CN115322913A

CN115322913A - Recombinant saccharomyces cerevisiae for producing rose essential oil and construction method and application thereof

Info

Publication number: CN115322913A
Application number: CN202110508671.9A
Authority: CN
Inventors: 张学礼; 戴住波; 李荣生
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2021-05-10
Filing date: 2021-05-10
Publication date: 2022-11-11
Anticipated expiration: 2041-05-10
Also published as: CN115322913B

Abstract

The invention discloses recombinant saccharomyces cerevisiae and a construction method and application thereof. The construction method comprises the following steps of modifying starting saccharomyces cerevisiae to obtain recombinant saccharomyces cerevisiae: a1, introducing a geraniol synthetase gene ObGES gene; a2, introduction of farnesyl pyrophosphate synthetase gene 96-position and 127-position double-point mutant gene ERG20 ^F96W/N127W A gene; a3, introducing A3-hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG 1; a4, introducing a geraniol reductase gene OYE2 gene; a5, introducing an nerol synthetase GmNES gene; a6, introduction of neryl diphosphate synthase SINDPS1 gene. The construction method successfully realizes the construction of the rose essential oil microbial cell factory in the saccharomyces cerevisiae through heterologous expression, module integration and branching interception regulation of farnesyl pyrophosphate synthetase.

Description

Recombinant saccharomyces cerevisiae for producing rose essential oil and construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to recombinant saccharomyces cerevisiae for producing rose essential oil and a construction method and application thereof.

Background

The rose essential oil is the most expensive essential oil in the world and is called 'after essential oil' and 'liquid gold'. The rose essential oil is yellow brown, has unique fragrance, is widely applied to industries such as daily chemicals, medicines, foods and the like, and has great practical value. 1kg of rose essential oil can be extracted by about 3000 kg-5000 kg of rose petals according to the traditional extraction method, the yield is very low, and the traditional extraction and separation easily causes the problems of environmental pollution and the like. At the present stage, because the demand is large due to low rose essential oil yield, china has a large market gap, and how to improve the production technology becomes a problem which needs to be solved urgently.

Since the 30 s of the last century, microorganisms have been used in industrial fermentation production in large quantities, and fermentation products are spread in various fields such as chemical industry, food, medicine, and the like. Metabolic engineering is a science of connecting cell metabolism to increase the production of metabolites or to impart microbial cells with the ability to produce new products, and has been widely used in the development of cell factories. Saccharomyces cerevisiae (Saccharomyces cerevisiae) is suitable for large-scale operation due to the Generally Regarded As Safe (GRAS) state, is widely applied to the synthetic biotechnology industry, and has been developed into one of the important platform microorganisms for metabolic engineering.

Disclosure of Invention

The invention provides a construction method of recombinant saccharomyces cerevisiae, which comprises the following steps: the starting saccharomyces cerevisiae is transformed as follows to obtain recombinant saccharomyces cerevisiae:

a1, introducing a geraniol synthetase gene ObGES gene; a2, introduction of farnesyl pyrophosphate synthetase gene 96-bit and 127-bit double-point mutant gene ERG20 ^F96W/N127W A gene; a3, introducing A3-hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1 gene; a4, introducing a geraniol reductase gene OYE2 gene; a5, introducing an nerol synthetase GmNES gene; a6, introduction of neryl diphosphate synthase SINDPS1 gene.

Optionally, the construction method includes: the starting saccharomyces cerevisiae was also modified as follows:

b1, replacing a promoter of a driving farnesyl pyrophosphate synthetase gene ERG20 gene with a promoter of an ERG7 gene named as pERG 7; b2, introducing a mevalonate kinase gene ERG12 gene; b3, introducing isopentenyl pyrophosphate isomerase gene IDI 1; b4, introducing an MVAPP decarboxylase gene ERG19 gene; b5, introducing an HMG-CoA reductase gene HMGR gene; b6, introducing a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase gene ERG 13; b7, introducing an MVAP kinase gene ERG8 gene; b8, introducing an acetyl-CoA acetyltransferase gene ERG 10.

The construction method of the recombinant saccharomyces cerevisiae can also comprise the step of expressing the introduced gene.

The starting Saccharomyces cerevisiae may be wild type Saccharomyces cerevisiae, such as Saccharomyces cerevisiae CEN. PK2-1D, or may be modified Saccharomyces cerevisiae.

Optionally, according to the above construction method, the sequence of the ObGES protein encoded by the ObGES gene is genbank accession number: AMK97466.1 sequence 35-569; and/or, the ERG20 ^F96W/N127W Gene encoded ERG20 ^F96W/N127W The sequence of the protein is shown as SEQ ID No. 10; and/or the sequence of the tHMG1 protein coded by the tHMG1 gene is genbank accession number: AJS96703.1, sequence 530-1054; and/or, the sequence of the OYE2 protein coded by the OYE2 gene is genbank accession number: NP _012049.1 sequence; and/or the sequence of the GmNES protein encoded by the GmNES gene is genbank accession number: AEE92791.1 sequence; and/or, the sequence of the SINDPS1 protein coded by the SINDPS1 gene is genbank accession number: QNM36897.1 sequence.

Optionally, according to the above construction method, the ObGES gene has a sequence shown from 431 th to 2035 th in SEQ ID No. 8; and/or, the ERG20 ^F96W/N127W The sequence of the gene is shown as 2048 th site to 3106 th site in SEQ ID NO. 8; and/or the sequence of the tHMG1 gene is shown as 757 th-2340 th sites in SEQ ID NO. 2; and/or the sequence of the OYE2 gene is shown as 801 th to 2003 th in SEQ ID NO. 7; and/or the sequence of the GmNES gene is shown as 801 th to 2405 th in SEQ ID NO. 3; and/or the sequence of the SINDPS1 gene is shown as 431 th site to 1213 th site in SEQ ID NO. 4.

The B1 may replace the above promoter by the CRISPR/CAS9 system, and specifically may be obtained by introducing the CAS9 gene, the gRNA gene, and a DNA fragment including the pERG7 promoter (e.g., pERG20-pERG7 fragment used in example) into the starting saccharomyces cerevisiae, and expressing the CAS9 gene and the gRNA gene. The gRNA fragment encoded by the gRNA gene targets the promoter driving the ERG20 gene (pERG 20 promoter). The target sequence may be, for example, TTTCTACTTGCCTGTCGCAT.

Alternatively, according to the above construction method, said A1 and A2 are obtained by introducing the ObGES gene and ERG20 into said s.cerevisiae ^F96W/N127W Gene expression cassettes (e.g., P) _TEF1 -ObGES-ERG20 ^F96W/N127W -T _CYC1 The expression cassette, the sequence of which is shown in SEQ ID No. 8); and/or said A3 is obtained by introducing a tHMG1 gene expression cassette (e.g. P) into said s.cerevisiae _PGK1 -tHMG1-T _ADH1 The expression cassette, the sequence of which is shown in SEQ ID No. 2); and/or said A4 is obtained by introducing an OYE2 gene expression cassette (e.g., P) into said s.cerevisiae _TDH3 -OYE2-T _TPI1 Expression cassette, the sequence of which is shown in SEQ ID No. 7); and/or said A5 is obtained by introducing a GmNES gene expression cassette (e.g., P) into said s.cerevisiae _TDn3 -GmNES-T _TPI1 The expression cassette, the sequence of which is shown in SEQ ID No. 3); and/or, said A6 is obtained by introducing a SINDPS1 gene expression cassette (e.g., P) into said s.cerevisiae _TEF1 -SINDPS1-T _CYC1 The expression cassette, the sequence of which is shown in SEQ ID No. 4); and/or, said B2 is obtained by introducing an ERG12 gene expression cassette (e.g.P) into said s.cerevisiae _PDC1 -ERG12-T _ADH2 Expression cassette); and/or B3 by introducing an IDI1 gene expression cassette (e.g.P) into the s.cerevisiae starting yeast _ENO2 -IDI1-T _PDC1 Expression cassette); and/or, said B4 is obtained by introducing into said s.cerevisiae starting an ERG19 gene expression cassette (e.g.P) _PYK1 -ERG19-T _PGI1 Expression cassette implementation; and/or, said B5 is obtained by introducing into said s.cerevisiae, starting, an HMGR gene expression cassette (e.g.P) _TEF2 -HMGR-T _ENO2 Expression cassette); and/or, said B6 gene is produced by introducing an ERG13 gene expression cassette (e.g., P) into said s.cerevisiae _FBA1 -ERG13-T _TDH2 Expression cassette); and/or, said B7 is obtained by introducing an ERG8 gene expression cassette (e.g.P) into said s.cerevisiae _TDH3 -ERG8-T _TPI1 Expression cassette); and/or, said B8 gene is obtained by introducing an ERG10 gene expression cassette (e.g.P) into said s.cerevisiae _TEF1 -ERG10-T _CYC1 Expression cassette).

Optionally, according to the construction method, the ObGES gene and ERG20 in the recombinant Saccharomyces cerevisiae ^F96W/N127W The gene is expressed by an expression plasmid which is introduced into the starting saccharomyces cerevisiae; tHMG1 gene, obGES gene and ERG20 ^F96W ^/N127W Gene integration into the GAL7 site of the starting saccharomyces cerevisiae; integrating a tHMG1 gene, a GmNES gene and a SINDPS1 gene into an NDT80 locus of the starting saccharomyces cerevisiae; the pERG7 replaces positions 1-248 of the promoter driving the ERG20 gene. The genes in B2-B8 can be integrated into YJL064W locus of the starting saccharomyces cerevisiae.

The recombinant saccharomyces cerevisiae constructed by the method also belongs to the protection scope of the invention.

The invention also provides a method for producing terpenes, which comprises the steps of culturing the recombinant saccharomyces cerevisiae to obtain a fermentation product; obtaining terpenes from the fermentation product.

Any of the following applications are also within the scope of the present invention,

x1, the use of the above process for the preparation of a terpene product; x2, the use of the above process for the production of terpenes; x3, application of the recombinant saccharomyces cerevisiae in preparation of terpene products; x4 and the application of the recombinant saccharomyces cerevisiae in terpene production.

Hereinbefore, the terpene may be selected from at least one of geraniol, citronellol, nerol.

As hereinbefore described, the terpene product may be a recombinant bacterium expressing a terpene.

The main components of the natural rose essential oil are monoterpene compounds citronellol, geraniol and nerol, and the construction of a rose essential oil microbial cell factory is successfully realized in saccharomyces cerevisiae through heterologous expression, module integration and branching interception regulation and control farnesyl pyrophosphate synthetase (ERG 20).

Drawings

FIG. 1 shows the GC-MS analysis results of the products of the Rose yeast B strain, wherein A is the peak pattern of the strains NEROL-pERG7, rose yeast B and NEROL (Nerol), geraniol (Geraniol) and Citronellol (Citronellol) standard, B (1) is the MS pattern of database Geraniol, B (2) is the MS pattern of Geraniol in the products of the Rose yeast B strain, C (1) is the MS pattern of Citronellol in the database, C (2) is the MS pattern of Citronellol in the products of the Rose yeast B strain, D (1) is the Ms pattern of NEROL in the database, and D (2) is the MS pattern of NEROL in the products of the Rose yeast B strain.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Data were processed using SPSS11.5 statistical software and experimental results were expressed as mean. + -. Standard deviation using One-way ANOVA test.

The media and components used in the following examples are as follows:

SD solid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His (purchased from beijing panyono technologies), 2% glucose, 0.01% Leu (leucine), 0.005% His (histidine), 0.01% Ura (uracil), 0.01% Trp (tryptophan), and 2% agar powder;

SD liquid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.005% His, 0.01% Ura, 0.01% Trp;

SD-Trp solid selection Medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.005% His, 0.01% Ura, 2% agar powder;

SD-Trp liquid selection Medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.005% His, 0.01% Ura:

SD-Trp-Ura solid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.005% His,2% agar powder;

SD-Trp-5FOA solid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.005% h, 0.01% Ura, 0.05%5-foa, 2% agar powder;

SD-Trp-His solid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.01% Ura, 2% agar powder;

SD-Trp-His liquid selection medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.01% Leu, 0.01% Ura;

SD-Trp-Leu solid selection Medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His (purchased from tokyo pan-keno technologies ltd.), 2% glucose, 0.005% His (histidine), 0.01% Ura (uracil), and 2% agar powder;

SD-Trp-Leu liquid selection Medium: 0.8% yeast selection medium SD-Ura-Trp-Leu-His,2% glucose, 0.005% His, 0.01% Ura;

SD-Trp-Ura-His-Leu solid screening culture medium: 0.8% of yeast selection medium SD-Ura-Trp-Leu-His,2% of glucose and 2% of agar powder.

The information on the gene fragments and protein sequences in the examples below is given in the following table.

Information related to gene fragment and protein sequence

Protein-related information

Example 1

1. Construction of promoter elements and acquisition of functional genes

1. PCR amplification

Saccharomyces cerevisiae CEN. PK2-1D (hereinafter abbreviated as NK2, purchased from the European Saccharomyces cerevisiae Collection (EUROSCARF)) genomic DNA was extracted (genome extraction kit of yeast genome of the century Kangji (cat. No.: CW 0569) was used, and genome was extracted according to the instructions of the manufacturer). And (2) taking genome DNA of saccharomyces cerevisiae NK2 as a template, respectively adopting primers in the table 1 to match, respectively amplifying to obtain a promoter fragment pERG7 (the pERG7 promoter is from-1 to-774 of ERG7 gene upstream), and then amplifying by using a primer containing a homologous arm of a pERG20 promoter region to obtain a promoter fragment pERG20-pERG7.

The amplification system was as follows: TAKARA

Hs DNA polymerase 5 XPS Buffer 10 u l, dNTPmix 4 u l, primer each 1.5 u l, DNA template 0.5 u l,

HS polymerase (2.5U/. Mu.l) 0.5. Mu.l, supplemented with ddH ₂ O to a total volume of 50. Mu.l.

The amplification conditions were as follows: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 58 ℃ for 15 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extension at 72 ℃ for 10min (1 cycle). The product is reclaimed and stored through tapping.

TABLE 1 primer sequences

2. Total Synthesis of related genes

Sinsley Biotechnology Co., ltd was entrusted to synthesize the SINDPS1 gene and GmNES gene in their entirety, and inserted into SexA1 and Asc1 cloning sites of pUC57 vector (available from Kisley Biotechnology Co., ltd.) to obtain cloning plasmids pUC57-SINDPS1 and pUC57-GmNES.

2. Construction of recombinant plasmid

Construction of pEASY-TRP1-URA3 plasmid

Respectively taking plasmids pRS314 and pGAL7-URA3 as templates, and amplifying by using primers in a primer table 2 to obtain a 871bp TRP1 fragment and a 1128bp URA3 fragment; then, the 1999bp TRP1-URA3 fragment was amplified by using the TRP1 and URA3 fragments as templates and primers in the primer Table 2. (pRS 314 is described in Ma Xiaolin, li Weixian, wang Dong, etc.. Analysis of hederagenin biosynthesis and construction of Yeast cell factory [ J ]. J.China Med.Med.2018, 043 (009): 1844-1850. PGAL7-URA3 is described in Lin Tingting, wang Dong, bo, etc.. Fermentation was created in Saccharomyces cerevisiae cell factory to produce lupeol [ J ]. J.China Med.2016, 41 (06): 1008-1015).

The amplification system was as follows: TAKARA

10 ul of HS DNA polymerase 5 XPS Buffer, 4 ul of dNTPmix, 1.5 ul of each primer, 0.5 ul of DNA template,

The amplification conditions were as follows: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 58 ℃ for 15 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extension at 72 ℃ for 10min (1 cycle). The product is reclaimed and stored by tapping.

Cloning the amplified product TRP1-URA3 into a pEASY-Blunt Simple cloning vector to transform a Trans1-T1 competent cell, extracting plasmid sequencing verification, and obtaining a plasmid pEASY-TRP-URA.

TABLE 2 primer combinations

2.pRS425-ObGES-ERG20 ^F96W/N127W 、pRS425-LEU-TRP-URA-ObGES-ERG20 ^F96W/N127W Construction of plasmids

With pM3-GES and pM4-ERG20 ^F96W/N127W The plasmid is a template (pM 3-GES, pM4-ERG 20) ^F96W-N127W Are described in the article: tao W, siwei L, bolin Z, et al.engineering Saccharomyces cerevisiae for the production of the viable monoclonal estergeranyl acetate [ J]Microbial Cell industries, 2018, 17 (1): 85. in (b), the primers shown in Table 3 were used to amplify to obtain ObGES-ERG20 ^F96W/N127W A gene fragment.

After purification of the fragment obtained above, the plasmid pRS425-LEU2-TEF1-SynPn3-29 (stored in the laboratory, recorded in the articles Wang, D., wang, J., shi, Y., li, R.,&zhang, X. (2020), emulsification of the complex biochemical pathway of the main tertiary glycosylation products of a large non-enzymatic using a synthetic biological pathway, 61) and fragment ObGES-ERG20 ^F96W/N127W And then tapping and recovering.

Tapping and recovering target fragments: pRS425-LEU2-TEF 1-/-CYC 1 (7576bp, 120ng) vector (pRS 425-LEU2-P _TEF1 -Pn3-32-T _CYC1 Tapping recovered product) and ObGES-ERG20 ^F96W/N127W (fragment ObGES-ERG20 ^F96W/N127W Product recovered from tapping) (2763bp, 105ng) fragment. Respectively connecting the target fragment with a corresponding vector, wherein the connection system is as follows: 5 ul 2 XQuick Ligation Buffer (NEB), 0.5 ul Quick T4 DNA Ligase (NEB, 400,00 reciprocal end units/ml), supplemented with ddH ₂ O to 10 mu l, reacting at 25 ℃ for 10min to obtain a ligation product, transferring the ligation product into Transl T1 competent cells, and performing sequencing verification to obtain a recombinant vector pRS425-LEU-TEF1-ObGES-ERG20 ^F96W ^/N127W (i.e., pRS425-ObGES-ERG20 ^F96W/N127W )。

The primers in Table 3 were used to amplify to obtain TRP-URA fragments, and the plasmids pRS425-LEU-TEF1-ObGES-ERG20 were digested with restriction enzymes Xma I and NOT I, respectively ^F96W/N127W And a fragment TRP-URA. p 425-LEU-/-TEF 1-ObGES-ERG20 ^F96W/N127W CYC1 (50 ng) vector (pRS 425-LEU-TEFi-ObGES-ERG20 ^F96W/N127W Rubber tappingRecovered product) and TRP-URA (130 ng) (fraction TRP-URA tapping recovered product). Respectively connecting the target fragment with a corresponding vector, wherein the connection system is as follows: 5. Mu.l of 2 Xquick Ligation Buffer (NEB), 0.5. Mu.l of Quick T4 DNA Ligase (NEB, 400, 000synergistic end units/ml), supplemented with ddH ₂ O to 10 mu l, reacting at 25 ℃ for 10min to obtain a ligation product, transferring the ligation product into Transl T1 competent cells, and performing sequencing verification to obtain pRS425-LEU-TRP-URA-ObGES-ERG20 ^F96W ^/N127W A plasmid.

Construction of YJL064W-gRNA and pERG20gRNA plasmids

pLPPgRNA is taken as a template, primers in the table 3 are matched, and gRNA fragments YJL064W-gRNA and pERG20-gRNA are obtained through respective amplification. The PCR product of the gRNA fragment obtained by amplification is treated for more than three hours by Dpnl enzyme, then 5-10 μ l of the PCR product is transferred into Trans 1T 1 competent cells and sequence verification is carried out, and YJL064W-gRNA plasmid and pERG20gRNA plasmid are obtained, and the related information of the plasmids is shown in Table 5. ( plpgrna is described in article: wang, D., wang, J., shi, Y., li, R., & Zhang, X. (2020). Emulsification of the complex biochemical pathway of the main ternary glycosylation products of the general non-pathological using synthetic biological Engineering,61 )

TABLE 3 primer sequences

4. Construction of pRS425-SINDPS1, pM4-OYE2, pM4-GmNES recombinant plasmids

(1) PCR amplification

And (3) amplifying to obtain a functional gene segment of geraniol reductase OYE2 by using genome DNA of saccharomyces cerevisiae NK2 as a template and adopting primers in a table 3.

(2) Construction of recombinant plasmid by enzyme digestion ligation

After purifying the fragment obtained above, plasmids pRS425-LEU2-TEF1-SynPn3-29, pUC57-GmNES, pUC57-SINDPS1 and plasmid pM4-tHMG1 were double-digested with restriction enzymes SexA1 and Asc1, respectively (stored in the laboratory, described in the article: tao W, siwei L, bolin Z, et al.engineering Saccharomyces cerevisiae for the production of the valid monoclonal estergeranyl acetate [ J ]. Microbiological Cell factors, 2018, 17 (1): 85.) and fragment OYE2, and then tapping to recover pM4 and p425 vectors with cohesive ends at the SexA1, ASC1 cleavage sites, and OYE2, SINDPS1, gmNES fragments.

Tapping and recovering target fragments: pEASY-Blunt-TDH 3-/-TPI 1 (5749bp, 100ng) vector (plasmid pM4-tHMG1 gel cut recovery product) and GmNES (plasmid pUC57-GmNES gel cut recovery product) (1605bp, 20ng), OYE2 (fragment OYE2 gel cut recovery product) (1203bp, 30ng) fragment, p425-LEU2-TEF 1-/-CYC 1 (120 ng) vector (plasmid pRS425-LEU2-TEF1-SynPn3-29 gel cut recovery product) and SINDPS1 (783bp, 20ng) (SINDPS 1 gel cut recovery product). Respectively connecting the target fragment with a corresponding vector, wherein the connection system is as follows: 5 ul 2 XQuick Ligation Buffer (NEB), 0.5 ul Quick T4 DNA Ligase (NEB, 400, 000genetic end units/ml), supplemented with ddH ₂ And reacting at 25 ℃ for 10min until the volume of the product is 10 mu l to obtain a ligation product, transferring the ligation product into Trans 1T 1 competent cells, and performing sequencing verification to obtain the recombinant vector.

After sequencing, the recombinant vector inserts the expression cassette of the gene between cloning sites of the cloning vector, and the expression cassette is named as pRS425-SINDPS1, pM4-OYE2 and pM4-GmNES.

5. plasmid construction of pM7-HMGR

The genome DNA of saccharomyces cerevisiae NK2 is taken as a template, a promoter pTEF2 (562 bp) is obtained by adopting primers Pac1-TEF2-F and SexA1-TEF2-R for amplification, and a terminator tENO2 (400 bp) is obtained by adopting primers Asc1-ENO2-F and Pme1-ENO2-R for amplification. The amplification system was as follows: primeSTAR GXL Buffer (Mg 2+ plus). Times.10. Mu.l, dNTPMix.times.4. Mu.l, 1.5. Mu.l each of the primers Pac1-TEF2-F and SexA1-TEF2-R (Asc 1-ENO2-F and Pme1-ENO 2-R), 1.5. Mu.l of genomic DNA template, 1. Mu.l of PrimeSTAR GXL DNA Polymerase (1.25U/. Mu.l), and addition of ddH2O to a total volume of 50. Mu.l.

Pac1-TEF2-F：5’-GCTTAATTAAATGGGGCCGTATACTTACATATAGTAGA-3’

SexA1-TEF2-R：5’-GCACCAGGTGTTTAGTTAATTATAGTTCGTTGACCGTATATTCTAAAAAC-3’

Asc1-ENO2-F：5’-GCGGCGCGCCAGTGCTTTTAACTAAGAATTATTAGTCTTTTCTGCT-3’

Pme1-ENO2-R：5’-GCGTTTAAACAGGTATCATCTCCATCTCCCATATGC-3’

Carrying out double enzyme digestion on the plasmid pUC57-synHMGR with restriction enzymes SexA I and Asc I respectively, tapping and recovering a target fragment to obtain a SexA I-synHMGR-Asc I fragment; respectively double-digesting the fragment pTEF2 by using restriction enzymes SexA I and pac I, and obtaining SexA I-pTEF2-pac I by tapping and recovering a target fragment; respectively carrying out double enzyme digestion on the fragments tENO2 by using restriction enzymes Asc1 and Pme1, tapping and recovering the target fragment to obtain Asc1-tENO2-Pme1, and adding 50ng of each of the three fragments into a connection system: 2ul 10XT4 ligation buffer (NEB), 1ul T4 ligation (NEB, 400,000 ligation end units/ml), distilled water was added to 20ul, and the reaction was carried out at room temperature for 2 hours to obtain a ligation product, 1ul of the ligation product was added, and the PCR system: primeSTAR GXL Buffer (Mg 2+ plus) x 10. Mu.l, dNTPmix 4. Mu.l, primers Pac1-TEF2-F and Pme1-ENO2-R each 1.5. Mu.l, ligation product 1. Mu.l, primeSTAR GXL DNA Polymerase (1.25U/. Mu.l) 1. Mu.l, supplemented with ddH2O to a total volume of 50. Mu.l, to obtain expression cassette P _TEF2 -HMGR-T _ENO2 . The expression cassette was cloned into pEASY-Blunt Simple cloning vector (purchased from Beijing Quanyujin Biotechnology Co., ltd.) to obtain recombinant vector pM7-HMGR.

The information on the recombinant vectors prepared as described above is shown in Table 4.

TABLE 4 recombinant vector information

3. Construction of recombinant bacterium

(I) construction of Chassis bacteria HP001-pERG7-ERG20

The amplification system is as follows: TAKARA

The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 58 ℃ for 15 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extension at 72 ℃ for 10min (1 cycle). The product is reclaimed and stored by tapping.

TABLE 5 primer information

Yeast underpan cells NK2 were activated in SD liquid medium, and competent cells were prepared by lithium acetate method. Mu.l of p414-TEF1p-Cas9-CYC1t plasmid (stored in the laboratory, purchased from addge., ltd.) was added, and the transformants were streaked after incubation in SD-Trp solid selection medium at 30 ℃ for 48 hours in an incubator. The obtained strain was activated in SD-Trp liquid selection medium, and competent cells were prepared by lithium acetate method. Adding YJL064W-gRNA plasmid 2. Mu.l to competence, and amplifying to obtain N1, N2, N3, N4, N5, and N6 (P) _FBA1 -ERG13-T _TDH2 ) And N7 and N8 the 8 modular fragments (total 8. Mu.l) were added to the yeast competent cells in a molar ratio of 1: 1. The transformant is cultured in an SD-Trp-Ura solid selection medium in a thermostat at 30 ℃ for 48 hours, then streaked, verified by PCR, and the correct strain is cultured in an SD-Trp-5FOA solid selection medium for 24 hours to eliminate gRNA plasmid, and named as HP001.

The construction principle of HP001 is specifically that a recombinant plasmid p414-PTEF1-Cas9-TCYC1 capable of expressing Cas9 protein is transferred into a strain NK2 in advance, then a recombinant plasmid (YJL 064W-gRNA plasmid) for expressing gRNA and a recombinant fragment (N1-N8) are transformed into the strain together, the YJL064W-gRNA plasmid recognizes and combines a specific PAM region of a YJL064W site, and activates and guides the Cas9 protein to perform a shearing function, so that double-stranded DNA of the YJL064W site is broken, and at the moment, the recombinant fragment N1-N8 containing a homologous region is integrated into strain DNA through homologous recombination repair.

Yeast underpan cells HP001 were activated in SD-Trp medium, and competent cells were prepared by lithium acetate method. The pERG20gRNA plasmid obtained in the above way is added into the yeast competent cells with the fragment pERG20-pERG7 according to the molar ratio of 1: 1. The transformants were cultured in SD-Trp-Ura solid selection medium in an incubator at 30 ℃ for 48 hours. Extracting a yeast genome, taking the extracted strain genome as a template, respectively adopting the following primers to amplify fragments by PCR, and carrying out sequencing verification to verify that the correct strain is named as HP001-pERG7-ERG20.

ERG20-OUT-F：CGGCTCTTACGCCATAACCTTTATG

ERG20-R：CTTCAGGTGCAGTGATTAAGTCCATC

(II) construction of recombinant Strain

1. Construction of high-yield nerol strain

(1) Construction of Gene Module

The PCR templates described in Table 6 (pNDT 80-HIS3 are described in articles Zhang Lili, ma Xiaolin, wang Dong, yu Peng, huang Luqi,&zhang Xueli et al (2017) yeast cell factory creation of high yield nerolidol, china journal of chinese traditional medicine, 42 (015), 2962-2968, where p δ -tmg 1 is described in literature: chinese traditional medicine journal, lin Tingting, wang Dong, donning boa, zhang Xueli, huang Luqi, 2016, 41 (6): 1008-1015) and corresponding primers are subjected to PCR amplification to respectively obtain functional modules: m1 (containing NDT80-HIS3-up fragment), M2 (containing P _PGK1 -tHMG1-T _ADH1 Expression cassette), M3 (comprising P) _TDH3 -GmNES-T _TPI1 Expression cassette), M4 (comprising P) _TEF1 -SINDPS1-T _CYC1 Expression cassette), M5 (containing NDT80-HIS3-down fragment).

The amplification system was as follows: TAKARA

10 ul of HS DNA polymerase 5 XPS Buffer, 4 ul of dNTPmix, 1.5 ul of each primer, 0.5 ul of RNA template,

TABLE 6 primer sequences

(2) Construction of recombinant Strain

The chassis strain HP001-pERG7-ERG20 obtained above was plated with SD-5FOA-Trp to eliminate gRNA plasmid. The yeast Chassis cells HP001-pERG7-ERG20 were activated in SD-TRP medium, and competent cells were prepared by lithium acetate method. M1, M2, M3, M4 and M5 were mixed and added to the yeast competent cells in a molar ratio of 1: 1 (5. Mu.l total). The transformant was cultured in an SD-Trp-His solid selection medium at 30 ℃ in an incubator for 48 hours and then streaked. Activating the strain in SD-Trp-His liquid culture medium, extracting yeast genome by the method, taking the extracted strain genome as a template, matching verification functional genes according to the primers in the table 7, verifying the correct strain name as NEROL-pERG7, shaking seed liquid, and performing shake flask fermentation.

TABLE 7 primer sequences

2. Construction of Rose essential oil Yeast strains

(1) Construction of Gene Module

Performing PCR amplification respectively by using the PCR template and the corresponding primer described in the table 8 to respectively obtain the functional modules: m6 (containing GAL7-URA3-up fragment), M7 (containing P) _PGK1 -tHMG1-T _ADH1 Expression cassette), M8 (comprising P) _TDH3 -OYE2-T _TPI1 Expression cassette), M9 (comprising P) _TEF1 -ObGES-ERG20 ^F96W/N127W -T _CYC1 Expression cassette), M10 (Containing GAL7-URA3-down fragment).

The amplification system was as follows: TAKARA

TABLE 8 primer sequences

(2) Construction of recombinant Strain

The engineered yeast cell NEROL-pERG7 obtained above was activated in SD-Trp-His medium, and competent cells were prepared by lithium acetate method. M6, M7, M8, M9 and M10 were mixed and added to the yeast competent cells in a molar ratio of 1: 1 (5. Mu.L total). The transformant is cultured in a constant temperature box at 30 ℃ for 48 hours in a SD-Trp-Ura-His solid screening culture medium and then streaked and cultured. Activating the strain in SD-Trp-Ura-His liquid culture medium, extracting yeast genome by the method, taking the extracted strain genome as a template, matching PCR verification functional genes according to primers in Table 9, verifying the correct strain and naming Rose yeast A, shaking seed solution, and performing shake flask fermentation.

TABLE 9 primer sequences

3. Optimization of rose essential oil yeast strains

After the plasmid containing TRP1 screening marker in Rose yeast A strain is eliminated through YPD culture medium culture and counter screening, the obtained engineering yeast cell Rose yeast A is activated in SD-His-Ura culture medium, and competent cells are prepared by a lithium acetate method. Mu.l of pRS425-LEU-TRP-URA-ObGES-ERG20 ^F96W/N127 The plasmid was added to yeast competent cells. The transformant is cultured in a constant temperature box at 30 ℃ for 48 hours in a SD-Trp-Ura-His-Leu solid screening culture medium and then streaked. Activating the strain in SD-Trp-Ura-His-Leu liquid culture medium, extracting strain yeast plasmid (using Tiangen yeast plasmid extraction kit (cargo number: DP 112-02), extracting yeast plasmid according to manufacturer's instructions), taking the extracted yeast plasmid as a template, matching the primers in Table 10 to verify functional plasmid, verifying the correct strain and naming Rose yeast B, shaking seed solution, and performing shake flask fermentation.

TABLE 10 primer sequences

The information on the recombinant bacteria prepared above is shown in Table 11.

TABLE 11 information on engineered strains

4. Shake flask fermentation and detection

1. Engineering bacteria culture and product extraction

According to Table 12, the engineered yeast strains prepared above were activated in the respective solid selective media, seed solutions (30 ℃,250rpm, 169h) were prepared in the respective liquid selective media, inoculated at an inoculum size of 1% into 100ml Erlenmeyer flasks containing 15ml of the respective liquid selective media, shake-cultured at 30 ℃,250rpm for 1 day, then added with 1.5ml of methyl oleate, and shake-cultured for further 5 days. Finally, the liquid in the triangular flask is transferred to a 50ml centrifuge tube, centrifuged at 5000rpm for 5min, and the organic phase is collected for later use.

TABLE 12 culture media for culturing the strains

Name of strain	Solid selective medium	Liquid selective medium
			NEROL-pERG7	SD-Trp-His	SD-Trp-His
Rose yeast A	SD-Trp-Ura-His	SD-Trp-Ura-His
			Rose yeast B	SD-Trp-Ura-His-Leu	SD-Trp-Ura-His-Leu

2. Qualitative and quantitative analysis

GC-MS detection

The converted material was diluted 10-fold with n-hexane, passed through an organic nylon membrane (0.22 μm), and detected by GC-MS. A detection instrument: agilent 7890A/5975C.

GC-MS determination conditions of fermentation products of the NEROL-pERG7 strain: the injection port temperature is 250 ℃, the injection volume is 1 mu L, the flow is not divided, and the solvent is delayed for 3min; a chromatographic column: HP-5ms (30m 0.25mM); chromatographic conditions are as follows: keeping the temperature at 45 ℃ for 1min, and keeping the temperature at 10 ℃/min to 300 ℃ for 5min; MS conditions: full Scan:50-750amu. The quality and quantity were determined by using nerol standard, which was purchased from Biotech, inc., hemo, zhejiang, inc. (Cat: N0077).

GC-MS determination conditions of fermentation products of Rose yeast A and Rose yeast B strains are as follows: the injection port temperature is 250 ℃, the injection volume is 1 mu L, no flow distribution is carried out, and the solvent is delayed for 3min; a chromatographic column: HP-5ms (30m 0.25mm); chromatographic conditions are as follows: keeping the temperature for 5min at 70 ℃,35min,3 ℃/min to 115 ℃,20 ℃/min to 300 ℃; MS conditions: full Scan:50-750amu. The qualitative and quantitative determination of geraniol, citronellol and nerol standard products were carried out, wherein geraniol (cat # G107515), citronellol (cat # G107515) and nerol (cat # N0077) were purchased from Alantin, shanghai-sourced leaf Biotech, inc., and Zhejiang Union, inc., respectively.

The experiment is repeated three times, and the yield of each engineering bacterium fermented for 6 days is as follows:

NEROL yield of the NEROL-pERG7 strain was 12.46mg/L.

The nerol yield of Rose yeast A reaches 3.37mg/L, the citronellol yield reaches 35.51mg/L, and the geraniol yield reaches 22.70mg/L.

The yield of nerol of Rose yeast B reaches 12.78mg/L, the yield of citronellol reaches 77.24mg/L, the yield of geraniol reaches 33.96mg/L, and the GC-MS analysis result of the fermentation product is shown in figure 1.

3. Bioreactor fermentation culture

1) Media preparation

Calcium chloride mother liquor: 19.2g/L calcium chloride dihydrate.

Trace metal salt mother liquor: 19.1g/L disodium edetate; 10.2g/L zinc sulfate heptahydrate; 0.5g/L of manganese chloride tetrahydrate; 0.86g/L of cobalt chloride hexahydrate; 0.78g/L copper sulfate pentahydrate; 0.56g/L sodium molybdate dihydrate; 5.12g/L ferrous sulfate heptahydrate.

Vitamin mother liquor: 0.05g/L biotin; 0.2g/L of sodium p-aminobenzoate; 1g/L nicotinic acid; 1g/L calcium pantothenate; 1g/L pyridoxine hydrochloride; 1g/L thiamine hydrochloride; 25g/L inositol.

Seed medium and fermentation medium: 25g/L glucose, 15g/L ammonium sulfate, 6.15g/L magnesium sulfate heptahydrate, 0.72g/L zinc sulfate heptahydrate, 8g/L monopotassium phosphate, 2ml/L calcium chloride mother liquor and 10ml/L trace metal salt mother liquor; 12ml/L of vitamin mother liquor, 1g/L of tryptophan and the balance of water.

And (3) a feed culture medium: 800g/L glucose, 5.125g/L magnesium sulfate heptahydrate, 3.5g/L potassium sulfate, 0.28g/L sodium sulfate, 9g/L monopotassium phosphate, 1g/L tryptophan and the balance of water.

2) Fermentation of engineering bacteria Rose year B

Activating the engineering bacterium Rose yeast B according to the method in '1, engineering bacterium culture and product extraction'. After the amino acid screening marker is supplemented back, selecting the monoclonal on the plate to a test tube filled with SD-Trp-Ura-His-Leu culture medium, and carrying out shaking culture at 30 ℃ and 250rpm overnight; sucking 500 mu L of bacterial liquid into a 250ml triangular flask filled with 50ml SD-Trp-Ura-His-Leu culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for 24h;

picking the single clone on the plate to a test tube filled with an sD-TRP-Ura-His-Leu culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for overnight; sucking 500 μ L of the bacterial liquid into a 250ml triangular flask filled with 50ml of SD-Ura-His-Leu culture medium, and performing shaking culture at 30 ℃ and 250rpm for 24h;

respectively sucking 2ml of bacterial liquid into 3 triangular flasks with 1L of 100ml of seed culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for 48 hours; finally, the seed solution was added via flame inoculation to a 7L fermenter (Eppendorf, germany, type:

) In (1).

The parameter set values in the fermentation process are respectively as follows: the temperature is 30 ℃, the pH value is 5.0, the dissolved oxygen is 30%, the air flow is 3-20L/min, the stirring speed is 300-1000rpm, and the dissolved oxygen, the stirring speed and the aeration are cascaded. When the dissolved oxygen value is more than 60%, adding a feed medium into the fermentation tank until the glucose concentration in the fermentation liquor is 5g/L.

3 hours before the end of the fermentation, 10% (by volume of the culture broth) of olive oil was added and the organic phase was separated after the end of the fermentation.

The conversion method and the detection method in the '2, qualitative and quantitative analysis' process are carried out, and the qualitative and quantitative analysis is carried out, so that 0.32g/L (relative to the culture solution) of nerol and 3.89g/L (relative to the culture solution) of geraniol can be obtained after the engineering bacteria Rose yeast B is subjected to high-density fermentation for 96 hours.

The recombinant bacteria meeting the purpose of the present invention, including but not limited to the specific experimental examples described in the table, can be subjected to fermentation culture according to the fermentation method described in "3, bioreactor fermentation culture" to obtain rose essential oil.

The expression cassettes and the pERG20-pERG7 fragment of the above-mentioned N2-N8 fragment are for specific information, see the following table.

Expression cassette in N2-N8 fragment and information table about pERG20-pERG7 fragment

Expression cassette in N2-N8 fragment and pERG20-pERG7 fragment sequence table

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> recombinant saccharomyces cerevisiae for producing rose essential oil, and construction method and application thereof

<130> 210858

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 726

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 60

ccatgattac gccaagctct gttccattga tttcttctct attgttatat cataattttc 120

atgaggtaat tcattgattt ttttgaatgc taatgagcct actttgaaaa tattctcatg 180

ttcaaaagag cgtgccggtt tcagttcgat ttgcttcata ttaacagaaa aactacttga 240

gtaaactaaa tcctcctttt ctaaacaccc ttccatacct cttgaagatg aactcggata 300

tttcagagag gaatctggac attgattttt caaagcaccc agtttgttct ggatatgttc 360

aagagtctcc acccttttat ttggcctgaa gaacggatcc tcattttcct tcgaagcttc 420

cattggtgtg gattgacgag atttgatagg cgagatggag gccccagagt tcggtgcacc 480

tagcgccact ttggatcgcc ttttcgaagg tcttgcattt aagcaacttt catttaacgg 540

ctgcgccatt gatggcattt ttctttttgt gctgttttgt gaggaattga cactcgacgg 600

tgttctcaca gttattcgct gagatgacgc atagttagaa ggtgatcttc ctctaataat 660

aagaggaggc gttttcattt cttgcaaata cacaaacatc ccttttgatc cattttttaa 720

agccag 726

<210> 2

<211> 2498

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acgcacagat attataacat ctgcacaata ggcatttgca agaattactc gtgagtaagg 60

aaagagtgag gaactatcgc atacctgcat ttaaagatgc cgatttgggc gcgaatcctt 120

tattttggct tcaccctcat actattatca gggccagaaa aaggaagtgt ttccctcctt 180

cttgaattga tgttaccctc ataaagcacg tggcctctta tcgagaaaga aattaccgtc 240

gctcgtgatt tgtttgcaaa aagaacaaaa ctgaaaaaac ccagacacgc tcgacttcct 300

gtcttcctat tgattgcagc ttccaatttc gtcacacaac aaggtcctag cgacggctca 360

caggttttgt aacaagcaat cgaaggttct ggaatggcgg gaaagggttt agtaccacat 420

gctatgatgc ccactgtgat ctccagagca aagttcgttc gatcgtactg ttactctctc 480

tctttcaaac agaattgtcc gaatcgtgtg acaacaacag cctgttctca cacactcttt 540

tcttctaacc aagggggtgg tttagtttag tagaacctcg tgaaacttac atttacatat 600

atataaactt gcataaattg gtcaatgcaa gaaatacata tttggtcttt tctaattcgt 660

agtttttcaa gttcttagat gctttctttt tctctttttt acagatcatc aaggaagtaa 720

ttatctactt tttacaacaa atataaaaca aaaacaatgg ctgcagacca attggtgaaa 780

actgaagtca ccaagaagtc ttttactgct cctgtacaaa aggcttctac accagtttta 840

accaataaaa cagtcatttc tggatcgaaa gtcaaaagtt tatcatctgc gcaatcgagc 900

tcatcaggac cttcatcatc tagtgaggaa gatgattccc gcgatattga aagcttggat 960

aagaaaatac gtcctttaga agaattagaa gcattattaa gtagtggaaa tacaaaacaa 1020

ttgaagaaca aagaggtcgc tgccttggtt attcacggta agttaccttt gtacgctttg 1080

gagaaaaaat taggtgatac tacgagagcg gttgcggtac gtaggaaggc tctttcaatt 1140

ttggcagaag ctcctgtatt agcatctgat cgtttaccat ataaaaatta tgactacgac 1200

cgcgtatttg gcgcttgttg tgaaaatgtt ataggttaca tgcctttgcc cgttggtgtt 1260

ataggcccct tggttatcga tggtacatct tatcatatac caatggcaac tacagagggt 1320

tgtttggtag cttctgccat gcgtggctgt aaggcaatca atgctggcgg tggtgcaaca 1380

actgttttaa ctaaggatgg tatgacaaga ggcccagtag tccgtttccc aactttgaaa 1440

agatctggtg cctgtaagat atggttagac tcagaagagg gacaaaacgc aattaaaaaa 1500

gcttttaact ctacatcaag atttgcacgt ctgcaacata ttcaaacttg tctagcagga 1560

gatttactct tcatgagatt tagaacaact actggtgacg caatgggtat gaatatgatt 1620

tctaaaggtg tcgaatactc attaaagcaa atggtagaag agtatggctg ggaagatatg 1680

gaggttgtct ccgtttctgg taactactgt accgacaaaa aaccagctgc catcaactgg 1740

atcgaaggtc gtggtaagag tgtcgtcgca gaagctacta ttcctggtga tgttgtcaga 1800

aaagtgttaa aaagtgatgt ttccgcattg gttgagttga acattgctaa gaatttggtt 1860

ggatctgcaa tggctgggtc tgttggtgga tttaacgcac atgcagctaa tttagtgaca 1920

gctgttttct tggcattagg acaagatcct gcacaaaatg ttgaaagttc caactgtata 1980

acattgatga aagaagtgga cggtgatttg agaatttccg tatccatgcc atccatcgaa 2040

gtaggtacca tcggtggtgg tactgttcta gaaccacaag gtgccatgtt ggacttatta 2100

ggtgtaagag gcccgcatgc taccgctcct ggtaccaacg cacgtcaatt agcaagaata 2160

gttgcctgtg ccgtcttggc aggtgaatta tccttatgtg ctgccctagc agccggccat 2220

ttggttcaaa gtcatatgac ccacaacagg aaacctgctg aaccaacaaa acctaacaat 2280

ttggacgcca ctgatataaa tcgtttgaaa gatgggtccg tcacctgcat taaatcctaa 2340

agttataaaa aaaataagtg tatacaaatt ttaaagtgac tcttaggttt taaaacgaaa 2400

attcttattc ttgagtaact ctttcctgta ggtcaggttg ctttctcagg tatagcatga 2460

ggtcgctctt attgaccaca cctctaccgg catgccga 2498

<210> 3

<211> 2807

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atggataata tctatattaa acaagcattg gttttgaagg 840

aagttaagca tgttttccaa aaattgatcg gtgaagatcc aatggaatct atgtacatgg 900

ttgatacaat ccaaagattg ggtatcgaac atcatttcga agaagaaatc gaagctgcat 960

tgcaaaagca acatttgatt ttctcttctc atttgtctga tttcgcaaac aaccataaat 1020

tgtgtgaagt tgctttgcct tttagattgt tgagacaaag aggtcattac gttttggcag 1080

atgttttcga taatttgaag tcaaataaga aagaattcag agaaaaacat ggtgaagatg 1140

ttaagggttt gatttcttta tacgaagcta ctcaattggg tattgaaggt gaagattcat 1200

tggatgatgc aggttactta tgtcatcaat tgttacatgc ttggttaact agacatgaag 1260

aacataacga agcaatgtac gttgctaaga cattgcaaca tccattacat tacgatttgt 1320

ctagattcag agatgatact tcaatcttgt tgaacgattt caagacaaaa agagaatggg 1380

aatgtttgga agaattagca gaaattaatt cttcaatcgt tagattcgtt aatcaaaatg 1440

aaattacaca agtttacaag tggtggaagg atttgggttt aaataacgag gttaagttcg 1500

caagatacca accattgaag tggtacatgt ggccaatggc ttgttttact gatccaagat 1560

tttcagaaca aagaatcgaa ttgacaaaac caatttcttt agtctacatc atcgatgata 1620

tttttgatgt ttacggtact ttggatcaat tgactttgtt tactgatgca attaaaagat 1680

gggaattggc ttctactgaa caattgccag atttcatgaa gatgtgtttg agagttttgt 1740

acgaaattac aaatgatttt gctgaaaaga tttgtaagaa acatggtttt aatccaattg 1800

aaactttgaa gagatcttgg gttagattgt tgaacgcatt tttagaagaa gctcattggt 1860

tgaactctgg tcatttgcca agatcagcag aatatttgaa caacggtatc gtttcaacag 1920

gtgttcatgt tgttttggtt cattctttct ttttgatgga ttactcaatt aataatgaaa 1980

ttgttgctat cgttgataac gttccacaaa tcatccattc tgttgcaaag atcttgagat 2040

tgtcagatga tttggaaggt gctaaatctg aagatcaaaa cggtttggat ggttcataca 2100

tcgattgtta catgaacgaa catcaagatg tttctgcagg tgacgctcaa agacatgttg 2160

ctcatttgat ttcatgtgaa tggaagagat taaatagaga aatcttgact caaaaccaat 2220

tgccatcttc ttttactaac ttttgtttga atgctgcaag aatggttcca ttgatgtacc 2280

attacagatc taacccaggt ttgtcaactt tgcaagaaca tgttaaattg ttgtctaata 2340

atgctgttgc aggtgctgaa agacatgttg ttcatatttt gtgtttacaa tttgttattg 2400

aataagatta atataattat ataaaaatat tatcttcttt tctttatatc tagtgttatg 2460

taaaataaat tgatgactac ggaaagcttt tttatattgt ttctttttca ttctgagcca 2520

cttaaatttc gtgaatgttc ttgtaaggga cggtagattt acaagtgata caacaaaaag 2580

caaggcgctt tttctaataa aaagaagaaa agcatttaac aattgaacac ctctatatca 2640

acgaagaata ttactttgtc tctaaatcct tgtaaaatgt gtacgatctc tatatgggtt 2700

actcataagt gtaccgaaga ctgcattgaa agtttatgtt ttttcactgg aggcgtcatt 2760

ttcgcgttga gaagatgttc ttatccaaat ttcaactgtt atataga 2807

<210> 4

<211> 1520

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atgtctgcta gaggtttgaa taagatctct tgttctttga atttgcaaac 480

tgaaaaattg tgttacgaag ataacgataa cgatttggat gaagaattga tgccaaagca 540

tatcgctttg atcatggatg gtaacagaag atgggcaaaa gataaaggtt tagaagttta 600

cgaaggtcat aagcatatca tcccaaaatt gaaggaaatt tgtgatattt cttcaaaatt 660

gggtattcaa atcatcactg ctttcgcatt ttctacagaa aactggaaga gatcaaagga 720

agaagttgat ttcttgttac aaatgttcga agaaatctat gatgaatttt ctagatcagg 780

tgttagagtt tctatcatcg gttgtaagtc agatttgcca atgactttgc aaaagtgtat 840

cgctttgaca gaagaaacta caaagggtaa taagggtttg catttggtta ttgcattgaa 900

ctacggtggt tactacgata tcttgcaagc tactaagtca atcgttaata aggcaatgaa 960

cggtttgtta gatgttgaag atatcaataa gaatttgttc gatcaagaat tagaatctaa 1020

gtgtccaaac ccagatttgt tgattagaac tggtggtgaa caaagagttt caaatttctt 1080

gttgtggcaa ttggcttaca cagaattcta cttcactaac acattgttcc cagatttcgg 1140

tgaagaagat ttgaaggaag caatcatgaa cttccaacaa agacatagaa gattcggtgg 1200

tcatacatat taaccgctga tcctagaggg ccgcatcatg taattagtta tgtcacgctt 1260

acattcacgc cctcccccca catccgctct aaccgaaaag gaaggagtta gacaacctga 1320

agtctaggtc cctatttatt tttttatagt tatgttagta ttaagaacgt tatttatatt 1380

tcaaattttt cttttttttc tgtacagacg cgtgtacgca tgtaacatta tactgaaaac 1440

cttgcttgag aaggttttgg gacgctcgaa ggctttaatt tgcaagctgc ggccctgcat 1500

taatgaatcg gccaacgcgc 1520

<210> 5

<211> 1993

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

catcataagg aattccggga ttctccccat gaaaggtatc tggatctacc actgcaccta 60

aaattacatg caagctaaag tgtttatttt gttgggatgg tttcttcacg ctaattgatg 120

aagcaaattg aactctttca taacgggcaa ctttctgaat agaatcttct ggataggaaa 180

acaataaaga gtccactcca tattcttcat aattaacgtg gtctctgtgc aaataaaaag 240

tggaatcgta ttttttcatt ttagtgatat ttcgaacatt tgaagcttct cttatgattt 300

gatgttttgg caaaggggaa ggcaccaacg gacatactga aggacaaaat tgaggacctt 360

tgtcgcgttt cgctgtatgc tggacgagat tgatttccgt gtcgtcgtcg tcattcttag 420

cttttatttt gatagcgaaa tattgcactc ttaatctgct ttctactgaa gagtcttcaa 480

cgagaagatc aaaactgctc tttaaaaaag tatccaaatc acaatttgcc gtttcaaacg 540

ttgatactaa ggtaaaataa tttcttttat aacctaccca ctcttcatca atatggtcga 600

acgtttaaag cggtttaaac gtgtcactac ataagaacac ctttggtgga gggaacatcg 660

ttggtaccat tgggcgaggt ggcttctctt atggcaaccg caagagcctt gaacgcactc 720

tcactacggt gatgatcatt cttgcctcgc agacaatcaa cgtggagggt aattctgcta 780

gcctctgcaa agctttcaag aaaatgcggg atcatctcgc aagagagatc tcctactttc 840

tccctttgca aaccaagttc gacaactgcg tacggcctgt tcgaaagatc taccaccgct 900

ctggaaagtg cctcatccaa aggcgcaaat cctgatccaa acctttttac tccacgcgcc 960

agtagggcct ctttaaaagc ttgaccgaga gcaatcccgc agtcttcagt ggtgtgatgg 1020

tcgtctatgt gtaagtcacc aatgcactca acgattagcg accagccgga atgcttggcc 1080

agagcatgta tcatatggtc cagaaaccct atacctgtgt ggacgttaat cacttgcgat 1140

tgtgtggcct gttctgctac tgcttctgcc tctttttctg ggaagatcga gtgctctatc 1200

gctaggggac caccctttaa agagatcgca atctgaatct tggtttcatt tgtaatacgc 1260

tttactaggg ctttctgctc tgtcatcttt gccttcgttt atcttgcctg ctcatttttt 1320

agtatattct tcgaagaaat cacattactt tatataatgt ataattcatt atgtgataat 1380

gccaatcgct aagaaaaaaa aagagtcatc cgctaggtgg aaaaaaaaaa atgaaaatca 1440

ttaccgaggc ataaaaaaat atagagtgta ctagaggagg ccaagagtaa tagaaaaaga 1500

aaattgcggg aaaggactgt gttatgactt ccctgactaa tgccgtgttc aaacgatacc 1560

tggcagtgac tcctagcgct caccaagctc ttaaaacgga attatggtgc actctcagta 1620

caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg 1680

cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg 1740

ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgatc cggacgccac 1800

cgctggtacc gagctcggat ccactagtaa cggccgccag tgtgctggaa ttgcccttaa 1860

gggcaattct gcagatatcc atcacactgg cggccgctcg agcatgcatc tagagggccc 1920

aattcgccct atagtgagtc gtattacaat tcactggccg tcgttttaca acgtcgtgac 1980

tgggaaaacc ctg 1993

<210> 6

<211> 1746

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg 60

caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat 120

aacaatttca cacaggaaac agctatgacc atgattacgc caagctgggc tggcttaact 180

atgcggcatc agagcagatt gtactgagag tgcaccatac caccttttca attcatcatt 240

ttttttttat tctttttttt gatttcggtt tccttgaaat ttttttgatt cggtaatctc 300

cgaacagaag gaagaacgaa ggaaggagca cagacttaga ttggtatata tacgcatatg 360

tagtgttgaa gaaacatgaa attgcccagt attcttaacc caactgcaca gaacaaaaac 420

ctgcaggaaa cgaagataaa tcatgtcgaa agctacatat aaggaacgtg ctgctactca 480

tcctagtcct gttgctgcca agctatttaa tatcatgcac gaaaagcaaa caaacttgtg 540

tgcttcattg gatgttcgta ccaccaagga attactggag ttagttgaag cattaggtcc 600

caaaatttgt ttactaaaaa cacatgtgga tatcttgact gatttttcca tggagggcac 660

agttaagccg ctaaaggcat tatccgccaa gtacaatttt ttactcttcg aagacagaaa 720

atttgctgac attggtaata cagtcaaatt gcagtactct gcgggtgtat acagaatagc 780

agaatgggca gacattacga atgcacacgg tgtggtgggc ccaggtattg ttagcggttt 840

gaagcaggcg gcagaagaag taacaaagga acctagaggc cttttgatgt tagcagaatt 900

gtcatgcaag ggctccctat ctactggaga atatactaag ggtactgttg acattgcgaa 960

gagcgacaaa gattttgtta tcggctttat tgctcaaaga gacatgggtg gaagagatga 1020

aggttacgat tggttgatta tgacacccgg tgtgggttta gatgacaagg gagacgcatt 1080

gggtcaacag tatagaaccg tggatgatgt ggtctctaca ggatctgaca ttattattgt 1140

tggaagagga ctatttgcaa agggaaggga tgctaaggta gagggtgaac gttacagaaa 1200

agcaggctgg gaagcatatt tgagaagatg cggccagcaa aactaagcgg tttaaacatg 1260

actgctgaag aatttgattt ttctagccat tcccatagac gttacaatcc actaaccgat 1320

tcatggatct tagtttctcc acacagagct aaaagacctt ggttaggtca acaggaggct 1380

gcttacaagc ccacagctcc attgtatgat ccaaaatgct atctatgtcc tggtaacaaa 1440

agagctactg gtaacctaaa cccaagatat gaatcaacgt atattttccc caatgattat 1500

gctgccgtta ggctcgatca acctatttta ccacagaatg attccaatga ggataatctt 1560

aaaaataggc tgcttaaagt gcaatctgtg agaggcaatt gtttcgtcat atgttttagc 1620

cccaatcata atctaaccat tccacaaatg aaacaatcag atctggttca tattgttaat 1680

tcttggcaag cattgactga cgatctctcc agagaagcaa gagaaaatca taagcctttc 1740

aaatat 1746

<210> 7

<211> 2405

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atactagcgt tgaatgttag cgtcaacaac aagaagttta atgacgcgga ggccaaggca 60

aaaagattcc ttgattacgt aagggagtta gaatcatttt gaataaaaaa cacgcttttt 120

cagttcgagt ttatcattat caatactgcc atttcaaaga atacgtaaat aattaatagt 180

agtgattttc ctaactttat ttagtcaaaa aattagcctt ttaattctgc tgtaacccgt 240

acatgcccaa aatagggggc gggttacaca gaatatataa catcgtaggt gtctgggtga 300

acagtttatt cctggcatcc actaaatata atggagcccg ctttttaagc tggcatccag 360

aaaaaaaaag aatcccagca ccaaaatatt gttttcttca ccaaccatca gttcataggt 420

ccattctctt agcgcaacta cagagaacag gggcacaaac aggcaaaaaa cgggcacaac 480

ctcaatggag tgatgcaacc tgcctggagt aaatgatgac acaaggcaat tgacccacgc 540

atgtatctat ctcattttct tacaccttct attaccttct gctctctctg atttggaaaa 600

agctgaaaaa aaaggttgaa accagttccc tgaaattatt cccctacttg actaataagt 660

atataaagac ggtaggtatt gattgtaatt ctgtaaatct atttcttaaa cttcttaaat 720

tctactttta tagttagtct tttttttagt tttaaaacac caagaactta gtttcgaata 780

aacacacata aacaaacaaa atgccatttg ttaaggactt taagccacaa gctttgggtg 840

acaccaactt attcaaacca atcaaaattg gtaacaatga acttctacac cgtgctgtca 900

ttcctccatt gactagaatg agagcccaac atccaggtaa tattccaaac agagactggg 960

ccgttgaata ctacgctcaa cgtgctcaaa gaccaggaac cttgattatc actgaaggta 1020

cctttccctc tccacaatct gggggttacg acaatgctcc aggtatctgg tccgaagaac 1080

aaattaaaga atggaccaag attttcaagg ctattcatga gaataaatcg ttcgcatggg 1140

tccaattatg ggttctaggt tgggctgctt tcccagacac ccttgctagg gatggtttgc 1200

gttacgactc cgcttctgac aacgtgtata tgaatgcaga acaagaagaa aaggctaaga 1260

aggctaacaa cccacaacac agtataacaa aggatgaaat taagcaatac gtcaaagaat 1320

acgtccaagc tgccaaaaac tccattgctg ctggtgccga tggtgttgaa atccacagcg 1380

ctaacggtta cttgttgaac cagttcttgg acccacactc caataacaga accgatgagt 1440

atggtggatc catcgaaaac agagcccgtt tcaccttgga agtggttgat gcagttgtcg 1500

atgctattgg ccctgaaaaa gtcggtttga gattgtctcc atatggtgtc ttcaacagta 1560

tgtctggtgg tgctgaaacc ggtattgttg ctcaatatgc ttatgtctta ggtgaactag 1620

aaagaagagc taaagctggc aagcgtttgg ctttcgtcca tctagttgaa cctcgtgtca 1680

ccaacccatt tttaactgaa ggtgaaggtg aatacaatgg aggtagcaac aaatttgctt 1740

attctatctg gaagggccca attattagag ctggtaactt tgctctgcac ccagaagttg 1800

tcagagaaga ggtgaaggat cctagaacat tgatcggtta cggtagattt tttatctcta 1860

atccagattt ggttgatcgt ttggaaaaag ggttaccatt aaacaaatat gacagagaca 1920

ctttctacaa aatgtcagct gagggataca ttgactaccc tacgtacgaa gaagctctaa 1980

aactcggttg ggacaaaaat taagattaat ataattatat aaaaatatta tcttcttttc 2040

tttatatcta gtgttatgta aaataaattg atgactacgg aaagcttttt tatattgttt 2100

ctttttcatt ctgagccact taaatttcgt gaatgttctt gtaagggacg gtagatttac 2160

aagtgataca acaaaaagca aggcgctttt tctaataaaa agaagaaaag catttaacaa 2220

ttgaacacct ctatatcaac gaagaatatt actttgtctc taaatccttg taaaatgtgt 2280

acgatctcta tatgggttac tcataagtgt accgaagact gcattgaaag tttatgtttt 2340

ttcactggag gcgtcatttt cgcgttgaga agatgttctt atccaaattt caactgttat 2400

ataga 2405

<210> 8

<211> 3413

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa atgtctgctt gtactccttt ggcatctgct atgccattgt cttctactcc 480

attgattaac ggtgataatt ctcagagaaa aaatacaaga caacatatgg aagagtcttc 540

atctaaaaga agagaatatt tgttggaaga aacaacaaga aaattgcaaa gaaacgatac 600

tgaatctgtt gagaaattaa aattgataga taacattcaa caattaggta ttggatacta 660

ttttgaagat gctataaatg ctgttttacg ttctcctttt tctacaggtg aagaagattt 720

gtttacagct gcattgagat ttaggttgtt gaggcataat ggtattgaaa tttctcctga 780

aattttcttg aagttcaaag atgaaagggg aaagttcgat gaatctgata ctttgggttt 840

attgtcttta tacgaggctt caaacttggg tgttgctggt gaagagattt tggaggaggc 900

tatggagttc gctgaagcta ggttgaggag gtctttgtct gagccagcag ctccattgca 960

cggtgaagtt gcacaggctt tagacgtccc aaggcacttg agaatggcta gattggaagc 1020

tagaagattt attgaacaat acggtaagca gtctgaccat gacggtgact tgttggaatt 1080

ggcaatttta gattataacc aagtccaggc tcagcaccag tctgaattga cagaaattat 1140

taggtggtgg aaagaattgg gattggttga taaattatct tttggtagag atagaccatt 1200

ggaatgcttt ttgtggactg tcggtttgtt gccagagcca aagtattctt ctgttagaat 1260

tgagttggct aaagctattt ctattttgtt ggttattgat gatattttcg atacatacgg 1320

tgaaatggat gatttaattt tgttcactga cgctattaga aggtgggact tagaggctat 1380

ggaaggttta cctgaatata tgaagatttg ctacatggct ttgtacaata ctacaaacga 1440

agtttgttat aaagttttaa gagatactgg tagaattgtt ttgttaaatt tgaaatcaac 1500

ttggattgat atgattgaag gttttatgga agaggctaaa tggttcaacg gaggttctgc 1560

tcctaagttg gaggaatata ttgaaaatgg tgtttcaact gctggtgctt acatggcttt 1620

cgctcatatt ttctttttaa ttggagaagg tgttactcat caaaattctc aattgttcac 1680

tcaaaagcca tatccaaaag tcttttctgc tgcaggtaga attttgagat tgtgggacga 1740

cttgggtaca gctaaggagg agcaagagag gggtgattta gcttcttgtg ttcaattatt 1800

tatgaaggaa aaatcattga ctgaagagga ggctagatct agaattttgg aagaaattaa 1860

gggtttatgg agagatttga atggtgagtt ggtctataat aagaatttac cattatcaat 1920

tattaaagtc gctttgaaca tggctagggc ttctcaggtc gtctataaac acgatcaaga 1980

tacttacttt tcttctgttg acaattacgt tgatgcttta tttttcactc aataaggtgg 2040

tggttctatg gcttcagaaa aagaaattag gagagagaga ttcttgaacg ttttccctaa 2100

attagtagag gaattgaacg catcgctttt ggcttacggt atgcctaagg aagcatgtga 2160

ctggtatgcc cactcattga actacaacac tccaggcggt aagctaaata gaggtttgtc 2220

cgttgtggac acgtatgcta ttctctccaa caagaccgtt gaacaattgg ggcaagaaga 2280

atacgaaaag gttgccattc taggttggtg cattgagttg ttgcaggctt actggttggt 2340

cgccgatgat atgatggaca agtccattac cagaagaggc caaccatgtt ggtacaaggt 2400

tcctgaagtt ggggaaattg ccatctggga cgcattcatg ttagaggctg ctatctacaa 2460

gcttttgaaa tctcacttca gaaacgaaaa atactacata gatatcaccg aattgttcca 2520

tgaggtcacc ttccaaaccg aattgggcca attgatggac ttaatcactg cacctgaaga 2580

caaagtcgac ttgagtaagt tctccctaaa gaagcactcc ttcatagtta ctttcaagac 2640

tgcttactat tctttctact tgcctgtcgc attggccatg tacgttgccg gtatcacgga 2700

tgaaaaggat ttgaaacaag ccagagatgt cttgattcca ttgggtgaat acttccaaat 2760

tcaagatgac tacttagact gcttcggtac cccagaacag atcggtaaga tcggtacaga 2820

tatccaagat aacaaatgtt cttgggtaat caacaaggca ttggaacttg cttccgcaga 2880

acaaagaaag actttagacg aaaattacgg taagaaggac tcagtcgcag aagccaaatg 2940

caaaaagatt ttcaatgact tgaaaattga acagctatac cacgaatatg aagagtctat 3000

tgccaaggat ttgaaggcca aaatttctca ggtcgatgag tctcgtggct tcaaagctga 3060

tgtcttaact gcgttcttga acaaagttta caagagaagc aaatagccgc tgatcctaga 3120

gggccgcatc atgtaattag ttatgtcacg cttacattca cgccctcccc ccacatccgc 3180

tctaaccgaa aaggaaggag ttagacaacc tgaagtctag gtccctattt atttttttat 3240

agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt ttctgtacag 3300

acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt gagaaggttt tgggacgctc 3360

gaaggcttta atttgcaagc tgcggccctg cattaatgaa tcggccaacg cgc 3413

<210> 9

<211> 911

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtccaaatat ttgaaaacaa aggtacagcc atgggttgtt ccaacttaca tccacatggc 60

caagcttggt gcttagaatc catccctagt gaagtttcgc aagaattgaa atcttttgat 120

aaatataaac gtgaacacaa tactgatttg tttgccgatt acgtcaaatt agaatcaaga 180

gagaagtcaa gagtcgtagt ggagaatgaa tcctttattg ttgttgttcc atactgggcc 240

atctggccat ttgagacctt ggtcatttca aagaagaagc ttgcctcaat tagccaattt 300

aaccaaatgg tgaaggagga cctcgcctcg attttaaagc aactaactat taagtatgat 360

aatttatttg aaacgagttt cccatactca atgggtatcc atcaggctcc tttgaatgcg 420

actggtgatg aattgagtaa tagttggttt cacatgcatt tctacccacc tttactgaga 480

tcagctactg ttcggaaatt cttggttggt tttgaattgt taggtgagcc tcaaagagat 540

ttaacttcgg aacaagctgc tgaaaaacta agaaatttag atggtcagat tcattatcta 600

caaagactgt aatggtaccg agctcggatc cactagtaac ggccgccagt gtgctggaat 660

tgcccttaag ggcaattctg cagatatcca tcacactggc ggccgctcga gcatgcatct 720

agagggccca attcgcccta tagtgagtcg tattacaatt cactggccgt cgttttacaa 780

cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct 840

ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc 900

agcctgaatg g 911

<210> 10

<211> 352

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Met Ala Ser Glu Lys Glu Ile Arg Arg Glu Arg Phe Leu Asn Val Phe

1 5 10 15

Pro Lys Leu Val Glu Glu Leu Asn Ala Ser Leu Leu Ala Tyr Gly Met

20 25 30

Pro Lys Glu Ala Cys Asp Trp Tyr Ala His Ser Leu Asn Tyr Asn Thr

35 40 45

Pro Gly Gly Lys Leu Asn Arg Gly Leu Ser Val Val Asp Thr Tyr Ala

50 55 60

Ile Leu Ser Asn Lys Thr Val Glu Gln Leu Gly Gln Glu Glu Tyr Glu

65 70 75 80

Lys Val Ala Ile Leu Gly Trp Cys Ile Glu Leu Leu Gln Ala Tyr Trp

85 90 95

Leu Val Ala Asp Asp Met Met Asp Lys Ser Ile Thr Arg Arg Gly Gln

100 105 110

Pro Cys Trp Tyr Lys Val Pro Glu Val Gly Glu Ile Ala Ile Trp Asp

115 120 125

Ala Phe Met Leu Glu Ala Ala Ile Tyr Lys Leu Leu Lys Ser His Phe

130 135 140

Arg Asn Glu Lys Tyr Tyr Ile Asp Ile Thr Glu Leu Phe His Glu Val

145 150 155 160

Thr Phe Gln Thr Glu Leu Gly Gln Leu Met Asp Leu Ile Thr Ala Pro

165 170 175

Glu Asp Lys Val Asp Leu Ser Lys Phe Ser Leu Lys Lys His Ser Phe

180 185 190

Ile Val Thr Phe Lys Thr Ala Tyr Tyr Ser Phe Tyr Leu Pro Val Ala

195 200 205

Leu Ala Met Tyr Val Ala Gly Ile Thr Asp Glu Lys Asp Leu Lys Gln

210 215 220

Ala Arg Asp Val Leu Ile Pro Leu Gly Glu Tyr Phe Gln Ile Gln Asp

225 230 235 240

Asp Tyr Leu Asp Cys Phe Gly Thr Pro Glu Gln Ile Gly Lys Ile Gly

245 250 255

Thr Asp Ile Gln Asp Asn Lys Cys Ser Trp Val Ile Asn Lys Ala Leu

260 265 270

Glu Leu Ala Ser Ala Glu Gln Arg Lys Thr Leu Asp Glu Asn Tyr Gly

275 280 285

Lys Lys Asp Ser Val Ala Glu Ala Lys Cys Lys Lys Ile Phe Asn Asp

290 295 300

Leu Lys Ile Glu Gln Leu Tyr His Glu Tyr Glu Glu Ser Ile Ala Lys

305 310 315 320

Asp Leu Lys Ala Lys Ile Ser Gln Val Asp Glu Ser Arg Gly Phe Lys

325 330 335

Ala Asp Val Leu Thr Ala Phe Leu Asn Lys Val Tyr Lys Arg Ser Lys

340 345 350

Claims

1. A construction method of recombinant saccharomyces cerevisiae is characterized by comprising the following steps: the method comprises the following steps: the starting saccharomyces cerevisiae is transformed as follows to obtain recombinant saccharomyces cerevisiae:

a1, introducing a geraniol synthetase gene ObGES gene;

a2, introduction of farnesyl pyrophosphate synthetase gene 96-position and 127-position double-point mutant gene ERG20 ^F96W/N127W A gene;

a3, introducing A3-hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG 1;

a4, introducing a geraniol reductase gene OYE2 gene;

a5, introducing an nerol synthetase GmNES gene;

a6, introduction of neryl diphosphate synthase SINDPS1 gene.

2. The construction method according to claim 1, characterized in that: the method comprises the following steps: the starting saccharomyces cerevisiae was also modified as follows:

b1, replacing a promoter of a driving farnesyl pyrophosphate synthetase gene ERG20 gene with a promoter of an ERG7 gene named as pERG 7;

b2, introducing a mevalonate kinase gene ERG12 gene;

b3, introducing an isopentenyl pyrophosphate isomerase gene IDI1 gene;

b4, introducing an MVAPP decarboxylase gene ERG19 gene;

b5, introducing an HMG-CoA reductase gene HMGR gene;

b6, introducing a 3-hydroxy-3-methylglutaryl coenzyme A synthase gene ERG13 gene;

b7, introducing an MVAP kinase gene ERG8 gene;

b8, introducing an acetyl-CoA acetyltransferase gene ERG 10.

3. The method according to claim 1 or 2, characterized in that:

the sequence of the ObGES protein coded by the ObGES gene is genbank accession number: the 35569 of the AMK97466.1 sequence;

and/or, the ERG20 ^F96W/N127W Gene encoded ERG20 ^F96W/N127W The sequence of the protein is shown as SEQ ID No. 10;

and/or the sequence of the tHMG1 protein coded by the tHMG1 gene is genbank accession number: AJS96703.1 sequence 5301054;

and/or, the sequence of the OYE2 protein coded by the OYE2 gene is genbank accession number: NP _012049.1 sequence;

and/or the sequence of the GmNES protein coded by the GmNES gene is genbank login number: AEE92791.1 sequence;

and/or, the sequence of the SINDPS1 protein coded by the SINDPS1 gene is genbank accession number: QNM36897.1 sequence.

4. The method according to any one of claims 1-3, wherein:

the sequence of the ObGES gene is shown as the 431 st 2035 th site in SEQ ID NO. 8;

and/or, the ERG20 ^F96W/N127W The sequence of the gene is shown as 2048 th site to 3106 th site in SEQ ID NO. 8;

and/or the sequence of the tHMG1 gene is shown as 757 th-2340 th sites in SEQ ID NO. 2;

and/or the sequence of the OYE2 gene is shown as 801 th to 2003 th in SEQ ID NO. 7;

and/or the sequence of the GmNES gene is shown as 801 th to 2405 th in SEQ ID NO. 3;

and/or the sequence of the SINDPS1 gene is shown as 431 th site to 1213 th site in SEQ ID NO. 4.

5. A method according to any one of claims 1-3, characterized in that:

the A1 and the A2 are obtained by introducing an ObGES gene and ERG20 into the starting saccharomyces cerevisiae ^F96W/N127W Gene expression cassette implementation;

and/or said A3 is effected by introducing a tmg 1 gene expression cassette into said starting saccharomyces cerevisiae;

and/or, said A4 is effected by introducing an OYE2 gene expression cassette into said starting saccharomyces cerevisiae;

and/or, the A5 is realized by introducing a GmNES gene expression cassette into the starting saccharomyces cerevisiae;

and/or, the A6 is realized by introducing a SINDPS1 gene expression cassette into the starting saccharomyces cerevisiae;

and/or, said B2 is achieved by introducing an ERG12 gene expression cassette into said starting Saccharomyces cerevisiae;

and/or, said B3 is effected by introducing an IDI1 gene expression cassette into said s.cerevisiae;

and/or, said B4 is achieved by introducing an ERG19 gene expression cassette into said starting Saccharomyces cerevisiae;

and/or, said B5 is effected by introducing an HMGR gene expression cassette into said starting saccharomyces cerevisiae;

and/or, said B6 is achieved by introducing an ERG13 gene expression cassette into said starting Saccharomyces cerevisiae;

and/or, said B7 is achieved by introducing an ERG8 gene expression cassette into said starting Saccharomyces cerevisiae;

and/or, the B8 is realized by introducing an ERG10 gene expression cassette into the starting saccharomyces cerevisiae.

6. The method according to any one of claims 1-5, wherein: in the recombinant saccharomyces cerevisiae, the ObGES gene and ERG20 ^F96W/N127W The gene is expressed by an expression plasmid which is introduced into the starting saccharomyces cerevisiae; tHMG1 gene, obGES gene and ERG20 ^F96W/N127W Integrating the gene into the Gal70 locus of the starting Saccharomyces cerevisiae; integrating a tHMG1 gene, a GmNES gene and a SINDPS1 gene into an NDT80 locus of the starting saccharomyces cerevisiae; the pERG7 replaces the 1 st to 248 th position of the promoter driving the ERG20 gene.

7. A recombinant Saccharomyces cerevisiae constructed by the method of any one of claims 1-6.

8. A method for producing a terpene, characterized by: comprising culturing the recombinant Saccharomyces cerevisiae of claim 7 to obtain a fermentation product; obtaining terpenes from the fermentation product.

9. Any one of the following applications is described below,

use of X1, a process according to any one of claims 1 to 6, for the manufacture of a terpene product;

use of X2, a method according to any one of claims 1 to 6 for the production of a terpene;

use of X3, the recombinant saccharomyces cerevisiae of claim 7 in the preparation of a product for the production of terpenes;

use of X4, the recombinant saccharomyces cerevisiae described in claim 7 for the production of terpenes.

10. The method of claim 8, the use of claim 9, wherein: the terpene is at least one of geraniol, citronellol and nerol.