CN103088036B - Soybean gmmads2 gene and application thereof - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering, and relates to a soybean GmMADS2 gene and an application thereof. The GmMADS2 gene which plays an important regulation and control role in controlling pod coat cracking and floral organ development is cloned from soybean, and the sequence of the GmMADS2 gene is shown in SEQIDNO.1. Expression analysis of an mRNA gene proves that the gene can participate in the development of pistil, pod and seed coat, and furthermore, reproductive organ variation of arabidopsis capable of over-expressing the GmMADS2 gene proves that the GmMADS2 gene plays a very important regulation and control role in controlling pod cracking and petal development. The invention discloses a genetic engineering improvement method for modifying the plant reproductive organ by the gene, and the method has a certain effect on the cultivation of a plant variety with varied reproductive organs, especially on the cultivation of the soybean, and serves for the improvement of the crop seed production efficiency by modifying flower organ forms and pod forms in an oriented manner to further serve for the increase of crop yield, especially the increase of soybean yield.

Description

Soybean GmMADS2 gene and application thereof

Technical field

The invention belongs to plant genetic engineering field, relate to soybean gmMADS2gene and application thereof.

Background technology

sHPgene belongs to ovule characterizing gene, has the function of D genoid, and it has vital role at aspects such as ovule characteristics determined, Carpel Development and fruit maturation crackings.After fruit maturation, can ftracture, discharge seed, in good time cracking is conducive to the collection of seed, and cracking is unfavorable for the results of agricultural-food too early.Soybean is as important leguminous plants, and its high protein, high oil content content occupy special and consequence always in human and animal's nutrition, but soybean later stage results process is easily split pod.Along with Soybean Industry, mass-producing development, mechanized cultivation area progressively expands now, and the loss that soybean is split pod has become one of main loss in soybean mechanization production, and this loss is that manpower institute is uncontrollable.Therefore in soybean breeder process, require kind to there is good cracking resistance pod characteristic.Therefore, understand fully the molecular mechanism that soybean pod is grown, and then for transformation pod organ provides basis, there is important theory and realistic meaning.

Summary of the invention

The object of the present invention is to provide and disclose a soybean sHPgene gmMADS2.

Another object of the present invention is to provide the genetically engineered application of this gene in reproductive organ transformation.

Object of the present invention can be achieved through the following technical solutions:

Soybean sHPgene gmMADS2, nucleotides sequence is classified SEQ ID NO. 1 as.

Soybean of the present invention sHPgene gmMADS2the protein of coding, its aminoacid sequence is SEQ ID NO. 2.

Contain soybean of the present invention sHPgene gmMADS2expression vector.

Soybean of the present invention sHPgene gmMADS2genetically engineered application.

Soybean of the present invention sHPgene gmMADS2the preferably genetically engineered application in plant generative organ's transformation.

The preferred floral organ of described plant generative organ and fruit pod form.

Use gmMADS2while building plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter.For the ease of transgenic plant cells or plant are identified and are screened, can process to plant expression vector used selected marker's (gus gene, luciferase genes etc.) that can express as added or the antibiotic marker thing (gentamicin marker, kantlex marker etc.) with resistance in plant.From the security consideration of transgenic plant, also can not add any selected marker, directly with phenotypic screen transformed plant.

Carry the present invention gmMADS2plant expression vector can by using, Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity be led, conventional biological method transformed plant cells or the tissue such as agriculture bacillus mediated, and the plant tissue of conversion is cultivated into plant.The plant host being converted can be both the monocotyledonss such as paddy rice, wheat, corn, can be also the dicotyledonss such as soybean, cucumber, tomato, willow, turfgrass, clover.

beneficial effect

The present invention has cloned 1 and has ftractureed and brought into play the gene of important regulating and controlling effect at control pod wall from soybean gmMADS2, this gene mRNA expression analysis shows that it likely participates in the growth of gynoecium, pod and seed coat, further overexpression gmMADS2the reproductive organ of Arabidopis thaliana change and show that GmMADS2 has brought into play important regulating and controlling effect controlling fruit pod cracking and petal development.The invention discloses the genetically engineered modification method that this gene carries out plant generative organ's transformation.The plant variety that the method changes cultivation reproductive organ particularly soybean varieties tool has certain effect, can be by directionally transforming floral organ and the fruit pod form of crop, for farm crop are improved seed production efficiency service, and then for improving the particularly output service of soybean of farm crop.

Utilize plant expression vector, by of the present invention gmMADS2import vegetable cell, can obtain transgenic cell line and transfer-gen plant that reproductive organ changes.

Brief description of the drawings

Fig. 1 gmMADS2the tissue expression analysis of gene.

Adopt sxemiquantitative RT-PCR and implement quantitative PCR technique and carry out different soyabean tissues gmMADS2tissue expression research, actingene be expressed as internal reference.A: gmMADS2rT-PCR expression analysis in soybean different tissues and organ; B: gmMADS2real-time PCR Analysis in root, stem, leaf, flower and the pod of soybean; C: gmMADS2real-time PCR Analysis in four kinds of floral organs; D: gmMADS2real-time PCR Analysis in embryo, cotyledon and the seed coat of soybean.

The Subcellular Localization research of Fig. 2 GmMADS2.

35S promoter is driven gmMADS2-GFPfusion gene carries out transient expression in onion epidermis cell, and result shows that GmMADS2 is positioned in nucleus (in figure shown in arrow).A: onion epidermis cell structure under visible ray; The location of B:GmMADS2:GFP in cell; The fusion figure of C:A and B; D:35S:GFP(negative control) location in cell; Scale represents 100 μ m.

Fig. 3 35S:GmMADS2the silique that transgenic arabidopsis is abnormal.

A: compared with wild-type Arabidopis thaliana (WT), the length of transgenosis silique (1-3) is less, and is yellow-green colour; B: 35S:GmMADS2boundary between sliver and the replum of transgenic arabidopsis silique is comparatively obvious; C, transgenic arabidopsis silique is cracking ahead of time, and when cracking, part seed is still green.

Fig. 4 35S:GmMADS2the scanning electron microscopic observation result of transgenic arabidopsis silique

A, C: wild-type Arabidopis thaliana silique cracking district absciss layer cellularstructure; B, D: 35S:GmMADS2transgenic arabidopsis silique cracking district absciss layer cellularstructure; Scale represents 100 μ m.White arrow refers to that the cellular layer thickness in transgenosis silique cracking district obviously increases with respect to wild-type.

Fig. 5 35S:GmMADS2the floral organ that transgenic arabidopsis is abnormal

A-B: wild-type Arabidopis thaliana; C-D: 35S:GmMADS2transfer-gen plant occurs without petal phenomenon.

embodiment (below in conjunction with figure explanation result)

Below in conjunction with drawings and Examples, the present invention will be further described.

In following embodiment, method therefor if no special instructions, is ordinary method.

Embodiment 1, soybean sHPgene gmMADS2cDNA cloning and identification

Soybean ( glycine max(L.) Merr.) kind Jackson provides by Agricultural University Of Nanjing country modified soybeans center germplasm resource bank, is seeded in solarium of Agricultural University Of Nanjing in the beginning of June, under natural condition, grow.Get the soybean root of six compound leaf phases, leaf, soybean full-bloom stage (R1) is got the mixture of flower and bud, soybean is the pod of pod phase (R3) just, it is remarkable in the sequence Gma.11881.1.A1_at at root and Ye Zhonggao that by gene chip, we obtain expression amount in flower and pod, and the result of real-time quantitative RT-PCR has also been verified this point.Further pass through blast program, we search for soybean est database taking Gma.11881.1.A1_at as probe sequence, according to the consequence devised primer of sequence assembly, taking the cDNA of the mixture of large Tofu pudding and bud as template, obtain 1 fragment by the method clone of RT-PCR.This fragment does not possess complete ORF, therefore carries out 3 ' RACE and 5 ' RACE to obtain complete sequence information according to this fragment.Comprehensive 3 ' RACE and the 5 ' RACE result analyzed, according to the sequence information design primer of splicing fragment ORF,

Upstream primer: 5'-TCATGGAATTTCCCAACGAAGCAATAC-3'(SEQ ID NO.3)

Downstream primer: 5'-CTCAGACAAGTTGAAGAGCAGTCTGG-3'(SEQ ID NO.4)

Application RT-PCR method increases from the total RNA of soybean gmMADS2gene.Get the mixture of large Tofu pudding and bud, with mortar grinding, add the 1.5mL EP pipe that fills lysate, after fully vibrating, then move in glass homogenizer.After homogenate, move in 1.5mL EP pipe extracted total RNA (TRIzol Reagents, Invitrogen, USA).Identify total RNA quality with denaturing formaldehyde gel electrophoresis, then on spectrophotometer, measure rna content.Taking total RNA of obtaining as template, the specification sheets of the reverse transcription test kit providing according to Promega company of the U.S. carries out reverse transcription, synthetic cDNA the first chain.Carry out pcr amplification reaction.PCR program is as follows: 94 DEG C of denaturations 4 minutes, 94 DEG C of sex change 30s, 55 DEG C of renaturation 1min, 72 DEG C are extended 2min, after 33 circulations, 72 DEG C of 10min, obtain the DNA fragmentation that a size is 846 bp, be cloned into pGEM-Teasy carrier, after order-checking, obtain the soybean SHP gene with complete coding region gmMADS2cDNA sequence SEQ ID NO. 1.

Embodiment 2, soybean gmMADS2the expression characteristic of gene in different tissues

Soybean varieties Jackson is seeded in solarium of Agricultural University Of Nanjing in the beginning of June, under natural condition, grows.When the 3rd compound leaf launches, get root, stem, leaf, stem apex; When full-bloom stage, get the mixture of flower and bud, soybean is pod and the pod wall of pod phase (R3) just; Collect after the flourishing mature flower of opening, under aseptic condition, separate rapidly four-wheel organ: calyx, petal, stamen and gynoecium; Under aseptic condition, separate seed coat, the Cotyledon and embryo of 20 DAF seeds.Material is equal liquid nitrogen flash freezer after collecting, and-80 DEG C save backup.

The extraction of total RNA is with embodiment mono-.With soybean constitutive expression actingene (GenBank accession No.V00450) is internal reference, since be template from total RNA of soybean different tissues, carry out RT-PCR analysis.RT-PCR analyzes and shows gmMADS2mainly express comprising in the reproductive organ such as flower, seed, pod and pod wall, and do not express in vegetative organ root, stem and leaf, in shoot apical meristem, there is faint expression, illustrate that this gene is regulating in this histocyte propagation, may also play a role (Figure 1A, B).Further we have analyzed gmMADS2expression in petal, stamen, carpel and sepal, result shows that this gene do not express in petal and stamen, the expression amount in gynoecium is the highest, is 11 times (Fig. 1 C) of expression amount in sepal.In the different tissues of seed, gmMADS2expression amount in cotyledon and seed coat is higher, especially expression amount the highest (Fig. 1 D) in seed coat.

Embodiment 3, soybean gmMADS2the Subcellular Localization research of gene

Obtain according to embodiment 1 gmMADS2cDNA full length sequence, design amplifies the primer of complete coding reading frame, and in primer, introduces Xba I and BamH I restriction enzyme site (underscore place).Upstream primer gmMADS2-Xba I:5'-G tCTAGAaTGGAATTTCCCAACGAAGC-3'(SEQ ID NO.5); Downstream primer gmMADS2-BamH:5'-G gGATCCgACAAGTTGAAGAGCAGTC-3'(SEQ ID NO.6).Utilize SEQ ID NO.5 and SEQ ID NO.6 to separate and comprise complete ORF's from large Tofu pudding cDNA by the method for RT-PCR for primer gmMADS2, amplification is obtained gmMADS2gene inserts Xba I and the BamH I restriction enzyme site of empty carrier pBI221, makes gmMAD2oRF and pBI221 carrier in gFPreporter gene 5 ' end merges and forms one gmMADS2-GFPmosaic gene, built plasmid pBIGmMADS2-GFP.Enzyme is cut after checking, itself and empty carrier pBI221 is transformed to Agrobacterium by freeze-thaw method respectively, then transform onion epidermis cell by agrobacterium-mediated transformation, finds gmMADS2gene product is positioned in nucleus, and pBI-GFP albumen is distributed in whole cell, shows that soybean GmMADS2 is for being positioned endonuclear transcription factor (Fig. 2).

Embodiment 4, gmMADS2genetically engineered application

According to gmMADS2cDNA sequence and Gateway process specifications design the Auele Specific Primer of a pair of this gene of overexpression: upstream primer: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAATTTCCCAACGAAGCAA TAC-3'(SEQ ID NO.7); Downstream primer: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGACAAGTTGAAGAGCAGTCT GG-3'(SEQ ID NO.8).Aim sequence after pcr amplification order-checking is carried out to BP with donor vector and reacts, the entry clone obtaining again with destination vector(pMDC83) carry out LR and react, acquisition plant expression vector pMDC83- gmMADS2.The expression vector of acquisition is proceeded to agrobacterium strains EHA105 with freeze-thaw method, adopt and be stained with colored method and infect Arabidopis thaliana (Col-0), obtain T ₁for transgenic arabidopsis seed.By seed disinfection, on the MS1 substratum that contains 50 μ g/ml HygB, sprout.Transfer-gen plant obtains hygromycin resistance because of the insertion of T-DNA, can be in screening culture medium normal growth, but not transfer-gen plant there will be the phenomenon such as yellow and poor growth, final withered death.Transgenic arabidopsis is transplanted to being equipped with in the little basin of vermiculite, under 22 DEG C of long day conditions, grow.The transfer-gen plant obtaining is carried out to PCR, after RT-PCR checking, carry out the phenotype analytical of plant, find gmMADS2the silique of ectopic expression render transgenic Arabidopis thaliana less, length is significantly shorter than wild-type silique, and the surperficial shrinkage of outer wall (sliver) of angle fruit, is yellow-green colour (Fig. 3 A).Sliver edge, the district that ftractures, fibrosis is heavier, and the boundary between sliver and replum is (Fig. 3 B) comparatively obviously.Utilize the microstructure of scanning electron microscopic observation Arabidopis thaliana silique outer wall, find that the cellular layer thickness in transgenosis silique cracking district increases (Fig. 4). 35S::GmMADS2the fruit pod of transfer-gen plant is cracking ahead of time.In the time of transgenosis fruit pod cracking, there is also fully matured not of part seed, be still emerald green (Fig. 3 C).To after seed drying, above sprout at MS1 substratum (not containing sucrose), most of transgenic seed all can normally be sprouted, and germination rate is similar to wild type seeds.In addition, exist gmSHPain the higher transgenosis individual plant of expression amount, except above-mentioned angle fruit is ahead of time cracking phenomena, also occur that blade upsweeps and flowering period the proterties such as in advance.Under the growth conditions in this laboratory, the average number that transfer-gen plant starts bolting lotus throne leaf while blooming is 11, and the average number of wild-type Arabidopis thaliana lotus throne leaf while blooming is 20.The petal of transgenosis flower is degenerated, and occurs without petal phenomenon (Fig. 5).These phenotypic characters all can genetic stability.All T ₂all occur without petal, the fruit pod proterties of cracking ahead of time for transgenic arabidopsis.

<110> Agricultural University Of Nanjing

<120> soybean GmMADS2 gene and application thereof

<130> GmMADS2

<160> 8

<170> PatentIn version 3.1

<210> 1

<211> 735

<212> DNA

<213> Glycine max

<220>

<221> GmMADS2 gene C DS

<222> (4)..(732)

<223>

<400> 1

ttc atg gaa ttt ccc aac gaa gca ata cca gaa ggg tgt tca cag aag 48

Met Glu Phe Pro Asn Glu Ala Ile Pro Glu Gly Cys Ser Gln Lys

1 5 10 15

aaa acg ggg agg ggg aaa ata gaa atc aag cgg atc gag aac aca acg 96

Lys Thr Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr

20 25 30

aat agg caa gtt acc ttc tgc aaa cgc cgt aac ggg ttg ctc aag aag 144

Asn Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys

35 40 45

gct tat gaa ttg tct gtt ctg tgt gat gct gag gtt gct ctt gtt gtc 192

Ala Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Val Val

50 55 60

ttc tca agc cgt gga cgc ctc tat gag tat gcc aac aac agt gtt aga 240

Phe Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Val Arg

65 70 75

gga acg atc gat agg tac aag aaa gca tgt gct gcc tcc aca aat cca 288

Gly Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Ala Ser Thr Asn Pro

80 85 90 95

gaa tct gtc tct gaa gct aat aca cag ttt tat cag cag gaa gcg tcc 336

Glu Ser Val Ser Glu Ala Asn Thr Gln Phe Tyr Gln Gln Glu Ala Ser

100 105 110

aaa tta aaa aga caa atc aga gac att cag aat cta aac agg cac atc 384

Lys Leu Lys Arg Gln Ile Arg Asp Ile Gln Asn Leu Asn Arg His Ile

115 120 125

cct ggt gaa gct ctt agc tct ctg agt ctg aag gaa tta aag aac ctg 432

Pro Gly Glu Ala Leu Ser Ser Leu Ser Leu Lys Glu Leu Lys Asn Leu

130 135 140

gag agt aga ctg gag aaa ggt tta agc aga gtt aga tcc aga aag cat 480

Glu Ser Arg Leu Glu Lys Gly Leu Ser Arg Val Arg Ser Arg Lys His

145 150 155

gaa act ttg ttt gcc gat atc gag ttc atg caa aag cgg gaa ata gag 528

Glu Thr Leu Phe Ala Asp Ile Glu Phe Met Gln Lys Arg Glu Ile Glu

160 165 170 175

ctg caa aac cat aat aat ttt ctg aga gct aag ata gct gaa cac gag 576

Leu Gln Asn His Asn Asn Phe Leu Arg Ala Lys Ile Ala Glu His Glu

180 185 190

aaa gca caa caa cgg caa cag gat atg ata ccg gga aat gtg tgc gag 624

Lys Ala Gln Gln Arg Gln Gln Asp Met Ile Pro Gly Asn Val Cys Glu

195 200 205

tca acc ata cct cca caa tca tat gac cgc aat ttc ttc cct gtt aat 672

Ser Thr Ile Pro Pro Gln Ser Tyr Asp Arg Asn Phe Phe Pro Val Asn

210 215 220

ctc ata gat tcc aat aat caa tat tca cat caa gac cag act gct ctt 720

Leu Ile Asp Ser Asn Asn Gln Tyr Ser His Gln Asp Gln Thr Ala Leu

225 230 235

caa ctt gtc tga gac 735

Gln Leu Val

240

<210> 2

<211> 242

<212> DNA

<213> Glycine max

<220>

The protein of <221> GmMADS2 genes encoding

<400> 2

Met Glu Phe Pro Asn Glu Ala Ile Pro Glu Gly Cys Ser Gln Lys Lys

1 5 10 15

Thr Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Asn

20 25 30

Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala

35 40 45

Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Val Val Phe

50 55 60

Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Val Arg Gly

65 70 75 80

Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Ala Ser Thr Asn Pro Glu

85 90 95

Ser Val Ser Glu Ala Asn Thr Gln Phe Tyr Gln Gln Glu Ala Ser Lys

100 105 110

Leu Lys Arg Gln Ile Arg Asp Ile Gln Asn Leu Asn Arg His Ile Pro

115 120 125

Gly Glu Ala Leu Ser Ser Leu Ser Leu Lys Glu Leu Lys Asn Leu Glu

130 135 140

Ser Arg Leu Glu Lys Gly Leu Ser Arg Val Arg Ser Arg Lys His Glu

145 150 155 160

Thr Leu Phe Ala Asp Ile Glu Phe Met Gln Lys Arg Glu Ile Glu Leu

165 170 175

Gln Asn His Asn Asn Phe Leu Arg Ala Lys Ile Ala Glu His Glu Lys

180 185 190

Ala Gln Gln Arg Gln Gln Asp Met Ile Pro Gly Asn Val Cys Glu Ser

195 200 205

Thr Ile Pro Pro Gln Ser Tyr Asp Arg Asn Phe Phe Pro Val Asn Leu

210 215 220

Ile Asp Ser Asn Asn Gln Tyr Ser His Gln Asp Gln Thr Ala Leu Gln

225 230 235 240

Leu Val

<210> 3

<211> 27

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 1 gmMADS2gene clone upstream primer

<400> 3

tcatggaatt tcccaacgaa gcaatac 27

<210> 4

<211> 26

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 1 gmMADS2gene clone downstream primer

<400> 4

ctcagacaag ttgaagagca gtctgg 26

<210> 5

<211> 27

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 3 gmMADS2gene Subcellular Localization vector construction upstream primer

<400> 5

gtctagaatg gaatttccca acgaagc 27

<210> 6

<211> 27

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 3 gmMADS2gene Subcellular Localization vector construction downstream primer

<400> 6

gggatccgac aagttgaaga gcagtc 26

<210> 7

<211> 56

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 4 gmMADS2gene plant expression vector establishment upstream primer

<400> 7

ggggacaagt ttgtacaaaa aagcaggctt catggaattt cccaacgaag caatac 56

<210> 8

<211> 55

<212> DNA

<213> artificial sequence

<220>

<221> embodiment 4 gmMADS2gene plant expression vector establishment downstream primer

<400> 8

ggggaccact ttgtacaaga aagctgggtc tcagacaagt tgaagagcag tctgg 55

Claims (1)

1. The genetically engineered application in soybean or Arabidopis thaliana petal and the transformation of fruit pod form of the aminoacid sequence of soybean GmMADS2 shown in 1.SEQ ID NO. 2 and encoding gene thereof.