CN115443908B

CN115443908B - Method for improving genetic transformation efficiency of plants

Info

Publication number: CN115443908B
Application number: CN202211279677.4A
Authority: CN
Inventors: 康向阳; 夏宇飞; 任勇谕; 杜康; 李赟; 杨珺
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2022-01-04
Filing date: 2022-10-19
Publication date: 2023-09-26
Anticipated expiration: 2042-10-19
Also published as: CN115443908A

Abstract

The invention discloses a method for improving genetic transformation efficiency of plants, which comprises the steps of carrying out differentiation culture treatment on plant explant receptor materials, and then carrying out genetic transformation on the receptor materials subjected to the differentiation culture treatment. The invention carries out differentiation culture on the receptor material with the notch, timely observes the development state of the notch of the material under a stereoscopic microscope, observes the cell morphology of the receptor material under the microscope through paraffin section, determines the S phase of the cell cycle through EdU staining and fluorescent quantitative PCR, accurately judges the genetic transformation time and timely carries out genetic transformation treatment. The method of the invention is adopted to precisely determine the optimal treatment period of genetic transformation of the receptor material, and based on the principle that the leaf bud primordia of different plant receptor materials are formed and the development process is different under the condition of isolated culture, the genetic transformation is carried out on different plants in time, thereby realizing the target gene transformation or modification of the leaf bud primordia, improving the genetic transformation rate, stability and repeatability of plants and obtaining the genetic transformation plants with high transformation rate.

Description

Method for improving genetic transformation efficiency of plants

Technical Field

The invention relates to a genetic transformation method, in particular to a method for improving the genetic transformation efficiency of plants, and belongs to the technical field of plant biology.

Background

Genetic transformation refers to the process of introducing an exogenous or endogenous gene of interest into the genome of a recipient plant by means of a genetic transformation method, or modifying a specific gene of interest in the genome of a recipient plant by means of a gene editing tool. There are two main genetic transformation methods, one is Agrobacterium-mediated method (Leaf disc transformation), mainly by integrating the gene of interest or editing tool into the recipient plant genome using Agrobacterium tumefaciens Ti plasmid, the most commonly used of which is the leaf disc transformation method of Horsch et al (1985); the second is the gene gun method (particle bombardment), which is a method of introducing a target gene or editing tool into the genome of a recipient plant by using high-speed microprojectiles to achieve expression or modification (Sanford et al, 1987). Furthermore, there are pollen tube pathway established by Zhou Guangyu et al (1983), nanomaterial transfer, and the like. The high-efficiency genetic transformation technology is a key technical link for realizing molecular design breeding such as transgene, gene editing and the like.

The establishment of a stable and efficient plant genetic transformation system is a precondition for realizing molecular design breeding. Since Zambryski et al (1983) succeeded in obtaining transgenic tobacco by taking Agrobacterium tumefaciens Ti plasmid as a transformation vector, genetic transformation systems of a series of plants such as important crops, flowers, plants, forests, fruit trees and the like were established for many researches on construction and development of genetic transformation systems of different genotypes of different plants, and transgenic plants (Wang Xin) with different excellent properties were obtained (equal, fruit tree transgenic research progress [ J ]. Shanxi agricultural science 2016,44 (01): 123-125+130; wang Li equal, soybean genetic transformation method and regeneration system research progress [ J ]. Guangdong agricultural science 2020,47 (03): 16-27; brilliant et al, development status of global transgenic crops [ J ]. Propagation, 2020,12 (24): 29-31+48; zhang Yue and the like), research progress of Agrobacterium-mediated grass genetic transformation [ J ]. Shanghai university (natural science version), 2021,50 (01): 21-27). However, in general, the genetic transformation rate of plants is relatively low, and the main problem is that a large number of adventitious buds can be obtained, but there are relatively few adventitious buds in which genetic transformation is achieved after detection. Only if the cause of the problem of low genetic transformation rate is found, a solution to the problem can be proposed.

It is generally considered that regeneration of plant in vitro culture receptor materials such as plant leaves and stem segments is mostly carried out by making incisions and parenchyma cells, epidermis cells and vascular bundle sheath cells around vascular bundles in the vicinity of incisions and performing cell division, generating meristematic cell masses and then generating them (and gentleprovided instruments and the like, cytohistological observation of tea leaf callus formation [ J ]. Tea leaves, 1995 (02): 11-13; deng Xin and the like, physiological and biochemical changes (brief) in the process of dedifferentiation and rediction of strawberry in vitro leaves [ J ]. Plant physiological communication, 2000 (03): 209-211; peng Liping and the like, establishment of a high-frequency regeneration system of Isatis tinctoria leaves [ J ]. Anhui academy of science and technology, 2007 (04): 14-17). The regeneration of adventitious buds is mostly regulated by a higher concentration of cytokinins, and some areas of non-embryogenic callus are activated to express WUS and CUC2 genes, so that leaf bud primordial cells are induced to form, and the adventitious buds are regenerated (Gordon et al, 2007; cheng et al, 2013). The plant genotype significantly affects the regeneration capacity of explants, and the regeneration capacities of different varieties of the same species have great differences; furthermore, explant material of different ages showed different rates of adventitious bud regeneration. This is mainly due to the different response of different explant materials to different induction media and other conditions.

From the standpoint of inducing chromosome doubling of isolated cultured plant cells, differences in the developmental states of explants of different genotypes are important causes of inconsistent chromosome doubling conditions of the somatic cells. It was found that there was a significant difference in the regeneration capacity of leaves of different genotypes by applying colchicine solution treatment under the same culture conditions. Xu et al (Xu Congping, et al, in vitro tetraploid plants regeneration from leaf explants of multiple genotypes in Populus [ J ]. Plant Cell Tissue & Organ Culture An International Journal on in Vitro Culture of Higher Plants, 2016.) also found that the optimal treatment conditions for chromosome doubling of sterile seedlings of hybrid progeny of populus of different genotypes were not identical. The development state of the explant during in vitro culture is not only dependent on the culture conditions such as culture composition, light, temperature, etc., but also on the time of differentiation culture of the explant (Cai X, kang, xy. In vitro tetraploid induction from leaf explants of Populus pseudo-simoni kit. [ J ]. PLANT CELL REP, 2011).

The same problem should exist with regard to differences in genetic transformation rates of different plant materials. Because the effective treatment period for chromosome doubling is near the mitosis metaphase of the cell, genetic transformation should be earlier than the effective treatment period for chromosome doubling.

It is well known that homologous recombination generally occurs after the S phase of the cell cycle, i.e. the process of replication of DNA. The response time difference of different plants, different genotypes of the same plant and different age materials of the same genotype to the induction of the culture condition also determines the optimal transformation time difference of the receptor materials of different sources. Thus, the transformation efficiencies of different genotypes of the same plant are different, for example, the genetic transformation efficiency of soybean is between 0 and 29.3 percent, and is generally between 2 and 6 percent (Wang Li is equal; the research on the genetic transformation method and regeneration system of soybean is [ J ]. Guangdong agricultural science, 2020,47 (03): 16-27). Because of this, despite extensive research in the aspects of explant selection, agrobacterium strain and bacterial fluid concentration, infection concentration and infection time, illumination and co-culture time, acetosyringone, hormone treatment conditions and the like, genetic transformation systems of related plants are continuously optimized, great fluctuation still exists in genetic transformation rate, and stable and efficient genetic transformation systems are difficult to establish. Although studies have been made to increase the physiological activity of the receptor by culturing the dedifferentiated callus prior to agrobacterium transformation or gene gun transformation, which is advantageous for obtaining optimal transformation efficiency (Vain et al, 1993; zhang Yue, et al, 2021), the reason for the increase in transformation rate is not pointed out, and no technical method has been proposed as to how differentiation culture time is discriminated.

Disclosure of Invention

The invention aims to provide a method for improving the genetic transformation rate of plants, aiming at the technical problems that the genetic transformation efficiency is low, the fluctuation is large, a stable and efficient genetic transformation system is difficult to establish and the like in the conventional genetic transformation process of plants. The method of the invention is based on the development state of the receptor material, and the time for carrying out the genetic transformation of the target gene is controlled relatively accurately, thus obviously improving the genetic transformation rate of the plant. According to the method, the chromatin activation period of leaf bud primordial cells, namely the optimal period of genetic transformation of receptor material cells, is immediately judged according to the cut and cell development states of plant receptor materials such as in vitro culture leaves, stem segments and the like and the identification of the cell cycle S phase, the timeliness of genetic transformation such as agrobacterium infection or gene gun transformation is enhanced, the ratio of obtaining target genetic transformation plants is obviously improved, and the stability of an obtained genetic transformation system can be ensured.

The technical problems to be solved by the invention are realized by the following technical scheme:

a method for improving genetic transformation rate of plant includes differentiation culture treatment of aseptic plant explant acceptor material; then genetic transformation treatment is carried out on the receptor material after the differentiation culture treatment.

The sterile plant explant acceptor material is an in-vitro sterile plant acceptor material, and comprises leaves and stem segments of in-vitro cultured plants, preferably leaves.

In particular, the explant recipient material is a sterile leaf disc of the plant, a cut or scratch treated leaf, a stem segment of an axillary bud cut, and the like.

Wherein the sterile plant receptor material is a leaf or stem segment with a nick or incision.

In particular, a leaf disc is manufactured by using a puncher; or shearing the main vein of the blade perpendicular to the vein by using a shearing tool (such as scissors, blades) to form a sterile blade with a cut or scratch; or cutting off internode stem ends of the excised axillary buds between the leaves of the sterile seedling with a cutting tool (e.g., scissors) to form sterile stem segments with cuts or lacerations.

The incision or scratch is formed by cutting the blade into a wound perpendicular to the main vein of the blade; or cutting off internodes of axillary bud with cutting tool (such as scissors) to form stem segment wound.

In particular, for the middle part of the blade, the main vein is sheared and sheared perpendicular to the blade vein, but the blade is not sheared, and the sheared part of the middle part of the blade is in an axisymmetric structure along the main vein of the blade.

In particular, the plant is selected from poplar, tobacco.

In particular, the poplar selects aspen 84K; the tobacco is common tobacco.

In particular, the plant explant acceptor material is leaf and stem segments of populus tomentosa 84K; tobacco lamina.

Wherein, the differentiation culture treatment is to inoculate the sterile plant explant acceptor material into a differentiation culture medium for differentiation culture.

In the method, sterile plant receptor materials such as isolated culture leaves, stem segments and the like for creating incisions are inoculated on a differentiation culture medium, differentiation treatment is carried out on the leaves and the stem segments, and leaf bud primordia are induced to form.

In particular, the differentiation medium for the differentiation culture treatment is: MS basic culture medium+NAA 0.005-0.05mg/L+6-BA 0.1-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.01-0.05mg/L+6-BA 0.2-0.5 mg/L+agar 6 g/L+sucrose 30g/L.

Particularly, when the plant receptor material is aspen 84K, the differentiation culture medium for differentiation culture is MS basic culture medium+NAA 0.03-0.05mg/L+6-BA 0.3-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; when the plant acceptor material is tobacco, the differentiation culture medium for differentiation culture is MS basic culture medium, NAA 0.01-0.02mg/L, 6-BA 0.1-0.3mg/L, agar 6g/L and sucrose 30g/L; preferably MS minimal medium+NAA 0.01mg/L+6-BA 0.2 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the culture conditions of the differentiation culture treatment are as follows: the culture temperature is 25+/-2 ℃; the illumination is 1500-2500lx, preferably 2000lx; the illumination period is 10-16h light/8-14 h dark, preferably 16h light/8 h dark.

Wherein the genetic transformation treatment comprises transformation treatment of plant explant acceptor material after differentiation culture treatment; and then sequentially inoculating the transformed receptor material on a selective differentiation medium and a selective rooting medium to perform selective culture of the resistant plants.

In particular, the genetic transformation treatment comprises the transformation treatment of plant explant receptor material after the differentiation culture treatment by adopting an agrobacterium infection method or a gene gun method; and then sequentially inoculating the transformed receptor material on a selective differentiation medium and a selective rooting medium to perform selective culture of the resistant plants.

Agrobacterium infection or gene gun methods are conventional techniques. When the agrobacterium infection method is adopted for transformation treatment, agrobacterium transforms a plant expression vector with a target gene to be genetically transformed, and the target gene to be genetically transformed is integrated into a plant receptor material. Genetic transformation is the integration of a gene of interest into the genome of a differentiated culture recipient material.

Wherein the conversion treatment comprises the following steps:

a) Soaking the plant receptor material subjected to differentiation culture treatment in an infectious microbe liquid, and then taking out the plant receptor material and sucking the infectious microbe liquid on the surface of the receptor material;

b) And (3) inoculating the receptor material with the surface infection bacteria liquid absorbed and dried into an infection-co-culture medium, and carrying out infection-co-culture.

In particular, the time of soaking in the infectious microbe liquid in the step A) is at least 10min, preferably 10-15min; the infection-co-culture medium in step B) is: MS basic culture medium+NAA 0.005-0.05mg/L+6-BA 0.1-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.01-0.05mg/L+6-BA 0.2-0.5 mg/L+agar 6 g/L+sucrose 30g/L.

The dip-co-culture medium in the dip-co-culture process is the same as the differentiation medium for the differentiation culture of the receptor material.

In particular, the target gene to be genetically transformed can be a functional gene or transcription factor for growth, development, reproduction, stress resistance and the like.

In particular, the target genes to be genetically transformed are MYC2, SDD1, BZIP53 and other genes. In addition to MYC2, SDD1, BZIP53 genes, other transcription factors are suitable for use in the present invention.

In particular, when the sterile plant acceptor material is populus tremulosa 84K, the infection-co-culture medium is MS basic culture medium+NAA 0.03-0.05mg/L+6-BA 0.3-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; when the sterile plant acceptor material is tobacco, the infection-co-culture medium is MS basic culture medium, NAA 0.01-0.02mg/L, 6-BA 0.1-0.3mg/L, agar 6g/L and sucrose 30g/L; preferably MS minimal medium+NAA 0.01mg/L+6-BA 0.2 mg/L+agar 6 g/L+sucrose 30g/L.

The culture conditions for the infection-co-culture were as follows: the co-culture temperature is 25+/-2 ℃; dark culture for 2-3 days (usually 2 days).

The culture conditions such as culture temperature and illumination of the differentiation culture are the same as those of the prior art. Screening of target gene transformation buds, rooting culture medium, culture conditions, transgenic plant identification and the like are all general methods, and all methods known in the art are applicable to the invention.

Inoculating a receptor material on a selective differentiation medium, and carrying out screening culture of resistant buds; and then inoculating the resistant buds on a rooting medium for rooting culture.

Wherein, the selective differentiation medium is: MS basic culture medium +NAA 0.005-0.05mg/L +6-BA 0.1-0.5mg/L +Kan 20-40mg/L +Tim 150-250mg/L +agar 6g/L +sucrose 30g/L, preferably MS basic culture medium +NAA 0.01-0.05mg/L +6-BA 0.2-0.5mg/L +Kan 30mg/L +Tim 200mg/L +agar 6g/L +sucrose 30g/L.

In particular, when the sterile plant receptor material is aspen 84K, the selective differentiation medium is: MS basic culture medium +NAA 0.03-0.05mg/L +6-BA 0.3-0.5mg/L +Kan 20-40mg/L +Tim 150-250mg/L +agar 6g/L +sucrose 30g/L, preferably MS basic culture medium +NAA 0.05mg/L +6-BA 0.5mg/L +Kan 30mg/L +Tim 200mg/L +agar 6g/L +sucrose 30g/L; when the sterile plant acceptor material is tobacco, the selective differentiation medium is: MS basic culture medium, NAA 0.01-0.02mg/L, 6-BA 0.1-0.3mg/L, kan 20-40mg/L, tim 150-250mg/L, agar 6g/L and sucrose 30g/L; preferably MS+NAA 0.01mg/L+6-BA 0.2mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the culture conditions for the resistant bud selection treatment are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. The screening culture time for the resistant shoots is 1 to 3 weeks, usually (2.+ -. 0.5) weeks.

In particular, the method further comprises the step of washing the plant receptor material after the dip-co-culture treatment before the resistant bud screening treatment, wherein the washing treatment comprises the following steps: placing the plant receptor material subjected to the infection treatment in distilled water containing cephalosporin, and washing for at least 20min; then at least 3 times, each for at least 2min, with distilled water.

Wherein the concentration of the cephalosporin in the distilled water containing the cephalosporin is 40-260mg/L.

In particular, when the acceptor material is aspen 84K, the concentration of cephalosporin in distilled water containing cephalosporin is 40-55mg/L, preferably 50mg/L; when the acceptor material is tobacco, the concentration of cephalosporin in distilled water containing cephalosporin is 240-260mg/L, preferably 250mg/L.

In particular, the washing time with distilled water containing cephalosporin is 20-30min, preferably 25min.

When the aseptic plant receptor material is aspen 84K, the selective rooting culture medium is 1/2MS basic culture medium, NAA 0.01-0.03mg/L, IBA 0.03-0.05mg/L, kan 20-40mg/L, tim 150-250mg/L, agar 6g/L, sucrose 30g/L, preferably 1/2MS basic culture medium, NAA 0.02mg/L, IBA 0.05mg/L, kan 30mg/L, tim 200mg/L, agar 6g/L and sucrose 30g/L.

Wherein, when the sterile plant receptor material is tobacco, the selective rooting culture medium is: MS basic culture medium +IBA 0.3-0.5mg/L +Kan 20-40mg/L +Tim 150-250mg/L +agar 6g/L +sucrose 30g/, preferably MS basic culture medium +IBA 0.4mg/L +Kan 30mg/L +Tim 200mg/L +agar 6g/L +sucrose 30g/L.

In particular, rooting culture conditions are: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. Rooting culture time is 2-4 weeks.

Wherein, before genetic transformation treatment, microscopic observation is carried out on the receptor material subjected to differentiation culture treatment, and the development state of cells at the incision or scratch part of the receptor material is determined; or the receptor material subjected to differentiation culture treatment is dyed by EdU, and the development state or development stage of cells at the incision or scratch part of the receptor material is observed and determined; or carrying out fluorescent quantitative PCR detection on the receptor material subjected to the differentiation culture treatment, detecting the expression condition of the cell cycle S phase related genes of the receptor material by using the fluorescent quantitative PCR, and then carrying out genetic transformation treatment on the receptor material.

In particular, microscopic observation of the recipient material subjected to the differentiation culture treatment also includes determining the morphology of the cut or lacerated site of the recipient material.

In particular, the genetic transformation treatment is performed when the cellular development state at the cut or scratch site of the receptor material is observed to be such that the budding cell develops to the activation stage of chromatin but has not yet developed to the mitosis stage, i.e., the budding cell develops to the S stage of the cell cycle.

The method further comprises the step of incubating the receptor material after the differentiation culture treatment before the EdU staining treatment, wherein the culture medium for the incubation culture is a differentiation culture medium containing 10 mu M of EdU (5-Ethynyl-2 '-deoxyuridine, 5-ethyl-2' -deoxyuridine).

The differentiation culture medium is MS basic culture medium+NAA 0.005-0.05mg/L+6-BA 0.1-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.01-0.05mg/L+6-BA 0.2-0.5 mg/L+agar 6 g/L+sucrose 30g/L.

When the plant receptor material is populus tomentosa 84K, the differentiation culture medium is MS basic culture medium+NAA 0.03-0.05mg/L+6-BA 0.3-0.5 mg/L+agar 6 g/L+sucrose 30g/L, preferably MS basic culture medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; when the plant receptor material is tobacco, the differentiation medium is MS basic medium+NAA 0.01-0.02mg/L+6-BA 0.1-0.3 mg/L+agar 6 g/L+sucrose 30g/L; preferably MS minimal medium+NAA 0.01mg/L+6-BA 0.2 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the culture conditions of the incubation culture are: the culture temperature is 25+/-2 ℃; the illumination is 1500-2500lx, preferably 2000lx; the illumination period is 10-16h light/8-14 h dark, preferably 16h light/8 h dark.

In particular, edU staining of the receptor material further comprises determining the number of S-phase cells at the notch of the receptor material; carrying out fluorescent quantitative PCR detection on the receptor material, wherein related genes including real-time fluorescent quantitative PCR detection comprise CDKB1;2, CDKD1;1 and CYCD6;1.

before genetic transformation, observing the receptor material subjected to differentiation culture treatment to determine the incision development state of the receptor material and the activation state of cells under anatomical conditions, and then carrying out genetic transformation on the receptor material. And when the cells at the incision site of the receptor material reach the optimal treatment period of genetic transformation, carrying out genetic transformation treatment on the receptor material at proper time.

And before genetic transformation treatment, edU staining is carried out on the receptor material, the corresponding period when the number of S-phase cells at the notch of the receptor material is maximum is determined, and then genetic transformation treatment is carried out on the receptor material. And when the cells at the incision site of the receptor material reach the optimal treatment period of genetic transformation, carrying out genetic transformation treatment on the receptor material at proper time.

Before genetic transformation treatment, carrying out real-time fluorescence quantitative PCR detection on the receptor material to determine CDKB1 in the receptor material; 2, CDKD1;1 and CYCD6;1 is in the highest expression level, and then genetic transformation treatment is carried out on the receptor material. And when the cells at the incision site of the receptor material reach the optimal treatment period of genetic transformation, carrying out genetic transformation treatment on the receptor material at proper time.

In particular, before genetic transformation treatment, observing the development state of scratches or cuts of the receptor material subjected to differentiation culture treatment by using a split microscope or a magnifier; and observing the development state of the receptor material cells under an optical microscope through paraffin sections.

Determining the period of maximum cell number of cells in the S phase of the cell cycle at the incision of the plant recipient material by EdU staining of the recipient prior to genetic transformation treatment; the fluorescence quantitative PCR detection is carried out on the receptor treatment, and the period of highest expression level of the related genes is determined by the fluorescence quantitative PCR.

Wherein the related gene is CDKB1; 2. CDKD1;1 or CYCD6;1, and one or more of the following.

By EdU staining, genetic transformation of the acceptor material is performed when a large number of cells are observed to emit green fluorescence, with the maximum number of cells in the S phase of the cell cycle; or a real-time fluorescent quantitative PCR method to determine the gene CDKB1 detected in the acceptor material; 2, CDKD1;1 or CYCD6;1, i.e. the number of cells in the S phase of the cell cycle is maximized, the receptor material is subjected to genetic transformation.

In particular, when it is observed that the recipient material develops until the chromatin of the germ cells starts to activate, the recipient material is subjected to genetic transformation, i.e., to a transformation treatment by applying an Agrobacterium infection method or by using a gene gun method. The receptor material develops until the germ cell chromatin begins to activate, in the S phase of the cell cycle.

In particular, when small cells with dense cytoplasm, enlarged nucleus and deepened color are observed under paraffin section, the chromatin of the germ primordial cells of the receptor material starts to activate and enter the S phase of the cell cycle, and the genetic transformation treatment is suitably performed.

The incision part of the sterile plant receptor material such as in vitro culture leaves, stems and the like starts to appear transparent yellow brown bulges, small cells with thick cytoplasm, enlarged cell nuclei and deepened color are observed under paraffin sections, and the receptor material cells are the optimal period for applying genetic transformation when in the S phase of the cell cycle.

Observing the incision development of the sterile plant receptor materials (in vitro culture leaves, stem segments and the like) by adopting a stereoscopic microscope; the state of cell development under the condition of paraffin section of the differentiation culture receptor material is observed by adopting an optical microscope, and the bud primordial cells are selected to develop to the activation stage of chromatin but not to the mitosis stage (namely, the leaf bud primordial cells are in the S phase of the cell cycle) as the optimal stage of genetic transformation treatment.

When the cut parts of the sterile plant receptor materials such as the isolated culture leaves, the stem segments and the like begin to appear transparent yellow brown bulges, and small cells with thick cytoplasm, enlarged cell nuclei and deepened color are observed under paraffin sections, the genetic transformation window period of the receptor material cells is the optimal period of applying agrobacterium infection of plant expression vectors with target genes or carrying out genetic transformation by adopting a gene gun method and the like when leaf bud primordial cells formed by the cut differentiation of the sterile plant receptor materials such as the isolated culture leaves, the stem segments and the like are in the cell cycle S phase.

The optimal treatment period of the genetic transformation of the receptor material is that transparent yellow brown bulges appear at the incision part of the receptor material when the receptor material leaf bud primordial cells are in the activation period of chromatin, small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin sections, or the receptor material cells are in the S phase of the cell cycle, agrobacterium infection of plant expression vectors with target genes is applied or genetic transformation is carried out by adopting a gene gun method and other methods.

The invention provides a method for improving genetic transformation efficiency of plants, which comprises the steps of carrying out differentiation culture on a receptor material; judging the incision of the receptor material and the development state and period of the cells in the differentiation culture process; genetic transformation treatment is performed on the acceptor material.

Includes differentiation culture of acceptor material, discrimination of genetic transformation period, timely genetic transformation treatment, cluster bud induction, screening of transformed plant, etc.

The genetic transformation conditions and related operations (such as culture of tissue culture seedlings, preparation of vectors, identification of positive seedlings and the like) in the genetic transformation technical scheme are the same as those of the conventional genetic transformation of other plants in the field.

The genetic transformation period is distinguished by inoculating sterile plant receptor materials such as isolated culture leaves, stem segments and the like for creating cuts or local scratches on a proper differentiation culture medium of the plant for culture, and inducing leaf bud primordia to form;

in the process of the differentiation culture of plant sterile receptor materials such as leaves, stems and the like for creating the incision, a split microscope or a magnifying glass is adopted to observe the development state of the incision of the isolated receptor material, and an optical microscope is adopted to observe the development state of paraffin section cells of the receptor material. When the aseptic receptor material of the plant such as the in vitro cultured leaf blade, stem section and the like is observed to start to appear transparent yellow brown bulge at the incision part, and small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin section, the activation period of the chromatin of the leaf bud primordial cells is determined, or the receptor material cells are determined to be in the S phase of the cell cycle by EdU staining or fluorescent quantitative PCR.

The technical links of cluster bud induction, transformed plant screening and the like all adopt the conventional technical methods in the field.

The techniques known or familiar to those skilled in the art are used for the in vitro culture of explants, the genetic transformation of Agrobacterium infection or gene gun method, the detection of transformed plants, etc.

Compared with the prior art, the invention has the following advantages:

the invention carries out microscopic observation on the morphological change of the incision of the receptor material and the development state of the cells of the receptor material which are subjected to certain differentiation culture, and accurately judges the development period of the primordium of the leaf bud according to the morphological change of the incision of the receptor material of different differentiation culture plants and the development state of the cells under the paraffin slicing condition of the receptor material, namely, when transparent yellow brown bulge starts to appear at the incision part of the isolated culture blade, and small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under the paraffin slicing; the incision site of the isolated culture stem segment starts to shrink by water loss, the outer edge is obviously enlarged, and a large number of small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin section (namely, the bud primordial cells develop to the activation period of chromatin but not to the mitosis period, and the leaf bud primordial cells are in the S phase of the cell cycle), so that the method is the optimal treatment period of genetic transformation. Genetic transformation of the receptor material at this stage is performed, avoiding blindness of genetic transformation.

The method starts to appear transparent yellow brown bulge at the notch part of the receptor material, small cells with thick cytoplasm, enlarged cell nucleus and deepened color are observed under paraffin sections, and when the receptor material cells are in the S phase of a cell cycle, the best opportunity for genetic transformation is realized, namely the best treatment period for genetic transformation of the receptor material cells, genetic transformation is carried out at proper time, and then a large number of stable genetic transformation plants with high transformation rate can be obtained through the technical links of adventitious bud regeneration culture, propagation and the like. The method is based on the principle that leaf bud primordia of different plant receptor materials are formed and development processes are different under the in-vitro culture condition, and by observing the incision morphology and the cell development state of the receptor materials after culture, genetic transformation is effectively applied when the plant receptor material cells are in the cell cycle S phase, and the target gene transformation or modification of most of leaf bud primordia is realized when the leaf bud primordia cells induce development to the chromatin activation phase, so that the plant genetic transformation rate, stability and repeatability are remarkably improved.

The method solves the problems that in the prior art, when receptor materials such as leaves, stems and the like are cut off for plant in vitro culture and then genetic transformation treatment is directly applied, the time for differentiating the leaf bud primordial cells by the receptor materials for in vitro culture of different plants or plants of the same species with different genotypes is different, or the time for the leaf bud primordial cells to enter a DNA replication period is different due to the difference of culture conditions, so that the genetic transformation efficiency fluctuates greatly, a stable and efficient genetic transformation system is difficult to establish and the like. The invention is based on the identification of the proper treatment period of genetic transformation, ensures that the genetic transformation is treated in the activation period of the leaf bud primordium cell chromatin of the receptor material, namely the optimal treatment period of the genetic transformation, and remarkably enhances the timeliness of the genetic transformation, thereby ensuring that the genetic transformation rate is not influenced by the culture environment, species or genotype difference and laying an important methodology foundation for the efficient genetic transformation of plants.

The method is based on the development state of a plant receptor material, the change of the incision morphology of an in-vitro plant receptor material is observed through a stereoscopic microscope or an magnifier, the cell development state of the receptor material under the condition of paraffin section is observed through an optical microscope, or the cell development of the receptor material is determined to the S phase of a cell cycle, or the expression quantity of genes (CDKB 1;2, CDKD1;1 and CYCD6; 1) related to the S phase of the cell development to the cell cycle is detected through real-time fluorescent PCR detection, the genetic transformation time of a target gene is accurately controlled, the optimal treatment period of the genetic transformation of the plant receptor material is accurately mastered according to the incision morphology change of the plant receptor material, the development state of leaf bud primordium cells, the number of cells in the S phase or the expression condition of genes related to the S phase, the time for applying the genetic transformation is accurately controlled, and the genetic transformation efficiency of the plant is remarkably improved.

For different plants or plants of the same species, which have different genotypes, the leaf bud primordium forms and develops in different processes, and only when the leaf bud primordium cells of the plant receptor materials are induced to develop to the S phase of the cell cycle, namely transparent yellow brown bulges appear at the incision parts of the receptor materials, small cells with thick cytoplasm, enlarged cell nuclei and deepened color are observed under paraffin sections; the most number of cells in S phase at the acceptor material incision was observed by EdU staining; fluorescent quantitative PCR detects CDKB1 in the plant acceptor material; 2. CDKD1;1 or CYCD6;1, when the expression is obviously high, genetic transformation is applied in time, so that the target gene transformation or modification of the leaf bud primordium can be realized, and the plant genetic transformation rate, stability and repeatability are obviously improved.

Drawings

FIG. 1 is a view of a stereoscopic microscope of the day 3 of the differentiation culture of the isolated culture leaves of Populus deltoides 84K;

FIG. 1A is a view of paraffin sections from day 3 of the differentiation culture of leaves of Populus deltoides 84K in vitro;

FIG. 1B is a graph of EdU staining of in vitro cultured leaves of Populus deltoides 84K on day 3;

FIG. 1C shows the detection of CDKB1 in the 84K in vitro culture leaves of Populus deltoides by fluorescence quantitative PCR; 2, CDKD1;1 and CYCD6; 1;

FIG. 2 is a view of the isolated culture of Populus deltoides 84K on day 4 of differentiation culture under a stereoscopic microscope;

FIG. 2A is a view of paraffin sections from day 4 of the in vitro culture of the stem segments of Populus deltoides 84K;

FIG. 2B is a graph of EdU staining of an isolated culture of Populus deltoides 84K at day 4 in stem differentiation culture;

FIG. 2C is a fluorescent quantitative PCR detection of CDKB1 from 84K in vitro cultured stems of Populus deltoides; 2, CDKD1;1 and CYCD6; 1;

FIG. 3 is a view of the tobacco in vitro culture lamina differentiation culture on day 2 as observed by a stereomicroscope;

FIG. 3A is an observation view of paraffin sections on day 2 of the differentiation culture of tobacco in vitro culture leaves;

FIG. 3B is a graph of EdU staining of tobacco in vitro culture leaves at day 2 of differentiation culture;

FIG. 3C shows the detection of CDKB1 in tobacco in vitro culture leaves by fluorescence quantitative PCR; 2, CDKD1;1 and CYCD6; 1;

FIG. 4 shows DNA agarose gel electrophoresis detection of the 84K tissue culture seedlings of Populus deltoides;

FIG. 5 shows the detection of tobacco tissue culture seedlings by DNA agarose gel electrophoresis.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

Example 1 Experimental materials and Medium

1. Experimental materials

1. The invention uses the leaves and stem segments of the silver aspen 84K tissue culture Miao Mojun and the leaves of the tobacco tissue culture Miao Mojun as plant receptor materials for genetic transformation.

2. Plant growth regulator

The plant growth regulating substances used in the present invention are α -naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), indole-3-butyric acid (IBA).

3. Culture medium

(1) Composition or formulation method of "MS minimal medium";

table 1 MS Medium (Murashige and Skoog, 1962)

According to the amount of the culture medium, weighing agar and sucrose, pouring the agar and sucrose into sterile water with the volume of 3/4 of the volume of the culture medium to be prepared, adding MS basic culture medium, fixing the volume to the final volume of the culture medium, measuring the pH value of the culture medium by using a pH meter, and regulating the pH value to 5.8-6.0 by using 1mol/L NaOH or 1mol/L HCl.

(2) Differentiation medium:

adding NAA 0.005-0.05mg/L, NAA 0.1-0.5mg/L, 6-BA, agar 6g/L and sucrose 30g/L into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121deg.C for 15min, wherein:

populus deltoides 84K: adding 0.05mg/L NAA, 0.5 mg/L6-BA, 6g/L agar and 30g/L sucrose into MS minimal medium; tobacco: to MS minimal medium was added 0.01mg/L NAA, 0.2 mg/L6-BA, 6g/L agar and 30g/L sucrose.

(3) Infection-co-culture medium:

the same as the differentiation medium.

(4) Selection of differentiation medium:

adding NAA 0.005-0.05mg/L, 6-BA 0.1-0.5mg/L, agar 6g/L and sucrose 30g/L into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121deg.C for 15min, adding kanamycin (Kan) 20-40mg/L and timentin (Tim) 150-250mg/L when the medium is cooled below 50deg.C, wherein:

populus deltoides 84K: adding NAA (sodium carbonate) 0.05mg/L, 6-BA 0.5mg/L, agar 6g/L and sucrose 30g/L into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121 deg.C for 15min, and adding kanamycin 30mg/L and timentin 200mg/L when the medium is cooled to below 50deg.C; tobacco: adding NAA 0.01mg/L, 6-BA 0.2mg/L, agar 6g/L and sucrose 30g/L into MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at 121deg.C for 15min, and adding kanamycin 30mg/L and timentin 200mg/L when the medium is cooled to below 50deg.C.

(5) Rooting medium selection

Populus deltoides 84K: adding NAA, IBA, agar and sucrose at a concentration of 0.02mg/L, IBA at a concentration of 0.05mg/L, agar at a concentration of 6g/L and sucrose at a concentration of 30g/L into a 1/2MS minimal medium, adjusting pH to 5.8-6.0, sterilizing at a constant temperature of 121 ℃ for 15min, and adding kanamycin at a concentration of 30mg/L and timentin at a concentration of 200mg/L when the medium is cooled to below 50 ℃; tobacco: adding 0.4mg/L IBA, 6g/L agar and 30g/L sucrose into MS basic culture medium, adjusting pH to 5.8-6.0, sterilizing at 121deg.C for 15min, and adding 30mg/L kanamycin and 200mg/L timentin when the culture medium is cooled below 50deg.C.

(6) Genetic transformation infectious microbe liquid suspension culture medium:

YEB liquid medium: 10g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, 20g/L agar, adding water to 1L, sterilizing at 121deg.C for 15min, and adding 50mg/L kanamycin (Kan) and 25mg/L rifampicin (Rif) when the medium is cooled below 50deg.C.

LB liquid medium: 5g/L yeast extract, 10g/L peptone, 10g/L sodium chloride, 20g/L agar, adding water to 1L, and sterilizing at 121deg.C for 15min.

Example 2 differentiation culture of Populus deltoides 84K in vitro leaf receptor Material, morphological anatomical observations, and discrimination of cell cycle S phase

1. Silver adenophora 84K differentiation culture

Cutting off the leaf of the tissue culture seedling of the populus deltoidea 84K growing for 4 weeks, cutting the leaf vein perpendicular to the leaf vein main vein by using scissors in an ultra-clean workbench, cutting off the main vein, and cutting off wounds at three parts of the leaf base, the leaf middle and the leaf tip, wherein the leaf middle is perpendicular to the leaf vein and cuts off the main vein, but does not cut off the leaf, and the cutting part of the leaf middle is basically in an axisymmetric structure along the leaf main vein;

The sheared leaves were then individually plated into petri dishes (9 cm diameter) containing solid differentiation medium for culture (i.e., differentiation culture), wherein: the differentiation medium is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; culture conditions: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic observation of silver glandular poplar 84K acceptor material

2-1, stereoscopic microscope observation:

in the differentiation culture process, the isolated culture leaves treated in different culture times are respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, the incision morphological characteristics of the 5 isolated culture leaves treated in different culture times are recorded, and the occurrence period of the callus is observed. Wherein: the morphological change characteristics of the in vitro culture blade incision at different culture times are shown in Table 2; microscopic observations on day 3 of culture are shown in FIG. 1.

2-2, observation by an optical microscope:

the leaves cultured for different time are cut into small pieces of 0.5cm multiplied by 0.5cm, then penicillin vials filled with FAA fixing liquid (5 mL of 38% formaldehyde +5mL of glacial acetic acid +90mL of 50% ethanol) are quickly placed, and air in the vials is sucked out by a syringe (materials are sunk into the bottom of the vials, so that the fixing liquid can be easily and quickly permeated into the materials), and then the materials are stored in a refrigerator at 4 ℃. And (3) dehydrating the material in 70% ethanol (1 h), 80% ethanol (1 h) and 100% ethanol (1/3 h) in sequence during tabletting, and then carrying out transparent wax dipping treatment on the material in a 1/2 xylene+1/2 alcohol solution (1.2 h), a pure xylene solution (0.5 h), 1/2 xylene+1/2 paraffin (60 ℃ overnight), pure paraffin (2 h) and pure paraffin (2 h). Pouring paraffin-immersed materials into a prestack kraft paper box for embedding, and timely adjusting the positions of the materials by forceps to enable the materials to be on the same plane. After cooling, the wax block was trimmed with a blade, sliced (thickness 8 μm), and then dewaxed and transparent. Slice staining method: 1% safranine dye liquor (24 h), tap water washing (10 min), 50% ethanol (2 min), 70% ethanol (2 min), 85% ethanol (2 min), 95% ethanol (2 min), 0.1% fast green dyeing (drop dyeing for 10-20 s), 95% ethanol (2 min) and 100% ethanol (2 min), and preparing the silver aspen 84K leaf paraffin slice. All materials were observed under an Olympus BX-51 type microscope and photographed. The anatomical features of the in vitro cultured leaves at various incubation times are shown in Table 2 and paraffin sections under light microscopy are shown in FIG. 1A.

TABLE 2 different culture times 84K in vitro culture blade morphology anatomical features

3. Cell cycle S phase identification

3-1, edU staining

The EdU staining method can accurately locate cells in the S phase of the cell cycle and make the cells emit green fluorescence. According to the invention, the EdU staining method is adopted to stain the 84K leaves of the silver aspen cultured in vitro for different time, and the distribution condition of fluorescent signals is observed.

The silver aspen 84K leaf materials after differentiation culture of 1d, 2d, 3d, 4d and 5d in the step 1) are respectively placed on differentiation culture media (MS basic culture media+6 g/L agar+30 g/L sucrose+0.05 mg/L NAA+0.5 mg/L6-BA) containing 10 mu M EdU (5-Ethynyl-2 '-deoxyuridine, 5-ethyl-2' -deoxyuridine) for incubation culture, and incubation culture conditions are respectively: the culture temperature is 25+/-2 ℃; the illumination is 2000lx (usually 1500-2500 lx); the illumination period is 16h light/8 h dark (typically 10-16h light/8-14 h dark).

After the leaves are incubated for 24 hours, washing the incubated leaf material for 3 times by using PBS, carrying out fixation treatment by using paraformaldehyde fixing solution with the concentration of 4%, then carrying out light-shielding treatment for 30 minutes, and then washing the leaf material for 3 times by using PBS; then treating with 0.5% Triton X-100 for 15min to promote EdU infiltration into cells; and then according to 488Click-iT EdU Imaging Kits (BN 16015, biorib, beijing) procedure A fluorescent agent is added and a fluorescent display treatment is performed (i.e., 1mL of a 1 XClick-iT reaction mixture (860. Mu.L of 1 XClick-iT EdU reaction buffer+40. Mu.L of CuSO4+2. Mu.L)>48Azide+100. Mu.L of 1 Xreaction buffer additive) into the permeabilized leaf material, incubating for 30min at room temperature in the absence of light, then washing the leaf with PBS 2 times), removing the washing solution and then performing confocal laser microscopy (Leica TCS SP8; leica, wetzlar, germany), respectively: the number of cells stained with EdU (green fluorescence), the chloroplast autofluorescence signal (red fluorescence), the bright field (no fluorescence signal, only the outline and morphology of the cells are shown), and the image under the co-localization (the green fluorescence emitted by EdU and the red fluorescence and bright field emitted by chloroplast, the superimposed image of the three) channel are photographed, and the difference in the number of cells in the S phase of the cell cycle in the leaf at different times of culture is analyzed.

The results showed that when the silver aspen 84K leaf was differentiated for 1 day, only a very small amount of S-phase cells emitting green fluorescence could be observed, and that on day 2, slightly more S-phase cells began to appear. When the silver adenophora 84K leaf is cultured on the 3 rd day, a large number of S-phase cells appear, are in the DNA replication phase, reach the peak value of the S-phase cell quantity at the moment, and are uniformly distributed at the cut of the leaf. At day 4 of leaf culture of populus deltoidea 84K, the number of cells in S phase began to decrease, presumably a large number of cells began to enter G2 phase or division phase. At day 5 of the cultivation of the silver adenophora 84K leaf, the number of S-phase cells is remarkably reduced, and the cells are scattered at the edge of the incision. In summary, it is assumed that the aspen 84K leaf is most suitable for genetic transformation on day 3 of culture. The number of cells in S phase stained with EdU from 84K leaf of Populus deltoides on day 3 of differentiation culture is shown in FIG. 1B.

3-2, fluorescent quantitative PCR detection

Total RNA was isolated from 84K leaves of Populus deltoides after the differentiation culture of step 1) for 0d, 1d, 2d, 3d, 4d, 5d, respectively, using a plant total RNA extraction kit (Tiangen, china, cat DP 432). RNA quality and concentration were measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, waltham, mass., USA). First strand cDNA was synthesized from total RNA using a cDNA synthesis kit (Tiangen, china, cat KR 106). UsingTop Green qPCR SuperMix (TRANSGEN, china, cat AQ 132-22) kit and reaction thereofThe system, performing real-time quantitative polymerase chain reaction (RT-qPCR) on a Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument and determining PagCDKB1; 2. PagCDKD1;1 and PagCYCD6; 1; />The reaction system of the Top Green qPCR SuperMix kit is shown in Table 3.

TABLE 3 Table 3Top Green qPCR SuperMix reaction system of kit

The reaction conditions for RT-qPCR are shown in Table 4.

TABLE 4 reaction conditions for RT-qPCR

Gene-specific primers were obtained by direct query of primer data qPrimerDB (https:// biodb. Swu. Edu. Cn/qPrimerdb) (see Table 5). The 2- ΔΔCt method was used to calculate the relative expression level of the gene. PagACTIN is a reference gene whose Ct value is used as a control to calculate PagCDKB1; 2. PagCDKD1;1 and PagCYCD6; 1.

Table 5 RT-qPCR primer Table:

the results show that cyclin kinase PagCDKB1 which acts in S phase when 84K poplar leaves are differentiated for 0-5 days; 2. PagCDKD1;1 and cyclin PagCYCD6;1, and the peak value is reached at the 3 rd day, and it is estimated that the genetic transformation is most suitable at this time, and the specific expression level results are shown in fig. 1C.

The results of FIG. 1C show that the expression levels of all 3 genes are highest on day 3 of differentiation culture, which is consistent with the aim of EdU staining, and can be used for indicating the S phase of the cell cycle, and since the period in which the expression levels of the three genes are highest is the S phase, the S phase of the cell cycle can be determined by detecting the expression levels of the 3 genes, and genetic transformation can be performed in the period.

Example 2A differentiation culture of Populus deltoides 84K in vitro stem segment receptor material, morphological anatomical observation, and cell cycle S phase discrimination

1. Differentiation culture

Cutting off the 84K tissue culture seedling plants of the populus euphratica growing for 4 weeks, cutting off the internode stem segments of the two leaves by scissors in an ultra-clean workbench, cutting off axillary buds, and then respectively spreading the cut stem segments into a culture dish (with the diameter of 9 cm) filled with a solid differentiation culture medium for culture (namely differentiation culture), wherein: the differentiation medium is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions were as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic observations of acceptor materials

2-1, observation with a split microscope:

in the differentiation culture process, the isolated culture stem sections treated in different culture times are respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, and the morphological characteristics of the incisions of the 5 isolated culture stem sections treated in different culture times and the appearance period of the callus are recorded, wherein: the morphological changes of the stem cut of the in vitro culture on the 4 th day of the differentiation culture are shown in figure 2; the morphology changes of the excised stem segment cuts at different culture times are shown in Table 6.

2-2, observation by an optical microscope:

internode stems between two leaves cultured for different times were rapidly placed in penicillin vials containing FAA fixative (5 mL 38% formaldehyde +5mL glacial acetic acid +90mL 50% ethanol) and stem paraffin sections were prepared according to the "step 2-2, optical microscopy" method of example 2. All materials were observed under an Olympus BX-51 type microscope and photographed. Wherein: stem cut paraffin sections were grown ex vivo at different culture times for cell development status as shown in table 6 and paraffin sections under light microscopy were observed as shown in fig. 2A.

TABLE 6 morphological anatomical features of in vitro cultured stem segments at different culture times of 84K

3. Cell cycle S phase identification

3-1, edU staining

And (3) staining the 84K stem segments of the populus euphratica which are cultured in vitro for different times by adopting an EdU staining method, and observing the distribution of fluorescent signals.

The 84K stem materials of the populus deltoides after 1d, 2d, 3d, 4d and 5d are respectively placed on a differentiation medium (MS basic culture medium+6 g/L agar+30 g/L sucrose+0.05 mg L-1 NAA+0.5mg L-1 6-BA) containing 10 mu M EdU for incubation culture, and the culture conditions of the incubation culture are respectively: the culture temperature is 25+/-2 ℃; the illumination is 2000lx (usually 1500-2500 lx); the illumination period is 16h light/8 h dark (typically 10-16h light/8-14 h dark).

After incubation of the stem segments for 24h, the following steps are the same as step 3-1 of example 2, except that the incubated stem segment material is washed 3 times with PBS.

Finally, the respective observations were made under a laser confocal microscope (Leica TCS SP8; leica, wetzlar, germany): the number of cells stained with EdU (green fluorescence), the chloroplast autofluorescence signal (red fluorescence), the bright field (no fluorescence signal, only the outline and morphology of the cells are shown), and the image under the co-localization (green fluorescence emitted by EdU and red fluorescence and bright field emitted by chloroplast, superimposed image of the three) channel are photographed, and the difference in the number of cells in the S phase of the cell cycle in 84K poplar stem segments at different times of culture is analyzed.

EdU staining of the 84K stem segment of Populus deltoides showed that cells in the S phase of the cell cycle began to appear and gradually increased from day 1-4, reaching maximum on day 4, after 1 day of differentiation culture. However, by day 5, the S-phase cell mass was reduced again. Therefore, the genetic transformation treatment effect is supposed to be optimal after the 84K stem segment of the populus tremulosa is cultured for 4 days. The number of cells in S phase stained with EdU from 84K stem segment of Populus deltoides on day 4 was shown in FIG. 2B.

3-2, fluorescent quantitative PCR detection

The subsequent steps and reaction systems, reaction conditions and primers used were the same as those of step 3-2 in example 2, except that total RNA was isolated from 84K stem sections of Populus deltoides after the differentiation culture of step 1) using a plant total RNA extraction kit (Tiangen, china, cat DP 432) respectively.

The results show that PagCDKB1;2, pagcdkdm 1;1 and PagCYCD6;1 are expressed in the highest amount when the cell cycle of a large number of cells is in S phase, namely, the 4 th day of differentiation culture. And showed an increasing trend on days 1-4 of culture, and the expression level was decreased again in 84K Yang Shujing on day 5 of culture. Therefore, the genetic transformation treatment effect is supposed to be optimal after the 84K stem segment of the populus tremulosa is cultured for 4 days. The result of the expression level is shown in FIG. 2C.

The results in FIG. 2C show that the expression levels of all 3 genes are highest on day 4 of culture, which is consistent with the objective of EdU staining, and indicates the S phase of the cell cycle, since the period in which the expression levels of the three genes are highest is the S phase, and genetic transformation is most suitable in this period. The optimal transformation treatment period for the stem segments here is therefore day 4.

Example 2B differentiation culture of tobacco in vitro leaf receptor Material, morphological anatomical observations, and discrimination of cell cycle phase S

1. Differentiation culture of receptor material

2 nd, 3 rd and 4 th fully unfolded leaves of the aseptic tobacco seedlings with the seedling age of about 15d are cut in an ultra-clean workbench, the leaves are cut into 2 pieces by a longitudinal cutter 1 of the main pulse of the leaves, and the 2 pieces are longitudinally cut on each leaf but not completely cut off;

the sheared leaves were spread on a petri dish (diameter: 12 cm) containing a solid differentiation medium for culture (i.e., differentiation culture), wherein the differentiation medium was: MS minimal medium+NAA 0.01mg/L+6-BA 0.2 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions were as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

2. Microscopic observation of leaf receptor materials

2-1, stereoscopic microscope observation:

In the tobacco leaf differentiation culture process, the in-vitro culture leaves treated in different culture times are respectively placed under a stereoscopic microscope (Olympus SZX 12) for observation, the incision morphology change of the 5 in-vitro culture leaves treated in different culture times is recorded, and the appearance period of the callus is observed. Wherein: the morphology changes of the in vitro culture leaf cuts at different differentiation culture times are shown in Table 4; the change of incision morphology on day 2 of differentiation culture under a stereomicroscope is shown in FIG. 3.

2-2, observation by an optical microscope:

tobacco leaves subjected to differentiation culture for different times were cut into small pieces of 0.5cm×0.5cm, and then rapidly placed in penicillin vials containing FAA fixative (5 mL 38% formaldehyde +5mL glacial acetic acid +90mL 50% ethanol), and then prepared into tobacco paraffin sections according to the "step 2-2, optical microscopy" method of example 2. All materials were observed under an Olympus BX-51 type microscope and photographed. Wherein: leaf cell characteristics of tobacco in vitro cultures at various culture times are shown in Table 7 and paraffin sections under light microscopy are shown in FIG. 3A.

TABLE 7 morphological anatomical features of tobacco in vitro culture leaves at different culture times

3. Cell cycle S phase identification

3-1, edU staining

Tobacco leaves cultured in vitro for different times are stained by adopting an EdU staining method, and the distribution condition of fluorescent signals is observed.

The tobacco leaf materials after the differentiation culture of 1d, 2d, 3d, 4d and 5d in the step 1) are respectively placed on differentiation culture media (MS basic culture media+6 g/L agar+30 g/L sucrose+0.05 mg L-1NAA+0.5mg L-1 6-BA) containing 10 mu M EdU, and respectively subjected to incubation culture, wherein the incubation culture conditions are as follows: the culture temperature is 25+/-2 ℃; the illumination is 2000lx (usually 1500-2500 lx); the illumination period is 16h light/8 h dark (typically 10-16h light/8-14 h dark).

The subsequent procedure was the same as in example 2, step 3-1) except that after incubation of the tobacco leaves for 24h, the incubated leaf material was washed 3 times with PBS.

Finally, the number of cells stained with EdU (green fluorescence), the chloroplast autofluorescence signal (red fluorescence), the bright field (no fluorescence signal, only showing the outline and morphology of the cells), and the co-localization (green fluorescence from EdU and red fluorescence from chloroplast and bright field, superimposed images of the three) of the channels were observed under a laser confocal microscope (Leica TCS SP8; leica, wetzlar, germany) and photographed, and the difference in cell cycle S phase cell numbers in tobacco leaves at different times of culture was analyzed.

The EdU staining results of tobacco leaves showed that S-phase cells appeared from day 1, and a large number of S-phase cells appeared at day 2, peaking. The number of S-phase cells that fluoresce green was gradually decreased on days 3-5. In summary, it is presumed that the effect of genetic transformation treatment of tobacco leaves at day 2 of differentiation culture is optimal. The number of tobacco leaf EdU stained S phase cells on day 2 of culture is shown in FIG. 3B.

3-2, fluorescent quantitative PCR detection

The following steps, reaction system and reaction conditions were the same as in step 3-2) "fluorescent quantitative PCR detection" in example 2, except that total RNA was isolated from tobacco leaves after culturing for 0d, 1d, 2d, 3d, 4d, 5d, respectively, in step 1) using a plant total RNA extraction kit (Tiangen, china, cat DP 432).

Wherein: gene-specific primers were obtained by direct query of primer data qPrimerDB (https:// biodb. Swu. Edu. Cn/qPrimerdb) (see Table 8). The 2- ΔΔCt method was used to calculate the relative expression level of the gene. NtACTIN is a reference gene whose Ct value is used as a control to calculate NtCDKB1;2, ntcdkd1;1 and NtCYCD6; 1.

TABLE 8 RT-qPCR primers

Primer name	Primer sequences
		NtActin-F	CCACACAGGTGTGATGGTTG
NtActin-R	GTGGCTAACACCATCACCAG
		NtCDKB1；2-F	ATAAAGCAAAGGACAAGGCGA
NtCDKB1；2-R	ACACAGAGGAGACGAACGAT
		NtCDKD1；1-F	TCTTCCTCTCACCTGCGGAT
NtCDKD1；1-R	GGCAAAGACCTGGTGAGTGA
		NtCYCD6；1-F	CTAAAAGCCAGAGCCACTGAGA
NtCYCD6；1-R	CGTGAGAAGCACAGAGAAGAG

The results indicate that NtCDKB1 acts in S phase; 2, ntcdkd1;1 and NtCYCD6;1 was expressed most at day 2 of culture. Wherein, ntCDKB1;2 was the lowest on day 0, while NtCDKD1;1 and NtCYCD6;1 increases in the expression level at day 0-2 and decreases at day 2-5. Therefore, it is presumed that the effect of genetic transformation treatment of tobacco leaves at day 2 of cultivation is optimal. The expression level is shown in FIG. 3C.

The results in FIG. 3C show that the expression levels of all 3 genes are highest on day 2 of culture, which is consistent with the objective of EdU staining, and indicates the S phase of the cell cycle, since the period in which the expression levels of the three genes are highest is the S phase, and genetic transformation is most suitable in this period. The optimal period of transformation treatment for tobacco lamina is therefore day 2.

EXAMPLE 3 genetic transformation of Populus deltoides 84K leaves

1. Preparation of an infectious microbe liquid

According to the existing preparation method of the dip-dyeing bacteria in the field

Constructing a target gene (MYC 2) on an expression vector (PBI 121) by adopting a seamless cloning method to obtain a vector plasmid (MYC 2-PBI 121) with a target gene fragment; followed by transformation into GV3101 Agrobacterium competence (purchased from Di Bio Inc.); then picking up a monoclonal on a flat plate, taking a 35S sequence on an expression vector (PBI 121) as an upstream primer F and a segment of sequence on a target gene as a downstream primer R, performing colony PCR detection, then picking up a positive single colony, inoculating the positive single colony into 50ml (each bottle) of YEB liquid culture medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, adding water to a constant volume to 1L, and sterilizing for 15 min) with the addition of 50mg/L kanamycin and 25mg/L rifampicin, and performing liquid suspension culture, wherein the liquid suspension culture temperature is 28 ℃ (usually 27-29 ℃); the rotating speed is 180-200rpm; culturing until the bacterial liquid is uniform and consistent, and OD of the bacterial liquid ₆₀₀ Reaching 0.6 to 0.8 (usually OD) ₆₀₀ 0.6 to 0.8) to prepare the infectious microbe liquid.

The target gene for genetic transformation in the method is homologous or heterologous free DNA molecules (plasmid and chromosome DNA), namely genes transferred into plants to be subjected to genetic transformation, and the target genes such as transcription factors, functional genes for growth and development, reproduction, stress resistance and the like are used as target genes in the specific embodiment, wherein the target genes in the embodiment are illustrated by taking transcription factor MYC2 as an example, and other functional genes such as BZIP53 or transcription factors are suitable for the invention.

In the specific embodiment of the present invention, the expression vector is exemplified by PBI121, and other expression vectors known in the art, such as pCambia1304, pROKII, etc., are suitable for the present invention in addition to the expression vector PBI 121.

The GV3101 Agrobacterium competent transformation procedure was as follows:

first,: taking agrobacterium tumefaciens competence stored at-80 ℃ at room temperature, and inserting into ice when part of the agrobacterium tumefaciens competence is melted and is in an ice water mixing state;

then: adding 0.01-1 μg of plasmid DNA (namely, vector plasmid with target gene fragment obtained after constructing target gene on PBI121 vector, with higher conversion efficiency, preferably making pre-experiment to determine the amount of the added plasmid before first use) into 100 μl of agrobacterium competence, stirring tube bottom, mixing, sequentially standing on ice for 5min, liquid nitrogen for 5min, 37 ℃ water bath for 5min, and ice bath for 5min;

and then following: adding 700 μl of LB culture medium (5 g/L yeast extract, 10g/L peptone, 10g/L sodium chloride, adding water to a constant volume of 1L, sterilizing at 121deg.C for 15 min) or YEB liquid culture medium, and shake culturing at 28deg.C for 2-3 hr.

Then: centrifuging at 6000rpm for 1min, removing part of supernatant, collecting about 100 μl supernatant, gently blowing off the centrifuged precipitate, re-suspending the pellet, coating on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-4 days until colony grows on the plate; wherein:

The LB or YEB plate culture medium containing the corresponding antibiotics is as follows: LB or YEB plate medium contains 50. Mu.g/ml Kan or both 50. Mu.g/ml Kan and 20. Mu.g/ml Rif or 50. Mu.g/ml Rif; when the plate only contains 50 mug/ml Kan, culturing at 28 ℃ for 48 hours; when 50 mug/ml Kan and 20 mug/ml Rif are added into the flat plate at the same time, the culture is carried out for 60 hours at 28 ℃; if the plate used contains 50. Mu.g/ml Rif, it is incubated at 28℃for 72-90h.

2. Treatment of infestation

The isolated leaves of the aspen 84K which are not subjected to differentiation culture (0 day) and differentiation culture for different times (1, 2, 3, 4 and 5 days) in the example 2 are respectively soaked in the infection bacterial liquid prepared in the step 1) for 15min (usually 10-15 min); then taking out the leaf and sucking the bacterial liquid on the surface of the leaf to dryness by using sterile filter paper; the leaves were then individually spread onto a petri dish (9 cm diameter) containing an infection-co-cultivation medium, and subjected to an infection treatment in the dark, wherein: the infection-co-culture medium was: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; conditions of infection-co-cultivation: the co-culture temperature is 25+/-2 ℃; dark cultures are performed for 2-3 days (usually 2 days) to obtain infection-ex vivo leaves.

3. Screening treatment of resistant shoots

Placing the infected-isolated leaves subjected to the infection treatment for 2-3 days in distilled water containing cephalosporin, and washing for 25min (usually 20-30 min), wherein the concentration of the cephalosporin in the distilled water containing cephalosporin is 50mg/L (usually 40-55 mg/L); respectively washing with distilled water for 3-5 times for 2min each time, and sucking water with sterilized filter paper; then, respectively spreading the leaves into a culture dish filled with a selective differentiation medium, and screening the resistant buds, wherein the selective differentiation medium is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions for the resistant bud screening treatment were as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the resistant buds are screened and cultured for about 1 week, the wound parts of the leaves start to deform, the leaves show waving, and the resistant buds grow out for about 2 weeks.

4. Rooting culture of resistant buds

When the growth of the resistance buds growing on the selective differentiation medium is 1-2cm, respectively shearing with sterile scissors, and respectively inoculating to the selective rooting medium for rooting culture, wherein the selective rooting medium is: 1/2MS minimal medium+NAA 0.02mg/L+IBA 0.05mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. Rooting culture time is 2-4 weeks, and regenerated plants are obtained.

In the pretreatment process, infection treatment is carried out according to the change of the incision morphology of the receptor material and the development state of the primordial cells of the receptor material, and the number of the obtained regenerated plants is shown in Table 5. When 3-4 fully developed leaves are grown on the regenerated plant, DNA detection is carried out on the regenerated plant.

5. Detection of resistant positive plants

DNA detection was performed on plants obtained by rooting culture, by the operation of a novel plant genomic DNA extraction kit (DP 320-03, tiangen Biochemical technology (Beijing) Co., ltd.).

1-2 leaves of the regenerated plant obtained after antibiotic screening are ground by liquid nitrogen, DNA extraction is carried out by adopting a novel plant genome DNA extraction kit of Tiangen biochemical technology Co., ltd, and the collected DNA is placed at-20 ℃ for standby.

PCR amplification was performed using the extracted DNA as a template, and 10ul of Taq enzyme and 8ul of ddH were added to the PCR tube ₂ O, 0.5ul primer F/R, 1ul DNA, and a total volume of 20ul system, wherein the upstream primer F for PCR amplification is designed and synthesized according to the sequence of a vector (PBI 121), and the downstream primer R is designed and synthesized according to the sequence of a gene (MYC 2); f: CTATCCTTCGCAAGACCCTTC; r: GTTCTGCATTCTTTGAAAA AT.

The PCR amplification primer is designed and synthesized according to the conventional method known in the art, namely, the upstream primer is designed and synthesized according to the gene sequence of the expression vector; the downstream primer is designed and synthesized according to the gene sequence of the target gene.

In this embodiment, the upstream primer F is designed and synthesized according to the sequence of the expression vector PBI121, and the downstream primer R is designed and synthesized according to the sequence of the target gene MYC 2. The upstream primer F is suitable for genetic transformation of all genes using PBI121 as a vector, and can be used as long as the vectors are identical since the primer is designed from the vector sequence of the PBI 121. However, the downstream primer R can be used only for the target gene, and since the sequence of each target gene is different, the downstream primer is also different.

The PCR procedure is that the pre-denaturation is carried out for 4min at 94 ℃, and the cyclic amplification stage is carried out: cycling for 30 times at 94 ℃ for 30s,55 ℃ for 30s and 72 ℃ for 1 min; the reaction was terminated by incubating at 72℃for 5min, and the PCR product was stored at 4 ℃.

Performing electrophoresis separation on the PCR product for 30min under the constant pressure of 140V in 1.2% agarose gel, checking the target gene band by using a gel imager, and judging that the plant is positive if the band conforming to the target gene length (1416 bp) exists after electrophoresis detection; the electrophoresis detection is as in FIG. 4, wherein markers 1, 2, 3, 4, 6, 7 in FIG. 4 are positive; 5. 8, 9 are false positives; 10 is a negative control (control 1), P is a positive control (control 1A), and M is Maker. The positive genetic transformation efficiency was calculated according to formula (1), the measurement results are shown in Table 9, and formula (1) is as follows:

Genetic transformation efficiency (%) =number of positive seedlings/number of rooted seedlings x100% (1)

EXAMPLE 3A genetic transformation of the 84K Stem segment of Populus deltoides

1. Preparation of an infectious microbe liquid

The same as in step 1) of example 3.

2. Treatment of infestation

Respectively soaking the isolated stem segments of the aspen 84K which are not subjected to differentiation culture (0 day) and differentiation culture for different times (1, 2, 3, 4 and 5 days) in the infection bacterial liquid prepared in the step 1) for 15min (usually 10-15 min); then taking out the stem segments, and sucking the bacterial liquid on the surfaces of the stem segments by using filter paper; the stem segments were then spread separately into a petri dish (9 cm diameter) containing an infection-co-cultivation medium, and subjected to an infection-co-cultivation treatment under dark conditions, wherein: the infection-co-culture medium was the same as in example 3; the culture conditions for the infection-co-culture were as follows: the co-culture temperature is 25+/-2 ℃; dark culture for 2-3 days (usually 2 days) to obtain the infection-isolated stem segment.

3. Screening of resistant shoots

Placing the infection-isolated stem segments which are subjected to infection-co-culture for 2-3 days in distilled water containing cephalosporin, and washing for 25min (usually 20-30 min), wherein the concentration of the cephalosporin in the distilled water containing cephalosporin is 50mg/L (usually 45-55 mg/L); respectively washing with distilled water for 3-5 times for 2min each time, and sucking water with sterilized filter paper; then spreading the stem segments into culture dishes containing selective differentiation culture medium, and screening and culturing the resistant buds, wherein the selective differentiation culture medium is the same as that of the example 3; the culture conditions for the resistant bud screening culture are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the resistant buds are screened and cultured for about 1 week, the wound of the stem begins to expand, and the resistant buds grow out for about 2 weeks.

4. Rooting culture of resistant buds

The same as in step 4 of example 3.

5. Detection of positive plants

The same as in step 5 of example 3. Positive genetic transformation efficiencies were calculated according to equation (1) and the results are shown in Table 9.

EXAMPLE 4 genetic transformation of tobacco leaves

1. Preparation of an infectious microbe liquid

Constructing a target gene (BZIP 53) on an expression vector (PBI 121) by adopting a seamless cloning method to obtain a vector plasmid (BZIP 53-PBI 121) with a target gene fragment; followed by transformation into GV3101 Agrobacterium competence; then picking up a monoclonal on a flat plate, taking 35S on an expression vector (PBI 121) as an upstream primer F and taking a segment of sequence on a target gene as a downstream primer R, performing colony PCR detection, then picking up a positive single colony, inoculating the positive single colony into 50ml (each bottle) of YEB liquid culture medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, adding water to a constant volume to 1L, and sterilizing for 15 min) with the addition of 50mg/L kanamycin and 25mg/L rifampicin, and performing liquid suspension culture, wherein the liquid suspension culture temperature is 28 ℃ (usually 27-29 ℃); the rotating speed is 180-200rpm; culturing until bacterial liquid is uniform and consistent, and bacterial liquid OD ₆₀₀ Reaching 0.6 to 0.8 (usually OD) ₆₀₀ 0.6 to 0.8) to prepare the infectious microbe liquid.

2. Treatment of infestation

Respectively soaking tobacco in vitro leaves which are not subjected to differentiation culture (0 day) and differentiation culture for different times (1, 2, 3, 4 and 5 days) in the infection bacterial liquid prepared in the step 1) in an ultra clean bench for 15min (usually 10-15 min); then taking out the leaf and sucking the bacterial liquid on the surface of the leaf to dryness by using sterile filter paper; then, the leaves are respectively spread into a culture dish (with the diameter of 12 cm) containing a tobacco co-culture differentiation medium, and infection-co-culture treatment is carried out under dark conditions, wherein the infection-co-culture medium is as follows: MS minimal medium+NAA 0.01mg/L+6-BA 0.2 mg/L+agar 6 g/L+sucrose 30g/L; the infection-co-culture conditions were as follows: the co-culture temperature is 25+/-2 ℃; dark culturing for 2-3d to obtain the infection-in-vitro leaf blade.

3. Screening of resistant shoots

Placing the infection-isolated leaves which are subjected to infection co-culture for 2-3 days in distilled water containing cephalosporin, and washing for 20min (usually 20-30 min), wherein the concentration of the cephalosporin in the distilled water containing cephalosporin is 250mg/L (usually 240-260 mg/L); respectively washing with distilled water for 3-5 times for 2min each time, and sucking water on the surfaces of the blades with sterile filter paper; then, respectively spreading the leaves into a culture dish filled with a selective differentiation medium, and screening the resistant buds, wherein the selective differentiation medium is: MS minimal medium+NAA 0.01mg/L+6-BA 0.2mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions for the resistant bud screening culture are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; after the resistant buds are screened and cultured for about 10 days, the wound parts of the leaves start to deform, the leaves show waving, and the calli grow gradually and differentiate into buds about 30 days.

4. Rooting culture of resistant buds

When buds in a selective differentiation medium grow to about 1-2cm, shearing the buds by using sterile scissors, and respectively inoculating the buds to a selective rooting medium for rooting culture, wherein the selective rooting medium is: MS basic culture medium, IBA 0.4mg/L, kan 30mg/L, tim 200mg/L, agar 6g/L and sucrose 30g/L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. Rooting culture time is about 20d, and regenerated plants are obtained.

The amount of regenerated plants obtained by dip-dyeing treatment according to the different states of callus development at the incision during pretreatment is shown in Table 6. And (3) when 3-4 fully developed leaves grow out of the plant, detecting DNA.

5. Detection of positive plants

Taking 1 leaf fully developed by the regenerated plant obtained after antibiotic screening, adding liquid nitrogen and fully grinding. The DNA was extracted using a novel plant genome DNA extraction kit (DP 320-03) from Beijing Tiangen Biochemical technologies Co., ltd according to the instructions, and the collected DNA was placed at-20℃for use.

PCR amplification was performed using the extracted DNA as a template, and 10ul of Taq enzyme and 8ul of ddH were added to the PCR tube ₂ O, 0.5ul primer F/R, 1ul DNA, and a total volume of 20ul system, wherein the upstream primer F for PCR amplification is designed and synthesized according to the sequence of a vector (PBI 121), and the downstream primer R is designed and synthesized according to the sequence of a gene (BZIP 53); f: CTATCCTTCGCAAGACCCTTC; r: TGAACTTGTGGCCGTTTAC.

In this example, the upstream primer F was designed and synthesized according to the sequence of the expression vector PBI121, and the downstream primer R was designed and synthesized according to the sequence of the target gene BZIP 53.

Separating the PCR product by electrophoresis under constant pressure 140V in 1.2% agarose gel for 20min, checking the target gene band by using a gel imager, and judging the plant as positive if the band meeting the target gene length (432 bp) is observed in gel electrophoresis; the electrophoresis detection is as in FIG. 5, wherein markers 1, 2, 3, 5, 6, 9, 10 in FIG. 5 are positive; 4. 7 and 8 are false positives; 11 is a negative control (control 2), P is a positive control (control 2A), and M is Maker.

Positive genetic transformation efficiencies were calculated according to equation (1), and the measurement results are shown in Table 9.

Comparative example 1 PCR amplification of wild type Populus deltoides 84K

The wild type Populus deltoides 84K leaves are ground by liquid nitrogen, DNA is extracted by a kit (DP 320-03), and the genomic DNA of the wild type Populus deltoides 84K is used as a negative control template for PCR amplification, wherein a PCR amplification system and an amplification program are the same as those of the PCR amplification of the resistant positive plants screened in the embodiment 3. The electrophoresis detection is as shown in FIG. 4. Positive genetic transformation efficiencies were calculated according to equation (1), and the measurement results are shown in Table 9.

Comparative example 1A PCR amplification of the 84K positive control of Populus deltoides

PCR amplification was performed using the DNA of MYC2-PBI121 vector plasmid in step "1, preparation of infectious bacteria liquid" of example 3 as a template, wherein the PCR amplification system and amplification procedure were the same as those of the resistant positive plants selected in example 3. The electrophoresis detection is as shown in FIG. 4. Positive genetic transformation efficiencies were calculated according to equation (1), and the measurement results are shown in Table 9.

Comparative example 2 PCR amplification of wild type tobacco

The wild tobacco leaf extracted DNA is selected as a negative control template for PCR amplification, wherein the PCR amplification system and the amplification procedure are the same as those of the screening of the resistant positive plants in the example 4. The electrophoresis detection is as shown in FIG. 5. Positive genetic transformation efficiencies were calculated according to equation (1), and the measurement results are shown in Table 9.

Comparative example 2A PCR amplification of tobacco positive control

PCR amplification was performed using the DNA of the BZIP53-PBI121 vector plasmid in step "1, preparation of infectious microbe liquid" of example 4 as a template, wherein the PCR amplification system and amplification procedure were the same as those of the resistant positive plants selected in example 4. The electrophoresis detection is as shown in FIG. 5. Positive genetic transformation efficiencies were calculated according to equation (1), and the measurement results are shown in Table 9.

TABLE 9 genetic transformation rates of poplar and tobacco at different differentiation culture times

As can be seen from table 9: the highest infection conversion efficiency of the silver adenophora 84K leaf blade culture on the 3 rd day can reach 86.58%; the genetic transformation efficiency of the 84K stem of the populus deltoidea is highest at the 4 th day, and can reach 77.83%; at day 2 of tobacco cultivation, the conversion efficiency of infected tobacco leaves is highest and can reach 57.33%.

The above results indicate that when a clear yellow brown bulge starts to appear at the incision site of the leaves of the recipient plant material to be genetically transformed, as observed under a stereoscopic microscope, small cells without vacuoles, dense cytoplasm, enlarged nuclei and darkened color are observed under paraffin sections; or the notch part of the stem section of the receptor plant material starts to shrink by water loss, the outer edge is obviously enlarged, more small cells with thick cytoplasm are observed under paraffin sections, the cell nucleus is enlarged and the color is deepened, and when the leaf bud primordial cells are in the S phase of the cell cycle, the optimal treatment period is provided for the cytogenetic transformation of the receptor material, and the receptor material is subjected to the genetic transformation at the moment, so that the genetically transformed plant can be stably and efficiently obtained, the problems of unstable genetic transformation efficiency and the like in the prior art can be overcome, and the genetic transformation efficiency is ensured to be obviously improved.

The invention carries out differentiation culture on plant sterile receptor materials for creating wounds (with incisions or wounds), observes and judges morphological characteristics of the incisions in real time, and the development state of germ cells of the receptor materials under paraffin sections, and carries out genetic transformation treatment at proper time according to the incision morphology, the cell development state and the number of cells in S phase of a cell cycle of the receptor materials. The method can relatively accurately judge the genetic transformation time, namely the optimal treatment period of the genetic transformation of the receptor material cells, and timely carry out the genetic transformation treatment to obtain the genetic transformation plants.

The method is based on the principle that leaf bud primordia of different plant receptor materials form and develop under the in vitro culture condition, effectively judges that the plant receptor materials apply genetic transformation when leaf bud primordia cells induce development to a chromatin activation period (namely, the leaf bud primordia cells are in a cell cycle S phase), realizes target gene transformation or modification of most of leaf bud primordia, and remarkably improves plant genetic transformation rate, stability and repeatability.

Claims

1. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on 84K silver gland poplar leaves of a sterile plant explant acceptor material with scratches or cuts; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; then, genetic transformation treatment is carried out on the receptor material subjected to the differentiation culture treatment, wherein the yellow brown bulge is observed to appear at the incision of the leaf in a microscopic way, and the receptor material is transparent; the whole blade is curled; no callus formation; and more small cells without vacuoles and with dense cytoplasm are seen, and when the nuclei of the small cells are enlarged and the color of the small cells is deepened, genetic transformation is performed on the receptor material.

2. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on 84K silver gland poplar leaves of a sterile plant explant acceptor material with scratches or cuts; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; observing and determining the development state or stage of cells at the incision or scratch part of the receptor material by EdU staining the receptor material treated by the differentiation culture; carrying out real-time fluorescent quantitative PCR detection on the receptor material subjected to differentiation culture treatment, and determining the expression condition of the cell cycle S phase related genes of the receptor material; then, genetic transformation treatment is carried out on the receptor material subjected to the differentiation culture treatment, wherein the yellow brown bulge is observed to appear at the incision of the leaf in a microscopic way, and the receptor material is transparent; the whole blade is curled; no callus formation; and more small cells without vacuoles and dense cytoplasm are visible, when the nuclei of the small cells are enlarged and the color is deepened, and by EdU staining, when a large number of cells are observed to emit green fluorescence, the number of cells in the S phase of a cell cycle is the largest, and the gene CDKB1, 2, CDKD1, 1 or CYCD6 detected in the receptor material is detected by real-time fluorescence quantitative PCR, and when the expression level of the receptor material is the highest, genetic transformation treatment is carried out on the receptor material.

3. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on a sterile plant explant acceptor material 84K silver gland poplar stem segment with scratches or incisions; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; then, genetic transformation treatment is carried out on the receptor material subjected to the differentiation culture treatment, wherein the stem section epidermis is observed to be green in a microscopic way; the cut sections at the two ends start to shrink due to water loss, and the outer edge is obviously enlarged; no callus formation; the cross section is obviously enlarged, the cell size at the incision is obviously increased, the edge is irregularly shaped, a large number of small cells without vacuoles and with thick cytoplasm are visible, and when the cell nucleus is enlarged and the color is deepened, the receptor material is genetically transformed.

4. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on a sterile plant explant acceptor material 84K silver gland poplar stem segment with scratches or incisions; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; observing and determining the development state or stage of cells at the incision or scratch part of the receptor material by EdU staining the receptor material treated by the differentiation culture; carrying out real-time fluorescent quantitative PCR detection on the receptor material subjected to differentiation culture treatment, and determining the expression condition of the cell cycle S phase related genes of the receptor material; then, genetic transformation treatment is carried out on the receptor material subjected to the differentiation culture treatment, wherein the stem section epidermis is observed to be green in a microscopic way; the cut sections at the two ends start to shrink due to water loss, and the outer edge is obviously enlarged; no callus formation; the cross section is obviously enlarged, the cell size at the incision is obviously increased, the edge is in an irregular shape, a large number of small cells without vacuoles and with thick cytoplasm are visible, when the cell nucleus is enlarged and the color is deepened, and through EdU staining, when a large number of cells are observed to emit green fluorescence, the number of cells in the S phase of a cell cycle is the largest, and when the real-time fluorescence quantitative PCR detects the gene CDKB1, 2, CDKD1, 1 or CYCD6 detected in the receptor material, and the expression level of the gene CDKB1, 2, CDKD1 or CYCD6 detected in the receptor material is the highest, the receptor material is subjected to genetic transformation.

5. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on sterile plant explant acceptor material tobacco leaves with scratches or incisions; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; then, genetic transformation treatment is carried out on the receptor material subjected to differentiation culture treatment, wherein the surface of the tobacco leaf is observed to be semi-moist in a microscopic way, the color is green, the vein texture is clear and dark green, the incision of the leaf starts to curl and dry, no callus is formed, and the epidermal cells of the leaf start to expand; it is seen that a large number of vacuole-free, cytoplasmic-dense minicells, when their nuclei are stained evident, undergo genetic transformation of the receptor material.

6. A method for increasing the efficiency of genetic transformation of a plant comprising: firstly, carrying out differentiation culture treatment on sterile plant explant acceptor material tobacco leaves with scratches or incisions; then, microscopic observation is carried out on the receptor material, and the development state of cells at the incision or scratch part of the receptor material is determined; observing and determining the development state or stage of cells at the incision or scratch part of the receptor material by EdU staining the receptor material treated by the differentiation culture; carrying out real-time fluorescent quantitative PCR detection on the receptor material subjected to differentiation culture treatment, and determining the expression condition of the cell cycle S phase related genes of the receptor material; then, genetic transformation treatment is carried out on the receptor material subjected to differentiation culture treatment, wherein the surface of the tobacco leaf is observed to be semi-moist in a microscopic way, the color is green, the vein texture is clear and dark green, the incision of the leaf starts to curl and dry, no callus is formed, and the epidermal cells of the leaf start to expand; it can be seen that when a large number of small cells without vacuoles and with dense cytoplasm are stained obviously, and by EdU staining, when a large number of cells are observed to emit green fluorescence, the number of cells in the S phase of the cell cycle is the largest, and the gene CDKB1, 2, CDKD1, 1 or CYCD6 detected in the receptor material is detected by real-time fluorescence quantitative PCR, and when the expression level of 1 is the highest, genetic transformation treatment is carried out on the receptor material.

7. The method of any one of claims 1-6, wherein the differentiation culture treatment is a differentiation culture by inoculating a sterile plant explant recipient material into a differentiation medium.

8. The method of claim 7, wherein the differentiation medium for the receptor material is: MS basic culture medium, NAA 0.005-0.05mg/L, 6-BA 0.1-0.5mg/L, agar 6g/L and sucrose 30g/L.

9. The method of claim 7, wherein the differentiation medium for the recipient material is MS minimal medium+NAA 0.01-0.05 mg/L+6-BA 0.2-0.5 mg/L+agar 6 g/L+sucrose 30g/L.

10. The method of any one of claims 1-6, wherein the genetic transformation treatment comprises transforming plant explant recipient material after the differentiation culture treatment using agrobacterium infection or gene gun; and then sequentially inoculating the transformed receptor material on a selective differentiation medium and a selective rooting medium to perform selective culture of the resistant plants.

11. The method of claim 10, wherein the selective differentiation medium is: MS basic culture medium, NAA 0.005-0.05mg/L, 6-BA 0.1-0.5mg/L, kan 20-40mg/L, tim 150-250mg/L, agar 6g/L and sucrose 30g/L.

12. The method of claim 10, wherein the selective differentiation medium is MS minimal medium+naa 0.01-0.05 mg/l+6-BA 0.2-0.5 mg/l+kan30mg/l+tim200mg/l+agar 6 g/l+sucrose 30g/L.