CN115232814A - Method and system for constructing congenital cataract disease model pig nuclear transplantation donor cells with CRYBB2 gene mutation - Google Patents

Abstract

The invention discloses a method and a system for constructing congenital cataract disease model pig nuclear transplantation donor cells with CRYBB2 gene mutation. The invention provides a kit, which comprises SEQ ID NO:18, CRYBB2-gRNA3 shown in SEQ ID NO:19, CRYBB2-gRNA6 and NCN protein. The NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein. The application of the kit is as follows: preparing a recombinant cell; preparing a cataract model pig; preparing a cataract cell model or a cataract tissue model or a cataract organ model. The invention also provides a method for preparing recombinant cells, which comprises the following steps: and co-transfecting the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein to the pig cell to obtain a recombinant cell. The invention has great application value for researching and developing cataract drugs and disclosing pathogenesis of the cataract.

Description

Method and system for constructing congenital cataract disease model pig nuclear transplantation donor cells with CRYBB2 gene mutation

Technical Field

The invention belongs to the technical field of biology, particularly belongs to the technical field of gene editing, and more particularly relates to a method and a system for constructing congenital cataract disease model pig nuclear transplantation donor cells with CRYBB2 gene mutation.

Background

Congenital Cataract (Congenital Cataract) refers to a Cataract caused by Congenital genetic or developmental disorder that is present at birth or develops within the last year of birth, and has significant genetic heterogeneity. The incidence of congenital cataract is 0.01% -0.06% worldwide. The congenital cataract is a common eye disease of children, and according to the report of WHO, the congenital cataract accounts for about 10 to 38 percent of the worldwide cases of blindness of children due to various reasons every year.

There are three different genetic patterns of congenital cataracts: autosomal dominant inheritance, autosomal recessive inheritance and sex chromosome linkage inheritance, wherein the autosomal dominant inheritance is the most common inheritance mode of congenital cataract. It is now reported that genes associated with congenital cataract are classified into 4 types: lens proteins, membrane proteins, cytoskeletal proteins, growth regulators.

Crystallin is the major lens structural protein of mammals and accounts for up to 90% of the water-soluble proteins of the lens. Among the crystallin family are three of alpha-crystallin, beta-crystallin and gamma-crystallin, which respectively account for 40%, 35% and 25% of the total amount. The three lens proteins are aggregated into a stable structure according to a proper proportion, and play an important role in the aspects of normal development of the lens, maintenance of transparency and the like. After the gene mutation of the lens protein, the structural abnormality of the lens protein can be caused to influence the close arrangement of the lens protein, and the solubility of the lens protein can be reduced to cause turbidity, namely the formation of cataract.

Beta-crystallin is a water-soluble protein and accounts for 35% of the total lens protein. The beta-crystallin is expressed by 3 CRYBB genes and 4 CRYBA genes and is respectively positioned on different chromosomes, wherein the CRYBB2 gene is expressed most, and the research shows that the function loss of the CRYBB2 gene can cause the occurrence of cataract.

So far, no medicine for treating cataract exists in the world, and some medicines only play a role in slowing down the development of cataract but cannot radically reverse the disease. Therefore, the research on the mechanism of the development of cataract caused by CRYBB2 gene mutation and the development of corresponding drugs are in need of being carried out on the basis of animal models. The current common animal model is a mouse model, however, the mouse is different from the human body in the aspects of body type, organ size, physiology, pathology and the like, and the normal physiological and pathological states of the human body cannot be simulated really. The pig as a large animal has similar body size and physiological function to human, is easy to breed and feed in large scale, has lower requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been greatly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention aims to provide a gene editing system for constructing cataract model pig nuclear transplantation donor cells with CRYBB2 gene mutation and application thereof.

The invention provides a kit, which comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein.

The invention provides a kit, which comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and PRONCN protein.

The invention provides a kit, which comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and specific plasmids.

Any one of the kits above further comprising porcine cells.

The invention provides application of CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN proteins in preparation of a kit.

The invention also provides application of CRYBB2-gRNA3, CRYBB2-gRNA6 and PRONCN proteins in preparation of the kit.

The invention also provides application of the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the heterogenous particles in preparation of the kit.

The invention also provides a method for preparing recombinant cells, which comprises the following steps: and co-transfecting the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein to the pig cell to obtain a recombinant cell.

The recombinant cell is a recombinant cell with CRYBB2 gene mutation.

The mutation is a deletion and/or insertion and/or substitution of one or more nucleotides.

The recombinant cell may be any of the heterozygous monoclonal cells, the biallelic different mutant type monoclonal cells or the biallelic same mutant type monoclonal cells shown in table 1.

The use of any one of the above kits is (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

The co-transfection is specifically a shock transfection.

The parameter settings of the electroporation transfection can be specifically as follows: 1450V, 10ms, 3pulse.

The co-transfection may be specifically carried out using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer apparatus.

The proportions of CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein are as follows: 0.8-1.2 μ g of CRYBB2-gRNA3:0.8-1.2 μ g CRYBB2-gRNA6: 3-5. Mu.g NCN protein.

The ratios of CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein are as follows in sequence: 1 μ g CRYBB2-gRNA3:1 μ g CRYBB2-gRNA6: mu.g NCN protein.

The proportions of the pig cells, the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 0.8-1.2 μ g CRYBB2-gRNA3:0.8-1.2 μ g CRYBB2-gRNA6: 3-5. Mu.g NCN protein.

The proportions of the pig cells, the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 1 μ g CRYBB2-gRNA3:1 μ g CRYBB2-gRNA6: mu.g NCN protein.

Any one of the CRYBB2-gRNA3 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:18 from nucleotide 3 to nucleotide 22.

Specifically, the CRYBB2-gRNA3 is shown as SEQ ID NO:18, respectively.

Specifically, the CRYBB2-gRNA3 is shown as SEQ ID NO: shown at 12.

Any one of the CRYBB2-gRNA6 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:19 at nucleotides 3 to 22.

Specifically, the CRYBB2-gRNA6 is shown as SEQ ID NO:19, respectively.

Specifically, the CRYBB2-gRNA6 is shown as SEQ ID NO: shown at 15.

Any one of the NCN proteins described above is a Cas9 protein or a fusion protein with a Cas9 protein.

Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.

Any one of the above porcine cells is a porcine fibroblast.

Any one of the above porcine cells is a porcine primary fibroblast.

The preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A fusion protein of the tag;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, 5209 to 9852 th nucleotide.

The preparation method of the NCN protein specifically comprises the following steps:

(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and performing shake culture;

(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until OD is reached _600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;

(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);

(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;

(6) Obtaining from step (5) by affinity chromatographyPurifying the filtrate with His ₆ A fusion protein of the tag (a fusion protein shown in SEQ ID NO: 2);

(7) Taking the post-column solution collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);

(8) Will have His ₆ Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;

(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;

(10) And (4) concentrating the supernatant obtained in the step (9) by using an ultrafiltration tube, and then adding the concentrated supernatant into an enzyme stock solution to obtain the NCN protein solution.

Purifying the filtrate obtained in step (5) to give a purified product having His by affinity chromatography ₆ The specific method of the labeled fusion protein is as follows:

firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then, 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Any one of the PRONCN proteins sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.

The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used for guiding the secretion and expression of the target protein into the bacterial periplasm cavity so as to be separated from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.

The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that assists in the formation of disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.

The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) ₆ Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.

The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, so that fused TrxA-His segment can be conveniently cut by enterokinase to obtain the Cas9 protein in a natural form. After the commodity enterokinase enzyme digestion fusion protein with the His label is used, the TrxA-His section and the enterokinase with the His label can be removed through once affinity chromatography to obtain the Cas9 protein in a natural form, and the damage and the loss of the target protein caused by repeated purification and dialysis are avoided.

The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.

The Cas9 protein may be saCas9 or spCas9, preferably is a spCas9 protein.

The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.

Any one of the specific plasmids comprises the following elements from upstream to downstream in sequence: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.

The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.

The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose induced expression, and after bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by the induced expression at low temperature.

The ribosome binding site is a ribosome binding site for translation of a protein, and is essential for translation of a protein.

The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevent other downstream sequences except the target gene from being transcribed and translated.

For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.

The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.

The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.

The ribosome binding site is shown as SEQ ID NO:1, nucleotides 5178 to 5201.

The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotide 5209-5271.

The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.

The coding sequence of His-Tag is shown as SEQ ID NO:1 from nucleotide 5620 to 5637.

The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to nucleotide 5652.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.

The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 9802 to nucleotide 9849.

The T7 terminator is shown as SEQ ID NO:1, nucleotides 9902-9949.

Specifically, the specific plasmid is plasmid pKG-GE4.

Plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotides 5121-9949.

Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.

The invention also protects the recombinant cell prepared by any one of the methods.

The invention also protects the application of the recombinant cell in preparing cataract model pigs.

The recombinant cell is taken as a nuclear transplantation donor cell to carry out somatic cell cloning, so that a cloned pig, namely the cataract model pig can be obtained.

The invention also protects the pig tissue of the model pig prepared by the recombinant cell, namely a cataract tissue model.

The invention also protects a pig organ of a model pig prepared by using the recombinant cell, namely a cataract organ model.

The invention also protects the pig cells of the model pig prepared by the recombinant cells, namely a cataract cell model.

The invention also protects the application of the recombinant cell, the cataract tissue model, the cataract organ model, the cataract cell model or the cataract model pig, which is (d 1) or (d 2) or (d 3) or (d 4) as follows:

(d1) Screening the medicine for treating cataract;

(d2) Evaluating the drug effect of the cataract drug;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of cataract;

(d4) The pathogenesis of cataract is studied.

Any one of the pigs may be a Yuanjiang fragrant pig.

Any one of the above cataracts is caused by a mutation in the CRYBB2 gene.

Pig CRYBB2 gene information: encodes beta-crystallin B2; is located on chromosome 14; geneID is 100736784, sus scrofa.

The amino acid sequence of the pig CRYBB2 gene code is shown as SEQ ID NO: shown in fig. 8.

The pig CRYBB2 gene has the nucleotide sequence shown in SEQ ID NO:9, or a fragment of DNA as set forth in seq id no.

Any of the above cataracts may be congenital cataracts.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate. Pigs are therefore very suitable animals as models for human diseases.

(2) The vector constructed by the invention uses a strong promoter T7-lac which can express target protein with high efficiency to express the target protein, and uses a signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein to a bacterial periplasm cavity, so that the target protein is separated from the bacterial intracellular protein and is expressed in a soluble way. Meanwhile, the thioredoxin TrxA and the Cas9 protein are fused and expressed, the TrxA can help the coexpressed target protein to form a disulfide bond, the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased. In order to facilitate the purification of the target protein, the His tag is designed, and the target protein can be purified through one-step Ni column affinity chromatography, so that the purification process of the target protein is greatly simplified. Meanwhile, an enterokinase enzyme cutting site is designed behind the His tag, so that the fused TrxA-His polypeptide fragment can be conveniently cut off, and the Cas9 protein in a natural form can be obtained. After the fusion protein is digested by the enterokinase enzyme with the His label, the TrxA-His polypeptide fragment and the enterokinase with the His label can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of the target protein caused by multiple times of purification and dialysis are avoided. Meanwhile, an NLS site is respectively designed at the N end and the C end of the Cas9, so that the Cas9 can more effectively enter a cell nucleus for gene editing. In addition, the E.coli BL21 (DE 3) strain is selected as a target protein expression strain, and the strain can efficiently express and clone a foreign gene of an expression vector (such as pET-32 a) containing a bacteriophage T7 promoter. Meanwhile, as for the codon of the Cas9 protein, the codon optimization is carried out, so that the codon preference of the expression strain is completely adapted, and the expression level of the target protein is improved. In addition, after the bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by inducing the expression at low temperature. Through the optimization design and experimental implementation, the activity of the obtained Cas9 protein is remarkably improved compared with that of a commercial Cas9 protein.

(3) The gene editing is carried out by combining the Cas9 high-efficiency protein constructed and expressed by the invention with the gRNA transcribed in vitro, and the optimal dosage ratio of the Cas9 and the gRNA is optimized, so that the ratio of the obtained gene editing single-cell clone is up to 89.1 percent and is far higher than the conventional gene editing efficiency (10-30 percent).

(4) The invention adopts the combination of double gRNAs for mutation, and can effectively reduce the generation of non-frameshift mutation compared with the single gRNA. If a single gRNA is used to mutate a target gene, there is a 1/3 probability of generating a non-frameshift mutation of the base in random repair of non-homologous end joining (NHEJ) of the DNA, and the non-frameshift mutation is likely to fail to destroy the function of the target gene and fail to achieve the intended goal of inactivating the target gene. When the double gRNA is used for cutting and mutating the target gene, a fragment can be removed from the target gene, and the fragment deletion frame shift mutation of the target gene can be effectively generated by designing a base fragment with non-3 times removed. In addition, the double gRNAs can cause theoretical fragment deletion, and the situation of respectively and independently cutting single gRNA also exists, so that the gene mutation efficiency is greatly increased.

(5) The cloned pig with the knocked-out target gene can be directly obtained by cloning somatic cell nuclear transfer animals by using the obtained single cell cloned strain with the knocked-out target gene, and the gene variation can be stably inherited.

The method for embryo transplantation after injecting gene editing materials into germ cells in micro-injection in mouse model production is not suitable for producing large animal (such as pig) models with longer gestation period because the probability of directly obtaining gene mutation offspring is lower and the offspring hybridization breeding is needed. Therefore, the method adopts the primary cell in-vitro editing with great technical difficulty and high challenge, the double gRNA cutting and the screening of the positive editing single cell clone, and the corresponding disease model pig is directly obtained through the somatic cell nuclear transfer animal cloning technology in the later stage, so that the model pig manufacturing period can be greatly shortened, and the manpower, material resources and financial resources are saved.

According to the invention, CRYBB2 gene is knocked out by combining CRISPR/Cas9 technology with double gRNA editing, the genetic characteristic of natural onset of cataract is simulated, single cell clone knocked out by the CRYBB2 gene is obtained, and a foundation is laid for breeding cataract model pigs by somatic cell nuclear transfer animal cloning technology in the later stage. The invention is helpful for researching and disclosing the pathogenesis of cataract caused by CRYBB2 gene dysfunction, can also be used for researching drug screening, drug effect evaluation, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and further provides powerful experimental means for successfully treating human cataract. The invention has great application value for researching and developing cataract drugs and revealing pathogenesis of cataract.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pET-32 a.

FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE4.

FIG. 3 is an electrophoretogram of the optimized dosage ratio of gRNA and NCN protein in example 3.

Fig. 4 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 3.

FIG. 5 is an electrophoretogram of PCR amplification using different primer pairs using ear tissue-extracted genomes of swine designated as 1 as templates in example 4.

FIG. 6 is an electrophoretogram of PCR amplification in example 4 using 18 pig genomic DNAs as templates and a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526, respectively.

FIG. 7 is an electropherogram comparing the editing efficiency of different target combinations in example 4.

FIG. 8 is an alignment of reverse sequencing of single cell clone number 6 with the wild type sequence.

FIG. 9 is an alignment of reverse sequencing of single cell clone numbered 3 with the wild type sequence.

FIG. 10 is a forward and reverse sequencing of single cell clone numbered 5 aligned simultaneously with the wild type sequence.

FIG. 11 is an alignment of reverse sequencing of single cell clone number 2 with the wild type sequence.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. The commercial Cas9-a protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃ C., 5% CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in the examples were all prepared from porcine ear tissue, which was freshly obtained from Jiangxiang pigs. The method for preparing the primary pig fibroblast comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging 500g for 5min, and removing the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, spreading into a 10cm diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:2, respectively. SEQ ID NO:2, nucleotides 395 to 680 form a CMV enhancer, nucleotides 682 to 890 form an EF1a promoter, nucleotides 986 to 1006 encode a Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 encode a Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 encode a Cas9 protein, nucleotides 5162 to 5209 encode a Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 encode a Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 encode a self-cleaving polypeptide P2A (the amino acid sequence from the cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage site from the cleavage is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotides 5333 to 6046 encode an EGFP protein, nucleotides 6056 to 6109 encode a self-cleaving polypeptide T2A (the amino acid sequence from the cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", the cleavage site from the cleavage site is between the first amino acid residue and the second amino acid residue from the C-terminus), nucleotides 6056 to 6109 encode a self-cleaving polypeptide T2A (the amino acid sequence from the cleavage site T2A is "EGRGSLLTCGDVEENPGP", nucleotides 677647 to 6773, nucleotides) constitute a Pu bug element, and nucleotides 677647, short. SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) with about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.

Example 1 construction of prokaryotic Cas9 high-efficiency expression vector

The structure of plasmid pET-32a is schematically shown in FIG. 1.

The plasmid pKG-GE4 is obtained by modifying a plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short), as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 2.

SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) ₆ Tag), 5638-5652 nucleotides encode enterokinase cleavage site (EK cleavage site), 5656-5670 nucleotides encode nuclear localization signal, 5701-9801 nucleotides encode spCas9 protein, 9802-9849 nucleotides encode nuclear localization signal, and 9902-9949 nucleotides constitute T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.

The main modifications of plasmid pKG-GE4 are as follows: (1) the encoding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide before a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cut by prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag after the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding the coding sequence of an enterokinase enzyme cutting site DDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of the coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for being expressed by an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.

The fusion gene in the plasmid pKG-GE4 is shown as SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, and SEQ ID NO: the protein shown in 3 is named NCN protein.

Example 2 preparation and purification of NCN protein

1. Inducible expression

1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.

3. Inoculating the bacterial liquid obtained in the step 2 to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD _600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to the system to give a concentration of 0.5mM, and the system was cultured at 25 ℃ for 12 hours with shaking at 230rpm, and then centrifuged at 4 ℃ for 15 minutes at 10000g, and the cells were collected.

4. The cells obtained in step 3 were washed with PBS buffer.

2. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

1. And (3) adding the crude extraction buffer solution into the thallus obtained in the step one, suspending the thallus, then crushing the thallus by using a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernatant, filtering the supernatant by using a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus.

Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH ₂ O。

2. The fusion protein was purified by affinity chromatography.

Firstly, balancing a Ni-NTA agarose column by using a balancing solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Ni-NTA agarose column: kinseri, L00250/L00250-C, 10ml of packing.

Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH ₂ O。

Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH ₂ O。

Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH ₂ O。

3. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

1. 15ml of the post-column solution collected in step two was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, 15ml capacity) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.

2. Providing commercial source with His ₆ Tagged recombinant bovine enterokinase (biol. C620031, recombinant bovine enterokinase light chain with His ₆ The tag, recombinant Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.

3. The solution (about 6 ml) that completed step 2 was taken, mixed with 480. Mu.l of Ni-NTA resin (Kinseri, L00250/L00250-C), mixed well by rotation at room temperature for 15min, then centrifuged at 7000g for 3min, and the supernatant (4-5.5 ml) was collected.

4. And (3) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), adding the concentrated solution into an enzyme stock solution, and adjusting the protein concentration to be 5mg/ml to obtain the NCN protein solution.

And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, i.e., the NCN protein.

The NCN proteins used in the subsequent examples were all provided by NCN protein solutions.

Enzyme stock solution (ph 7.4): containing 10mM Tris,300mMNaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, the balance ddH ₂ O。

Example 3 Performance of NCN protein

The 2 gRNA targets targeting the TTN gene were selected as follows:

TTN-gRNA1：AGAGCACAGTCAGCCTGGCG；

TTN-gRNA2：CTTCCAGAATTGGATCTCCG。

primers used to identify target fragments comprising grnas in the TTN gene were as follows:

TTN-F55：TACGGAATTGGGGAGCCAGCGGA；

TTN-R560：CAAAGTTAACTCTCTGTGTCT。

1. preparation of gRNA

1. Preparing TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.

The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.

2. In vitro transcription to obtain gRNA

Taking TTN-T7-gRNA1 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is single-stranded RNA, shown in SEQ ID NO: and 6.

Taking TTN-T7-gRNA2 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: shown at 7.

2. gRNA and NCN protein dosage ratio optimization

1. Co-transfected porcine primary fibroblasts

A first group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.

Second group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.

Third group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

And a fourth group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 million porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.

And a fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested and collected with trypsin, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 3. The 505bp band is a wild-type band (WT), and the about 254bp band (the wild-type band is 505bp theoretically deleted by 251 bp) is a deletion mutant band (MT).

Gene deletion mutation efficiency = (MT grayscale/MT band bp number)/(WT grayscale/WT band bp number + MT grayscale/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. Group five was not mutated.

The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, the actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN protein was determined to be 1 μ g:1 μ g:4 μ g.

3. Comparison of Gene editing efficiency of NCN protein with that of the commercial Cas9 protein

1. Co-transfected porcine primary fibroblasts

Cas9-a group: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-A protein into a pig primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.

pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

Cas9-B set: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-B protein into a porcine primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.

Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 4. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.

The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.

Example 4 screening of efficient gRNA target combinations of CRYBB2 genes

Pig CRYBB2 gene information: encodes beta-crystallin B2; is located on chromosome 14; geneID is 100736784, sus scrofa. The amino acid sequence of the protein coded by the pig CRYBB2 gene is shown as SEQ ID NO: shown in fig. 8. In the pig genome DNA, the CRYBB2 gene has 7 exons, and the nucleotide sequences of the 4 th exon and the 400bp of the exon and the upstream and the downstream thereof are shown as SEQ ID NO: shown at 9.

1. Conservation analysis of preset deletion region and adjacent genome sequence of CRYBB2 gene

18 newborn Jiangxiang pigs, 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 respectively) and 8 males (named A, B, C, D, E, F, G, H respectively).

CRYBB2-E4g-JDF100：AGGATCTCCAAGTCCCCATTCAT；

CRYBB2-E4g-JDR463：AGCACAAGCTCTCCATATGCTAC；

CRYBB2-E4g-JDF45：TCAGACTTTATATTTGGTTCCT；

CRYBB2-E4g-JDR526：CCAACCTCACTCAGCCAGACGT。

The porcine ear tissue designated 1 was used to extract the genome as a template, PCR amplified with different primer pairs, and then subjected to 1% agarose gel electrophoresis. The electrophoretogram is shown in FIG. 5. In fig. 5: group 1: a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526 is adopted; group 2: a primer pair formed by CRYBB2-E4g-JDF45 and CRYBB2-E4g-JDR 526; group 3: a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR463 is adopted; group 4: a primer pair consisting of CRYBB2-E4g-JDF45 and CRYBB2-E4g-JDR463 is adopted. The result shows that the primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526 is preferably adopted for carrying out the amplification of the target fragment.

The genomic DNA of 18 pigs is respectively used as a template, PCR amplification is carried out by adopting a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526, and then 1% agarose gel electrophoresis is carried out. The electrophoretogram is shown in FIG. 6. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the CRYBB2 gene sequence in the public database. A common conserved region in 18 pigs is selected for designing a gRNA target.

2. Screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 6 targets from the NGG through a preliminary experiment.

The 6 targets are respectively as follows:

CRYBB2-E4-gRNA1：GAGACGGGAGTGGAGAAGGC；

CRYBB2-E4-gRNA2：GCCCGTTGAGCTCATGCGAG；

CRYBB2-E4-gRNA3：GTCTCCTTCAGGTTGGGGCA；

CRYBB2-E4-gRNA4：CGGGCCCTGCCCCAACCTGA；

CRYBB2-E4-gRNA5：CAACCTGAAGGAGACGGGAG；

CRYBB2-E4-gRNA6：GAAGGAGACGGGAGTGGAGA。

3. preparation of gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

CRYBB2-E4-gRNA1-S and CRYBB2-E4-gRNA1-A are respectively synthesized, and then are mixed and annealed to obtain double-stranded DNA molecules with sticky ends. A double-stranded DNA molecule with a sticky end is connected with a vector skeleton to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 1). The plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 1) expresses the nucleotide sequence shown in SEQ ID NO:10 sgRNA _{CRYBB2-E4-gRNA1} 。

sgRNA _{CRYBB2-E4-gRNA1} (SEQ ID NO：10)：

GAGACGGGAGUGGAGAAGGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

Respectively synthesizing CRYBB2-E4-gRNA2-S and CRYBB2-E4-gRNA2-A, then mixing and annealing to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 2). Plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 2) expresses SEQ ID NO:11 sgRNA _{CRYBB2-E4-gRNA2} 。

sgRNA _{CRYBB2-E4-gRNA2} (SEQ ID NO：11)：

GCCCGUUGAGCUCAUGCGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

Respectively synthesizing CRYBB2-E4-gRNA3-S and CRYBB2-E4-gRNA3-A, then mixing and annealing to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 3). The plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 3) expresses the nucleotide sequence shown in SEQ ID NO:12 sgRNA _{CRYBB2-E4-gRNA3} 。

sgRNA _{CRYBB2-E4-gRNA3} (SEQ ID NO：12)：

GUCUCCUUCAGGUUGGGGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

Respectively synthesizing CRYBB2-E4-gRNA4-S and CRYBB2-E4-gRNA4-A, then mixing and annealing to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector skeleton to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 4). The plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 4) expresses the nucleic acid sequence shown in SEQ ID NO:13 sgRNA _{CRYBB2-E4-gRNA4} 。

sgRNA _{CRYBB2-E4-gRNA4} (SEQ ID NO：13)：

CGGGCCCUGCCCCAACCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

Respectively synthesizing CRYBB2-E4-gRNA5-S and CRYBB2-E4-gRNA5-A, then mixing and annealing to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 5). The plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 5) expresses the nucleic acid sequence shown in SEQ ID NO:14 sgRNA _{CRYBB2-E4-gRNA5} 。

sgRNA _{CRYBB2-E4-gRNA5} (SEQ ID NO：14)：

CAACCUGAAGGAGACGGGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

CRYBB2-E4-gRNA6-S and CRYBB2-E4-gRNA6-A are respectively synthesized, and then are mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule with the cohesive end is connected with a vector framework to obtain a plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 6). The plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 6) expresses the nucleic acid sequence shown in SEQ ID NO:15 sgRNA _{CRYBB2-E4-gRNA6} 。

sgRNA _{CRYBB2-E4-gRNA6} (SEQ ID NO：15)：

GAAGGAGACGGGAGUGGAGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

CRYBB2-E4-gRNA1-S：caccGAGACGGGAGTGGAGAAGGC；

CRYBB2-E4-gRNA1-A：aaacGCCTTCTCCACTCCCGTCTC；

CRYBB2-E4-gRNA2-S：caccGCCCGTTGAGCTCATGCGAG；

CRYBB2-E4-gRNA2-A：aaacCTCGCATGAGCTCAACGGGC；

CRYBB2-E4-gRNA3-S：caccGTCTCCTTCAGGTTGGGGCA；

CRYBB2-E4-gRNA3-A：aaacTGCCCCAACCTGAAGGAGAC；

CRYBB2-E4-gRNA4-S：caccgCGGGCCCTGCCCCAACCTGA；

CRYBB2-E4-gRNA4-A：aaacTCAGGTTGGGGCAGGGCCCGc。

CRYBB2-E4-gRNA5-S：caccgCAACCTGAAGGAGACGGGAG；

CRYBB2-E4-gRNA5-A：aaacCTCCCGTCTCCTTCAGGTTGc；

CRYBB2-E4-gRNA6-S：caccGAAGGAGACGGGAGTGGAGA；

CRYBB2-E4-gRNA6-A：aaacTCTCCACTCCCGTCTCCTTC。

CRYBB2-E4-gRNA1-S, CRYBB2-E4-gRNA1-A, CRYBB-E4-gRNA 2-S, CRYBB-E4-gRNA 2-A, CRYBB-E4-gRNA 3-S, CRYBB-E4-gRNA 3-A, CRYBB2-E4-gRNA4-S, CRYBB-E4-gRNA 4-A, CRYBB-E4-gRNA 5-S, CRYBB2-E4-gRNA5-A, CRYBB2-E4-gRNA6-S, CRYBB z5262-E4-gRNA 6-A are single-stranded DNA molecules.

4. Comparison of editing efficiency for different target combinations

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 1) and the plasmid pKG-GE3 are co-transfected into the primary fibroblast of the pig. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 1): 1.08. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 2) and the plasmid pKG-GE3 are co-transfected into the primary fibroblast of the pig. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 2): 1.08. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 3) and the plasmid pKG-GE3 are co-transfected into the primary fibroblast of the pig. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 3): 1.08. Mu.g of plasmid pKG-GE3.

And a fourth group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 4) and the plasmid pKG-GE3 transfect primary pig fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3.

And a fifth group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 5) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 5): 1.08. Mu.g of plasmid pKG-GE3.

A sixth group: the plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 6) and the plasmid pKG-GE3 are co-transfected into the primary fibroblast of the pig. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (CRYBB 2-E4-gRNA 6): 1.08. Mu.g of plasmid pKG-GE3.

A seventh group: carrying out electrotransformation operation on primary pig fibroblasts with the same electrotransformation parameters and without plasmids.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After the completion of step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing with a new complete culture solution. The total time of incubation after electroporation was 48 hours.

3. After step 2 was completed, cells were digested and collected with trypsin, lysed, genomic DNA was extracted, PCR amplified with a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526, and then subjected to 1% agarose gel electrophoresis. And detecting the mutation of the target gene of the cell, and an electrophoresis chart is shown in figure 7.

And cutting and recovering the target product, sending the target product to a sequencing company for sequencing, and analyzing a sequencing peak map by using a webpage version Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first to sixth groups were 13%, 22%, 46%, 8%, 17%, and 35% in this order, and no gene editing occurred in the seventh group. The result shows that the editing efficiency of the CRYBB2-E4-gRNA3 and the CRYBB2-E4-gRNA6 is higher.

Example 5 preparation of CRYBB2 Gene-knocked-out Single cell clone from Jiangxiang pig

Two high-efficiency gRNA targets (CRYBB 2-E4-gRNA3 and CRYBB2-E4-gRNA 6) screened in the embodiment 4 are selected.

1. Preparation of gRNA

1. Preparing a CRYBB2-T7-gRNA3 transcription template and a CRYBB2-T7-gRNA6 transcription template

The CRYBB2-T7-gRNA3 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 16.

The CRYBB2-T7-gRNA6 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 17.

2. In vitro transcription to obtain gRNA

Taking a CRYBB2-T7-gRNA3 Transcription template, carrying out in vitro Transcription by adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then using MEGA clear ^TM The CRYBB2-gRNA3 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). CRYBB2-gRNA3 is single-stranded RNA, and is shown as SEQ ID NO:18, respectively.

CRYBB2-gRNA3(SEQ ID NO：18)：

GGGUCUCCUUCAGGUUGGGGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

Taking a CRYBB2-T7-gRNA6 Transcription template, and adopting a Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to perform in vitro TranscriptionTranscribing, then cleaning with MEGA ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain CRYBB2-gRNA6. The CRYBB2-gRNA6 is single-stranded RNA, and is shown as SEQ ID NO:19, respectively.

CRYBB2-gRNA6(SEQ ID NO：19)：

GGGAAGGAGACGGGAGUGGAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

2. Transfection of porcine primary fibroblasts

1. Co-transfecting the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein into the primary pig fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g CRYBB2-gRNA3:1 μ g CRYBB2-gRNA6: mu.g NCN protein. Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 100. Mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and harvested (approximately 2/3 of the resulting cells per well were plated into 6-well plates containing complete medium, and the remaining 1/3 were harvested in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 80% confluency, trypsinized and collected, and the cells were cryopreserved using cell cryopreserving (90% complete medium +10% dmso by volume).

6. And (4) taking the centrifuge tube in the step (4), taking cells, carrying out cell lysis and extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of CRYBB2-E4g-JDF100 and CRYBB2-E4g-JDR526, and then carrying out electrophoresis. Porcine primary fibroblasts were used as wild type control (WT).

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

The sequencing result of the pig primary fibroblast cell is only one, and the genotype of the pig primary fibroblast cell is a wild type (also called a homozygous wild type). If the sequencing result of a single-cell clone has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is heterozygote; if the sequencing result of one single-cell clone is two types, the two types of single-cell clones are mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary porcine fibroblast, and the genotype of the single-cell clone is a biallelic different mutant type; if the sequencing result of a single-cell clone is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is a biallelic identical mutant; if the sequencing result of a single cell clone is one and is consistent with the sequencing result of a pig primary fibroblast, the genotype of the single cell clone is a wild type (also called a homozygous wild type).

The results are shown in Table 1. The genotypes of the single cell clones numbered 6, 19, 26, 36, 44 were wild-type. The genotypes of the single cell clones numbered 3, 4, 9, 11, 14, 18, 21, 30, 32, 37, 41, 46 were heterozygous. The genotypes of the single cell clones numbered 1, 5, 10, 12, 16, 17, 22, 24, 25, 27, 29, 31, 33, 34, 35, 38, 40, 42, 43, 45 are biallelic different mutants. The genotypes of the single cell clones numbered 2, 7, 8, 13, 15, 20, 23, 28, 39 are biallelic identical mutants. The rate of single cell clones resulting from the editing of the CRYBB2 gene was 89.1%.

Exemplary sequencing alignments are shown in figures 8 to 11. FIG. 8 shows the alignment of forward sequencing of single-cell clone No. 6 with the wild-type sequence, and the result was judged to be wild-type. FIG. 9 shows the result of alignment of forward sequencing of single-cell clone No. 3 with the wild-type sequence, and it was judged as heterozygous. FIG. 10 is a sequence alignment of forward and reverse sequencing of single cell clone No. 5 with the wild type sequence, as a biallelic different mutant. FIG. 11 is a alignment of forward sequencing of single cell clone number 2 with the wild type sequence, showing biallelic identity mutation.

TABLE 1 genotype determination of single cell clones edited by the CRYBB2 Gene

The single clone cells of the heterozygote type, the variant type with different double alleles and the variant type with the same double alleles can be used for subsequent clone pig production. The cells are used as nuclear transplantation donor cells to carry out somatic cell cloning, and cloned pigs, namely cataract model pigs, can be obtained.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> method and system for constructing congenital cataract disease model pig nuclear transplantation donor cell with CRYBB2 gene mutation

<130> GNCYX212297

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 9974

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600

gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660

ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720

agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780

agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840

tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900

tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960

cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020

aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080

tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140

tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200

ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260

ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320

cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380

gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440

actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500

aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560

caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620

aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680

accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740

aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800

ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860

agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920

accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980

gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040

tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100

cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160

cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220

cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400

gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460

tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520

cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580

gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640

gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700

catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760

tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820

ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880

tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940

ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000

aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060

gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120

tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180

acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240

cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300

cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360

gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420

cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480

gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540

tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600

atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660

tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720

gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780

tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840

cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900

tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960

atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020

atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080

tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140

cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200

aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260

ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320

tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380

tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440

gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500

gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560

gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620

ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680

taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740

ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800

atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860

tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920

gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980

gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040

aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100

cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160

ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220

actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280

aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340

atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400

gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460

aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520

aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580

ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640

gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700

gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760

actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820

tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880

acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940

ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000

gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060

attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120

ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180

atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240

gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300

aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360

ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420

atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480

gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540

atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600

ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660

attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720

cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780

tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840

aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900

cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960

atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020

aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080

ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140

gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200

ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260

aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320

ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380

aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440

ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500

aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560

accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620

ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680

ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740

ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800

ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860

gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920

aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980

gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040

aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100

gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160

atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220

gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280

aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340

tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400

aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460

gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520

aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580

ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640

caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700

ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760

atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820

attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880

ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940

accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000

accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060

cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120

tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180

gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240

ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300

agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360

aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420

tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480

cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540

ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600

atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660

gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720

gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780

ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840

aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900

actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960

aactatatcc ggat 9974

<210> 2

<211> 1547

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr

1 5 10 15

Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp

20 25 30

Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp

35 40 45

Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu

50 55 60

Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu

65 70 75 80

Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly

85 90 95

Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys

100 105 110

Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn

115 120 125

Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp

130 135 140

Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly

145 150 155 160

Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr

165 170 175

Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser

180 185 190

Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys

195 200 205

Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala

210 215 220

Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn

225 230 235 240

Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val

245 250 255

Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu

260 265 270

Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu

275 280 285

Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys

290 295 300

Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala

305 310 315 320

Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp

325 330 335

Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val

340 345 350

Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly

355 360 365

Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg

370 375 380

Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu

385 390 395 400

Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys

405 410 415

Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp

420 425 430

Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln

435 440 445

Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu

450 455 460

Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu

465 470 475 480

Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr

485 490 495

Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu

500 505 510

Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly

515 520 525

Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu

530 535 540

Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp

545 550 555 560

Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln

565 570 575

Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe

580 585 590

Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr

595 600 605

Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg

610 615 620

Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn

625 630 635 640

Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu

645 650 655

Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro

660 665 670

Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr

675 680 685

Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser

690 695 700

Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg

705 710 715 720

Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu

725 730 735

Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala

740 745 750

Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp

755 760 765

Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu

770 775 780

Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys

785 790 795 800

Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg

805 810 815

Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly

820 825 830

Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser

835 840 845

Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser

850 855 860

Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly

865 870 875 880

Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile

885 890 895

Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys

900 905 910

Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg

915 920 925

Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met

930 935 940

Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys

945 950 955 960

Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu

965 970 975

Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp

980 985 990

Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser

995 1000 1005

Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp

1010 1015 1020

Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys

1025 1030 1035 1040

Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr

1045 1050 1055

Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser

1060 1065 1070

Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg

1075 1080 1085

Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr

1090 1095 1100

Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr

1105 1110 1115 1120

Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr

1125 1130 1135

Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu

1140 1145 1150

Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu

1155 1160 1165

Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met

1170 1175 1180

Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe

1185 1190 1195 1200

Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala

1205 1210 1215

Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr

1220 1225 1230

Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys

1235 1240 1245

Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln

1250 1255 1260

Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp

1265 1270 1275 1280

Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly

1285 1290 1295

Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val

1300 1305 1310

Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly

1315 1320 1325

Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe

1330 1335 1340

Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys

1345 1350 1355 1360

Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met

1365 1370 1375

Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro

1380 1385 1390

Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu

1395 1400 1405

Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln

1410 1415 1420

His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser

1425 1430 1435 1440

Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala

1445 1450 1455

Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile

1460 1465 1470

Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys

1475 1480 1485

Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu

1490 1495 1500

Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu

1505 1510 1515 1520

Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala

1525 1530 1535

Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

1540 1545

<210> 3

<211> 1399

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala

1 5 10 15

Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly

20 25 30

Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys

35 40 45

Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly

50 55 60

Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys

65 70 75 80

Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr

85 90 95

Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe

100 105 110

Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His

115 120 125

Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His

130 135 140

Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser

145 150 155 160

Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met

165 170 175

Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp

180 185 190

Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn

195 200 205

Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys

210 215 220

Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu

225 230 235 240

Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu

245 250 255

Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp

260 265 270

Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp

275 280 285

Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu

290 295 300

Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile

305 310 315 320

Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met

325 330 335

Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala

340 345 350

Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp

355 360 365

Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln

370 375 380

Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly

385 390 395 400

Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys

405 410 415

Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly

420 425 430

Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu

435 440 445

Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro

450 455 460

Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met

465 470 475 480

Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val

485 490 495

Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn

500 505 510

Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu

515 520 525

Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr

530 535 540

Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys

545 550 555 560

Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val

565 570 575

Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser

580 585 590

Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr

595 600 605

Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn

610 615 620

Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu

625 630 635 640

Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His

645 650 655

Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr

660 665 670

Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys

675 680 685

Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala

690 695 700

Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys

705 710 715 720

Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His

725 730 735

Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile

740 745 750

Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg

755 760 765

His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr

770 775 780

Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu

785 790 795 800

Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val

805 810 815

Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln

820 825 830

Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu

835 840 845

Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp

850 855 860

Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly

865 870 875 880

Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn

885 890 895

Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe

900 905 910

Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys

915 920 925

Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys

930 935 940

His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu

945 950 955 960

Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys

965 970 975

Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu

980 985 990

Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val

995 1000 1005

Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val

1010 1015 1020

Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser

1025 1030 1035 1040

Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn

1045 1050 1055

Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile

1060 1065 1070

Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val

1075 1080 1085

Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met

1090 1095 1100

Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe

1105 1110 1115 1120

Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala

1125 1130 1135

Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro

1140 1145 1150

Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys

1155 1160 1165

Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met

1170 1175 1180

Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys

1185 1190 1195 1200

Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr

1205 1210 1215

Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala

1220 1225 1230

Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val

1235 1240 1245

Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro

1250 1255 1260

Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr

1265 1270 1275 1280

Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile

1285 1290 1295

Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His

1300 1305 1310

Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe

1315 1320 1325

Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr

1330 1335 1340

Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala

1345 1350 1355 1360

Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp

1365 1370 1375

Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala

1380 1385 1390

Gly Gln Ala Lys Lys Lys Lys

1395

<210> 4

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 5

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 6

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 7

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 8

<211> 205

<212> PRT

<213> Sus scrofa

<400> 8

Met Ala Ser Asp His Gln Thr Gln Ala Gly Lys Pro Gln Pro Leu Asn

1 5 10 15

Pro Lys Ile Ile Ile Phe Glu Gln Glu Asn Phe Gln Gly His Ser His

20 25 30

Glu Leu Asn Gly Pro Cys Pro Asn Leu Lys Glu Thr Gly Val Glu Lys

35 40 45

Ala Gly Ser Val Leu Val Gln Ala Gly Pro Trp Val Gly Tyr Glu Gln

50 55 60

Ala Asn Cys Lys Gly Glu Gln Phe Val Phe Glu Lys Gly Glu Tyr Pro

65 70 75 80

Arg Trp Asp Ser Trp Thr Ser Ser Arg Arg Thr Asp Ser Leu Ser Ser

85 90 95

Leu Arg Pro Ile Lys Val Asp Ser Gln Glu His Lys Ile Ile Leu Tyr

100 105 110

Glu Asn Pro Asn Phe Thr Gly Lys Lys Met Glu Val Ile Asp Asp Asp

115 120 125

Val Pro Ser Phe His Ala His Gly Tyr Gln Glu Lys Val Ser Ser Val

130 135 140

Arg Val Gln Ser Gly Thr Trp Val Gly Tyr Gln Tyr Pro Gly Tyr Arg

145 150 155 160

Gly Leu Gln Tyr Leu Leu Glu Lys Gly Asp Tyr Lys Asp Ser Gly Asp

165 170 175

Phe Gly Ala Pro Gln Pro Gln Val Gln Ser Val Arg Arg Ile Arg Asp

180 185 190

Met Gln Trp His Gln Arg Gly Ala Phe His Pro Ser Asn

195 200 205

<210> 9

<211> 919

<212> DNA

<213> Sus scrofa

<400> 9

aaatagcatc agatgagttt gggctccagt ctcagttctg ctacttccac tcaggatctg 60

tagcactccc ttaactaagt acacctccca cacccagagc aaacatggta tgctaacaat 120

tatgctcctc tgagtccttc caacaaccct atgaggtagg ttctgctttt atttcctgct 180

ggggaaactg aggctcagag aggtaacatg ctggctccaa ggtctcagag ctggtaacaa 240

gagccaggag tgtcagactt tatatttggt tcctgattcc caaacgtgga atccttcagc 300

atccttcgag gatctccaag tccccattca tcccactgcc ctgctctcca tcctccccat 360

catgttgggg gtctgactct cttctctctt cctgttgcag atcatcatct ttgagcagga 420

gaactttcag ggccactcgc atgagctcaa cgggccctgc cccaacctga aggagacggg 480

agtggagaag gcaggctctg tcctggtgca ggctggaccg tatgtacctg ggggtcctct 540

cttggtcagg ggctgacagg gtgtggccat caggttgtgc agctggaggg atccactctc 600

actgagctcc tagaccatgc gattggggga ccaggatttg gggtcccagt agcatatgga 660

gagcttgtgc tttgaggtcc aatagagtca ggctcaaatc ctggttccac cacgtctggc 720

tgagtgaggt tggaccagga acttccctct ctgagcttag gttgcctcct gtgtaggatg 780

aggatagcca gtcctccttg ggatgaaggg atggagttaa tgtggaaagc ctggcaccaa 840

ggtcagccac atccttgagg caggaagatg gatgtgtgac tcccatggac ctttttagag 900

ctgccaatct ctggctctg 919

<210> 10

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gagacgggag uggagaaggc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcccguugag cucaugcgag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 12

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gucuccuuca gguuggggca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgggcccugc cccaaccuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caaccugaag gagacgggag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaaggagacg ggaguggaga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 16

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

atagggtctc cttcaggttg gggcagtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 17

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

atagggaagg agacgggagt ggagagtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 18

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gggucuccuu cagguugggg caguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 19

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gggaaggaga cgggagugga gaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims (14)

1. A kit comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein;

the CRYBB2-gRNA3 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:18, nucleotides 3 to 22; the CRYBB2-gRNA6 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:19 at nucleotides 3 to 22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

2. A kit comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and PRONCN protein;

the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1;

the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

3. A kit comprises CRYBB2-gRNA3, CRYBB2-gRNA6 and specific plasmids;

the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1;

the specific plasmid comprises the following elements from upstream to downstream in sequence: a promoter, an operator, a ribosome binding site, a PRONCN protein coding gene and a terminator; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

Application of CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein in preparation of a kit;

the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1; the NCN protein is the NCN protein described in claim 1;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

5, application of CRYBB2-gRNA3, CRYBB2-gRNA6 and PRONCN proteins in preparation of a kit;

the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1; the PRONCN protein is the PRONCN protein of claim 2;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

6, application of CRYBB2-gRNA3, CRYBB2-gRNA6 and the extraordinarily heterogeneous particles in preparation of the kit;

the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1; the specific plasmid is the specific plasmid as described in claim 3;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant cell; (b) preparing cataract model pig; (c) Preparing a cataract cell model or a cataract tissue model or a cataract organ model.

7. A method of making a recombinant cell comprising the steps of: co-transfecting pig cells with CRYBB2-gRNA3, CRYBB2-gRNA6 and NCN protein to obtain recombinant cells; the CRYBB2-gRNA3 is the CRYBB2-gRNA3 described in claim 1; the CRYBB2-gRNA6 is the CRYBB2-gRNA6 described in claim 1; the NCN protein is the NCN protein according to claim 1.

8. The method of claim 7, wherein: the proportions of the pig cells, the CRYBB2-gRNA3, the CRYBB2-gRNA6 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 0.8-1.2 μ g of CRYBB2-gRNA3:0.8-1.2 μ g CRYBB2-gRNA6: 3-5. Mu.g NCN protein.

9. The kit of claim 1 or the use of claim 4 or the method of claim 7 or 8, wherein: the NCN protein is shown as SEQ ID NO:3, respectively.

10. A kit or use or method as claimed in claim 9 wherein:

the preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain recombinant bacteria;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-D-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting the strain;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A tagged fusion protein;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence SEQ ID NO:1, nucleotide 5209-9852.

11. Recombinant cells produced by the method of claim 7 or 8 or 9.

12. Use of the recombinant cell of claim 11 for the preparation of cataract-model pigs.

13. Porcine tissue, porcine organ or porcine cells of a cataract-model pig prepared using the recombinant cells of claim 11.

14. The recombinant cell of claim 11, the porcine tissue of claim 13, the porcine organ of claim 13, the porcine cell of claim 13, or the cataract model pig prepared by using the recombinant cell of claim 11, wherein the recombinant cell is (d 1) or (d 2) or (d 3) or (d 4):

(d1) Screening the medicine for treating cataract;

(d2) Evaluating the drug effect of the cataract drug;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of cataract;

(d4) The pathogenesis of cataracts is studied.

Images