant receptor materials; then, the receptor material after the differential culture treatment is subjected to genetic transformation treatment.

2. The method of claim 1, wherein the sterile plant explant recipient material is a leaf or stem section having a laceration or incision.

3. The method according to claim 1 or 2, wherein the differentiation culture treatment is to inoculate sterile plant explant recipient material to a differentiation medium for differentiation culture.

4. The method of claim 3, wherein the recipient material differentiation medium is: MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + agar 6g/L + sucrose 30g/L.

5. The method according to claim 1 or 2, wherein the genetic transformation treatment comprises transformation treatment of the plant explant recipient material after the differential culture treatment by Agrobacterium infection or particle gun; then the receptor material after transformation treatment is sequentially inoculated on a selective differentiation culture medium and a selective rooting culture medium to carry out selective culture on the resistant plants.

6. The method of claim 5, wherein the selective differentiation medium is: MS minimal medium + NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L + Kan 20-40mg/L + Tim 150-250mg/L + agar 6g/L + sucrose 30g/L, preferably MS minimal medium + NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L + Kan 30mg/L + Tim 200mg/L + agar 6g/L + sucrose 30g/L.

7. The method according to claim 1 or 2, further comprising, before the genetic transformation treatment, performing microscopic observation of the subject material subjected to the differential culture treatment to determine the developmental state of cells at the incision or scratch part of the subject material; or through carrying out EdU staining on the receptor material subjected to differential culture treatment, observing and determining the development state or stage of cells at the cut or scratch part of the receptor material; or real-time fluorescent quantitative PCR detection is carried out on the receptor material subjected to the differential culture treatment, the expression condition of the cell cycle S phase related gene of the receptor material is determined, and then the receptor material is subjected to genetic transformation treatment.

8. The method according to claim 7, wherein the genetic transformation is performed when the development state of the cells at the incision or scratch part of the recipient material is observed as the bud primordial cells develop to the chromatin activating stage but not to the mitotic stage, i.e., the leaf bud primordial cells develop to the S phase of the cell cycle.

9. The method of claim 7, wherein the recipient material is genetically transformed by EdU staining when a large number of cells are observed to fluoresce green and the number of cells in the S phase of the cell cycle is at its maximum; or determining the gene CDKB1 detected in the acceptor material by a real-time fluorescent quantitative PCR method; 2, CDKD1;1 or CYCD6;1, the recipient material is genetically transformed when the expression level is the highest.