CN115247164A - Gene editing system for constructing adenomatous polyposis model pig and colorectal cancer model pig and application thereof - Google Patents

Abstract

The invention discloses a gene editing system for constructing an adenomatous polyposis model pig and a colorectal cancer model pig and application thereof. The present invention provides SEQ ID NO:18, APC-gRNA5, SEQ ID NO:19 APC-gRNA6 and NCN protein in the preparation of a kit. The invention also provides a method for preparing the recombinant cell: and co-transfecting the APC-gRNA5, the APC-gRNA6 and the NCN protein to a pig cell to obtain a recombinant cell. The recombinant cell is a recombinant cell with mutation of an APC gene. The application of the kit is as follows: preparing a recombinant cell; preparing an adenomatous polyposis model pig; preparing a cell model of adenomatous polyposis or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; preparing a colorectal cancer model pig; preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model. The invention has great application value for researching and developing medicaments for adenomatous polyposis and colorectal cancer and disclosing the pathogenesis of the diseases.

Description

Gene editing system for constructing adenomatous polyposis model pig and colorectal cancer model pig and application thereof

Technical Field

The invention belongs to the technical field of biology, particularly belongs to the technical field of gene editing, and more particularly relates to a gene editing system for constructing a adenomatosis polyposis model pig and a colorectal cancer model pig based on APC gene mutation and application thereof.

Background

Familial Adenomatous Polyposis (FAP) is an autosomal dominant disease characterized primarily by the growth of large numbers of adenomatous polyposis in the colon and rectum. The polyp that occurs is a precancerous lesion and is very likely to progress into cancer. FAP is common in young people, clinical symptoms begin to appear in adolescence of 15-25 years, and are most obvious in about 30 years. The FAP is divided into a severe type, an intermediate type and an attenuation type, wherein the severe type has a cancer rate of 100 percent, the attenuation type has a cancer rate of 69 percent, and the intermediate type is between the severe type, the intermediate type and the attenuation type. FAP is caused by mutation of the Adenomatous Polyposis Coli (APC) gene. The human APC gene is located in 5q21-q22, contains 8535 nucleotides, 15 coding exons and a 310kDa protein, contains 2843 amino acids, 75 percent of the coding sequence is located in the exon 15, and the exon is the most frequently occurring part of germ line mutation (referring to genetic gene mutation carried by germ cells) and systemic mutation (referring to somatic gene mutation). The APC gene belongs to a cancer suppressor gene, is a signal molecule in a Wnt signal transduction pathway, and negatively regulates the Wnt pathway by degrading beta-catenin. APC mutation leads to the increase of beta-catenin, which in turn promotes the interaction of beta-catenin and TCF, and up-regulates downstream target genes (such as cyclin D1 and Myc), driving tumor formation.

The mutation modes of the APC gene are numerous, and the most common mutation is the change of a gene sequence, so that a stop codon appears in advance, and a non-functional truncated protein is generated. Over 80% of FAP patients can detect mutated APC gene, and about 20% of patients have no mutation but have epigenetic modifications (such as methylation of CpG island) to make their promoters not normally expressed. A functional deficiency of a single allele of APC is sufficient to cause FAP to occur.

Colorectal Cancer (CRC) is one of the most common malignancies. In recent years, with the improvement of living standard, the incidence of colorectal cancer keeps rapidly increasing at home and abroad, and the health of human beings is seriously threatened. Gastric cancer has been surpassed in 2020, with the second highest incidence of cancer, and nearly 80% of patients are at a middle-to-advanced stage when they are found, with nearly half of them having a survival time of less than 5 years. Previous data indicate that most colorectal cancers begin in abnormal crypts and gradually develop into polyps, eventually progressing to colorectal cancer. The early symptoms are not obvious, and the symptoms such as defecation habit change, hematochezia, diarrhea and constipation alternation, local abdominal pain and the like are presented along with the increase of cancer, and the general symptoms such as anemia, weight loss and the like are presented at the late stage. The large-scale clinical trials jointly developed by 8 major hospitals in China show that: the colorectal cancer has a window period of more than 10 years, and if early diagnosis and early treatment are carried out, the survival rate can exceed 90 percent.

The cause of CRC is not well understood and there is now increasing evidence of association with genetic mutations, of which APC genetic mutations and their resulting FAP are considered to be the major driving cause for CRC development. The mutation of APC single allele germ line can cause FAP to the mutant gene carrier. Mutations in the germ line homozygous for the APC biallelic gene render the embryo lethal. FAP in turn predisposes the other normal APC allele of APC single allele mutation carriers to mutation in polypoma somatic cells, resulting in the carcinogenesis of polyposis, producing CRC. APC somatic mutations (APC somatic mutation refers to random mutation of one normal APC allele at the somatic level, and mutation of the other allele in an inherited abnormal APC germline, resulting in defects in both alleles) are found in 80-85% of CRC-shedding patient tumor tissues. Loss of heterozygosity (LOH) of an APC locus (loss of heterozygosity of an APC locus means that a normal APC allele fragment thereof is partially or completely deleted, resulting in the remaining of only another abnormal APC allele) is found in 30% -40% of CRC.

The existing research shows that the mutation of the APC gene is commonly found in FAP and CRC and is less common in other tumors, but the pathogenesis and the treatment method of the disease caused by the mutation of the APC gene are not clear, and the pathogenesis and the treatment method need to be carried out on the basis of an animal model. The current common animal model is a mouse model, however, the mouse is different from the human body in the aspects of body type, organ size, physiology, pathology and the like, and the normal physiological and pathological states of the human body cannot be simulated really. The pig as a large animal has the body size and physiological function similar to those of human, is easy to breed and feed in a large scale, has lower requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been under significant development in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, with CRISPR/Cas9 technology being the most advanced gene editing technology at present. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention aims to provide a gene editing system for constructing an adenomatosis polyposis model pig and a colorectal cancer model pig based on APC gene mutation and application thereof.

The invention provides application of APC-gRNA5, APC-gRNA6 and NCN proteins in preparation of a kit.

The invention also provides application of the APC-gRNA5, APC-gRNA6 and PRONCN proteins in preparation of the kit.

The invention also provides application of the APC-gRNA5, the APC-gRNA6 and the idiosyncratic particles in preparation of the kit.

The invention provides a kit which comprises APC-gRNA5, APC-gRNA6 and NCN protein.

The invention also provides a kit which comprises APC-gRNA5, APC-gRNA6 and PRONCN protein.

The invention also provides a kit which comprises APC-gRNA5, APC-gRNA6 and specific plasmids.

The invention provides a method for preparing recombinant cells, which comprises the following steps: and co-transfecting the APC-gRNA5, the APC-gRNA6 and the NCN protein to a pig cell to obtain a recombinant cell.

The co-transfection is specifically a shock transfection.

The parameter settings of the electroporation transfection can be specifically as follows: 1450V, 10ms, 3pulse.

The co-transfection may be specifically carried out using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer apparatus.

Any of the kits above further comprising porcine cells.

The use of any one of the above kits is (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing a cell model of adenomatous polyposis or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing colorectal cancer model pigs; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

The proportions of APC-gRNA5, APC-gRNA6 and NCN protein are as follows in sequence: 0.8-1.2 μ g APC-gRNA5:0.8-1.2 μ g APC-gRNA6: 3-5. Mu.g NCN protein.

The proportions of APC-gRNA5, APC-gRNA6 and NCN protein are as follows in sequence: 1 μ g APC-gRNA5:1 μ g APC-gRNA6: mu.g NCN protein.

The proportions of the pig cells, the APC-gRNA5, the APC-gRNA6 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 0.8-1.2 μ g APC-gRNA5:0.8-1.2 μ g APC-gRNA6: 3-5. Mu.g NCN protein.

The proportions of the pig cells, the APC-gRNA5, the APC-gRNA6 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 1 μ g APC-gRNA5:1 μ g APC-gRNA6: mu.g NCN protein.

Any one of the APC-gRNA5 described above is a sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:18 from nucleotide 3 to nucleotide 22.

Specifically, the APC-gRNA5 is shown as SEQ ID NO:18, respectively.

Specifically, the APC-gRNA5 is shown as SEQ ID NO: as shown at 14.

Any one of the APC-gRNA6 is sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:19 at nucleotides 3 to 22.

Specifically, the APC-gRNA6 is shown as SEQ ID NO:19, respectively.

Specifically, the APC-gRNA6 is shown as SEQ ID NO: shown at 15.

Any of the NCN proteins described above is a Cas9 protein or a fusion protein with a Cas9 protein.

Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.

Any one of the above porcine cells is a porcine fibroblast.

Any of the above porcine cells are porcine primary fibroblasts.

Any of the above porcine cells are porcine primary fibroblasts obtained from a primary pig.

The preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain recombinant bacteria;

(2) Culturing the recombinant bacteria by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-D-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting bacteria;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A fusion protein of the tag;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ Tag fusion protein, then removing His in the protein with Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, 5209 to 9852 th nucleotide.

The preparation method of the NCN protein specifically comprises the following steps:

(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and performing shake culture;

(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until OD is reached _600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;

(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);

(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;

(6) Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ A fusion protein of the tag (the fusion protein shown in SEQ ID NO: 2);

(7) Taking the post-column solution collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);

(8) Will have His ₆ Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;

(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;

(10) And (5) taking the supernatant obtained in the step (9), concentrating by using an ultrafiltration tube, and then adding the supernatant into an enzyme stock solution to obtain the NCN protein solution.

Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ The specific method of the labeled fusion protein is as follows:

firstly, balancing a Ni-NTA agarose column by using a balancing solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Any one of the PRONCN proteins sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.

The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The signal peptide of alkaline phosphatase is used to guide the secretory expression of the target protein into the bacterial periplasm cavity so as to be separated from the protein in the bacterial cell, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.

The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that helps to form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.

The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) ₆ Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.

The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, so that fused TrxA-His segment can be conveniently cut by enterokinase to obtain the Cas9 protein in a natural form. After the fusion protein is digested by using the commercial enterokinase with the His label, the TrxA-His section and the enterokinase with the His label can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of target protein caused by multiple times of purification and dialysis are avoided.

The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.

The Cas9 protein may be saCas9 or spCas9, preferably a spCas9 protein.

The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.

Any one of the above specific plasmids sequentially comprises the following elements from upstream to downstream: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.

The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.

The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose-induced expression, and IPTG can be used for inducing the expression of the target protein at low temperature after bacteria grow to a certain amount, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein can be obviously improved by inducing expression at low temperature.

The ribosome binding site is a ribosome binding site for protein translation, and is essential for protein translation.

The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevent other downstream sequences except the target gene from being transcribed and translated.

For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.

The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.

The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.

The ribosome binding site is shown as SEQ ID NO:1 from nucleotide 5178 to 5201.

The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotides 5209-5271.

The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.

The coding sequence of His-Tag is shown as SEQ ID NO:1 from nucleotide 5620 to 5637.

The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to nucleotide 5652.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.

The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 9802 to nucleotide 9849.

The T7 terminator is shown as SEQ ID NO: nucleotides 9902-9949 of 1.

Specifically, the specific plasmid is plasmid pKG-GE4.

Plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotides 5121-9949.

Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.

The invention also protects the recombinant cell prepared by any one of the methods.

The recombinant cell is a recombinant cell with mutated APC gene.

The recombinant cell is a single cell clone in which the APC gene is mutated and is heterozygous and non-3-fold mutated based on the genotype of the APC gene.

The recombinant cell may specifically be a single cell clone in which the genotype in table 1 is heterozygous and is not a 3-fold mutation.

Non-3-fold mutation means that deletion mutation and/or insertion mutation occur, and the number of nucleotides deleted and/or inserted is not a multiple of 3.

The invention also protects the application of the recombinant cell in preparing the adenomatous polyposis model pig.

The recombinant cell is used as a nuclear transplantation donor cell to carry out somatic cell cloning, so that a cloned pig, namely the adenomatous polyposis model pig can be obtained.

The invention also protects the pig tissue of a model pig prepared by using the recombinant cell, namely an adenomatous polyposis tissue model.

The invention also protects a pig organ of a model pig prepared by using the recombinant cell, namely an adenomatous polyposis organ model.

The invention also protects the pig cell of the model pig prepared by the recombinant cell, namely an adenomatous polyposis cell model.

The invention also protects the application of the recombinant cell, the adenomatous polyposis tissue model, the adenomatous polyposis organ model, the adenomatous polyposis cell model or the adenomatous polyposis model pig, which is (d 1) or (d 2) or (d 3) or (d 4) as follows:

(d1) Screening a medicine for treating adenomatosis polyposis;

(d2) Evaluating the drug effect of the adenomatous polyposis drug;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of adenomatous polyposis;

(d4) The pathogenesis of adenomatous polyposis was studied.

The invention also protects the application of the recombinant cell in preparing colorectal cancer model pigs.

And (3) taking the recombinant cell as a nuclear transplantation donor cell to clone a somatic cell to obtain a cloned pig, namely the colorectal cancer model pig.

And (3) taking the recombinant cell as a nuclear transplantation donor cell to clone a somatic cell to obtain a cloned pig, wherein the pig with colorectal cancer in the cloned pig is the colorectal cancer model pig.

The invention also protects pig tissues of the model pig prepared by the recombinant cells, namely a colorectal cancer tissue model.

The invention also protects a pig organ of a model pig prepared by using the recombinant cell, namely a colorectal cancer organ model.

The invention also protects pig cells of a model pig prepared by using the recombinant cells, namely a colorectal cancer cell model.

The invention also protects the application of the recombinant cell, the colorectal cancer tissue model, the colorectal cancer organ model, the colorectal cancer cell model or the colorectal cancer model pig, which is (e 1) or (e 2) or (e 3) or (e 4) as follows:

(e1) Screening a medicine for treating colorectal cancer;

(e2) Evaluating the drug effect of the colorectal cancer drug;

(e3) Evaluating the curative effect of gene therapy and/or cell therapy of colorectal cancer;

(e4) The pathogenesis of colorectal cancer is studied.

Any one of the above pigs may be a fragrant pig from Yangjiang.

Any one of the pigs may be a newborn Zingjiang Xiang pig.

Any of the adenomatous polyposis described above is caused by a mutation in the APC gene.

Any one of the adenomatous polyposis described above is familial adenomatous polyposis.

Any of the above colorectal cancers are caused by mutation of the APC gene and resulting adenomatous polyposis.

Any of the above colorectal cancers is familial colorectal cancer.

Pig APC gene information: encoding tumor suppressor protein APC; is located on chromosome 2; gene ID is 100517932, sus scrofa.

The amino acid sequence of the protein coded by the pig APC gene is shown as SEQ ID NO: shown in fig. 8.

The pig APC gene has the nucleotide sequence shown in SEQ ID NO:9, or a fragment thereof.

Any of the above mutations is a deletion and/or insertion and/or substitution of one or more nucleotides.

Any of the above mutations is a deletion of one or more nucleotides.

Any of the above mutations is an insertion of one or more nucleotides.

Any of the above mutations is a deletion and insertion of one or more nucleotides.

Any of the above mutations is a non-3-fold mutation.

Non-3-fold mutation means that deletion mutation and/or insertion mutation occur, and the number of nucleotides deleted and/or inserted is not a multiple of 3.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. As for large animals, primates are animals having a close relationship with humans, but they are small in size, mature late (starting mating at age 6-7), and are monozygotic animals, and they are extremely slow in population propagation speed and high in raising cost. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and breeding cost is much lower than that of the primate. Pigs are therefore very suitable animals as models for human disease.

(2) The vector constructed by the invention uses a strong promoter T7-lac which can express target protein with high efficiency to express the target protein, and uses a signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein to a bacterial periplasm cavity, so that the target protein is separated from the bacterial intracellular protein and is expressed in a soluble way. Meanwhile, the thioredoxin TrxA and the Cas9 protein are fused and expressed, the TrxA can help the coexpressed target protein to form a disulfide bond, the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased. In order to facilitate the purification of the target protein, the His tag is designed, and the target protein can be purified through one-step Ni column affinity chromatography, so that the purification process of the target protein is greatly simplified. Meanwhile, an enterokinase enzyme cutting site is designed behind the His tag, so that the fused TrxA-His polypeptide fragment can be conveniently cut off, and the Cas9 protein in a natural form can be obtained. After the fusion protein is digested by using the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of the target protein caused by multiple times of purification dialysis are avoided. Meanwhile, the invention also designs an NLS site at the N end and the C end of the Cas9 respectively, so that the Cas9 can enter the cell nucleus more effectively for gene editing. In addition, the E.coli BL21 (DE 3) strain is selected as a target protein expression strain, and the strain can efficiently express and clone a foreign gene of an expression vector (such as pET-32 a) containing a bacteriophage T7 promoter. Meanwhile, as for the codon of the Cas9 protein, the codon optimization is carried out, so that the codon preference of the expression strain is completely adapted, and the expression level of the target protein is improved. In addition, after the bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by inducing the expression at low temperature. Through the optimization design and experimental implementation, the activity of the obtained Cas9 protein is remarkably improved compared with that of a commercial Cas9 protein.

(3) The gene editing is carried out by combining the Cas9 high-efficiency protein constructed and expressed by the invention with the gRNA transcribed in vitro, and the optimal dosage ratio of the Cas9 and the gRNA is optimized, so that the ratio of the obtained single cell clone for gene editing is up to 85.7 percent and is far higher than the conventional gene editing efficiency (10-30 percent).

(4) The cloned pig with the knocked-out target gene can be directly obtained by cloning somatic cell nuclear transfer animals by using the obtained single cell cloned strain with the knocked-out target gene, and the gene variation can be stably inherited.

The method for embryo transplantation after injecting gene editing materials into fertilized eggs in the mouse model making is not suitable for making large animal (such as pig) models with longer gestation period because the probability of directly obtaining gene mutation offspring is lower, and the offspring hybridization breeding is needed. Therefore, the method adopts the primary cell in-vitro editing with great technical difficulty and high challenge, the method for cutting the Cas9 protein and the double gRNA and screening the positive editing single cell clone, and the corresponding disease model pig is directly obtained by the somatic cell nuclear transfer animal cloning technology in the later stage, so that the model pig manufacturing period can be greatly shortened, and the labor, the material resources and the financial resources are saved.

According to the invention, the CRISPR/Cas9 technology and double gRNA editing are combined to knock out the APC gene, the natural pathogenesis genetic characteristic of FAP is simulated, the single cell clone with the APC gene knock-out is obtained, and a foundation is laid for breeding FAP model pigs by somatic cell nuclear transfer animal cloning technology in the later stage. Since mutation of the APC gene and the resulting FAP are considered to be the main driving cause of CRC, the cloned pig also partially progresses to colorectal cancer and can be used as a colorectal cancer model pig. The invention is helpful for researching and revealing pathogenesis of FAP and CRC caused by APC gene dysfunction, can be used for research such as drug screening, drug effect evaluation, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and further provides powerful experimental means for successfully treating human FAP and CRC. The invention has great application value for researching and developing FAP and CRC disease medicines and revealing pathogenesis of the disease.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification using different primer pairs using ear tissue-extracted genomes of swine designated as 1 as templates in example 1.

FIG. 2 is an electrophoretogram of PCR amplification in example 1 using 18 pig genomic DNAs as templates and a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR580, respectively.

FIG. 3 is an electropherogram comparing the editing efficiency of different target combinations in example 1.

FIG. 4 is an alignment of forward sequencing of single cell clone numbered 4 to the wild type sequence.

FIG. 5 is a comparison of forward sequencing of single cell clone numbered 2 with the wild type sequence.

FIG. 6 is a comparison of the forward sequencing of single cell clone numbered 1 with the wild type sequence.

FIG. 7 is a comparison of forward sequencing of single cell clone numbered 6 with the wild type sequence.

FIG. 8 is a schematic diagram of the structure of plasmid pET-32 a.

FIG. 9 is a schematic diagram of the structure of plasmid pKG-GE4.

FIG. 10 is an electrophoretogram of example 3 in which the ratio of gRNA to NCN protein is optimized.

Fig. 11 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 3.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise specified, were carried out in a conventional manner according to the techniques or conditions described in the literature in this field or according to the product instructions. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. The commercial Cas9-A protein is a commercial Cas9 protein with good effect. The commercial Cas9-B protein is a commercial Cas9 protein with good effect. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃ C., 5% CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in the examples were all prepared from porcine ear tissue, which was freshly obtained from Jiangxiang pigs. The method for preparing the primary pig fibroblast comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging at 500g for 5min, and discarding the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, then spreading into a 10 cm-diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

Example 1 screening of APC Gene efficient gRNA targets

Pig APC gene information: encoding tumor suppressor protein APC; is located on chromosome 2; gene ID is 100517932, sus scrofa. The amino acid sequence of the protein coded by the pig APC gene is shown as SEQ ID NO: shown in fig. 8. In the porcine genomic DNA, the APC gene has 15 exons, and a partial sequence (partial sequence of the 15 th exon) thereof is shown as SEQ ID NO: shown at 9.

Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:2, respectively. SEQ ID NO:2, the nucleotide at positions 395 to 680 constitutes CMV enhancer, the nucleotide at positions 682 to 890 constitutes EF1a promoter, the nucleotide at positions 986 to 1006 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 1016 to 1036 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 1037 to 5161 encodes Cas9 protein, the nucleotide at positions 5162 to 5209 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 5219 to 5266 encodes a Nuclear Localization Signal (NLS), the nucleotide at positions 5276 to 5332 encodes self-cleaving polypeptide P2A (the amino acid sequence of self-cleaving polypeptide P2A is "ATNFSLSLLKKQAKGDAKGDVEENPGP", the position of self-cleaving is between the first and second amino acid residues from the C-terminus of the sequence), the nucleotide at positions 5333 to 6046 encodes EGFP protein, the nucleotide at positions 6056 to 539 encodes self-cleaving polypeptide T2A (the amino acid sequence of self-cleaving polypeptide T2A is "EGSLRGSLRGPLGVEGDVEGFENP", the nucleotide at positions 73610739 and the nucleotide at positions 7373769 to 677647), the nucleotide at positions WPBYb 6747 encodes the nucleotide sequence (the nucleotide sequence of the nucleotide at positions WPSbSLRGBW 679) and the nucleotide sequence of the nucleotide at positions 677610 to 677647), and the nucleotide sequence of WPSbRGSLRG 677610 to 677647, the sequence (WPSbRG 679). SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280-2539 th nucleotides form the hU6 promoter, and the 2558-2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) with about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.

1. Conservation analysis of preset deletion region and adjacent genome sequence of APC gene

18 newborn Jiangxiang pigs, wherein 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10) and 8 males (named A, B, C, D, E, F, G and H respectively) are provided.

APC-E15-JDF51：AGAAGCAGAATTAGACGCCCAGC；

APC-E15-JDR537：CAGTGCATTCCTCTCATCTGTCC；

APC-E15-JDF96：TATTGACAATTTAAGTCCCAAGG；

APC-E15-JDR580：GTTGTACGTGTTTGCGTGTGAGT。

The porcine ear tissue designated 1 was used to extract the genome as a template, PCR amplified with different primer pairs, and then subjected to 1% agarose gel electrophoresis. The electrophoretogram is shown in FIG. 1. In fig. 1: group 1: adopting a primer pair consisting of APC-E15-JDF51 and APC-E15-JDR 537; group 2: adopting a primer pair consisting of APC-E15-JDF51 and APC-E15-JDR 580; group 3: adopting a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR 537; group 4: a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR580 was used. As a result, it is preferable to amplify the target fragment using a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR 580.

The genomic DNA of 18 pigs was used as templates, PCR amplification was performed using primer pairs consisting of APC-E15-JDF96 and APC-E15-JDR580, and then 1% agarose gel electrophoresis was performed. The electrophoretogram is shown in FIG. 2. And recovering PCR amplification products, sequencing, and comparing and analyzing a sequencing result with an APC gene sequence in a public database. A common conserved region in 18 pigs is selected for designing a gRNA target.

2. Screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 6 targets from the NGG through a preliminary experiment.

The 6 targets are respectively as follows:

APC-E15-gRNA1：CCCCTTGATGAAGAGGAGCT；

APC-E15-gRNA2：CCCAGCTCCTCTTCATCAAG；

APC-E15-gRNA3：TTCTGAGAAAGACAGAAGTT；

APC-E15-gRNA4：AGAAGTTTGGAGAGAGAACG；

APC-E15-gRNA5：AGAGAACGAGGTATTAGCAT；

APC-E15-gRNA6：CCAGGAACCTCTTCAAAGCG。

3. preparation of gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

APC-E15-gRNA1-S and APC-E15-gRNA1-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 1). Plasmid pKG-U6gRNA (APC-E15-gRNA 1) expresses the nucleic acid sequence of SEQ ID NO:10 sgRNA _{APC-E15-gRNA1} 。

sgRNA _{APC-E15-gRNA1} (SEQ ID NO：10)：

CCCCUUGAUGAAGAGGAGCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA2-S and APC-E15-gRNA2-A are respectively synthesized, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 2). Plasmid pKG-U6gRNA (APC-E15-gRNA 2) expresses the nucleic acid sequence of SEQ ID NO: 11-sgRNA _{APC-E15-gRNA2} 。

sgRNA _{APC-E15-gRNA2} (SEQ ID NO：11)：

CCCAGCUCCUCUUCAUCAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA3-S and APC-E15-gRNA3-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 3). Plasmid pKG-U6gRNA (APC-E15-gRNA 3) expresses SEQ ID NO:12 sgRNA _{APC-E15-gRNA3} 。

sgRNA _{APC-E15-gRNA3} (SEQ ID NO：12)：

UUCUGAGAAAGACAGAAGUUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA4-S and APC-E15-gRNA4-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 4). Plasmid pKG-U6gRNA (APC-E15-gRNA 4) expresses SEQ ID NO:13 sgRNA _{APC-E15-gRNA4} 。

sgRNA _{APC-E15-gRNA4} (SEQ ID NO：13)：

AGAAGUUUGGAGAGAGAACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA5-S and APC-E15-gRNA5-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 5). Plasmid pKG-U6gRNA (APC-E15-gRNA 5) expresses the nucleic acid sequence of SEQ ID NO:14 sgRNA _{APC-E15-gRNA5} 。

sgRNA _{APC-E15-gRNA5} (SEQ ID NO：14)：

AGAGAACGAGGUAUUAGCAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA6-S and APC-E15-gRNA6-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (APC-E15-gRNA 6). Plasmid pKG-U6gRNA (APC)-E15-gRNA 6) expresses SEQ ID NO:15 sgRNA _{APC-E15-gRNA6} 。

sgRNA _{APC-E15-gRNA6} (SEQ ID NO：15)：

CCAGGAACCUCUUCAAAGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

APC-E15-gRNA1-S：caccgCCCCTTGATGAAGAGGAGCT；

APC-E15-gRNA1-A：aaacAGCTCCTCTTCATCAAGGGGc。

APC-E15-gRNA2-S：caccgCCCAGCTCCTCTTCATCAAG；

APC-E15-gRNA2-A：aaacCTTGATGAAGAGGAGCTGGGc。

APC-E15-gRNA3-S：caccgTTCTGAGAAAGACAGAAGTT；

APC-E15-gRNA3-A：aaacAACTTCTGTCTTTCTCAGAAc。

APC-E15-gRNA4-S：caccgAGAAGTTTGGAGAGAGAACG；

APC-E15-gRNA4-A：aaacCGTTCTCTCTCCAAACTTCTc。

APC-E15-gRNA5-S：caccgAGAGAACGAGGTATTAGCAT；

APC-E15-gRNA5-A：aaacATGCTAATACCTCGTTCTCTc。

APC-E15-gRNA6-S：caccgCCAGGAACCTCTTCAAAGCG；

APC-E15-gRNA6-A：aaacCGCTTTGAAGAGGTTCCTGGc。

APC-E15-gRNA1-S, APC-E15-gRNA1-A, APC-E15-gRNA2-S, APC-E15-gRNA2-A, APC-E15-gRNA3-S, APC-E15-gRNA3-A, APC-E15-gRNA4-S, APC-E15-gRNA4-A, APC-E15-gRNA5-S, APC-E15-gRNA5-A, APC-E15-gRNA6-S and APC-E15-gRNA6-A are single-stranded DNA molecules.

4. Comparison of editing efficiency for different target combinations

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (APC-E15-gRNA 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 1): 1.08. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (APC-E15-gRNA 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 2): 1.08. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (APC-E15-gRNA 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 3): 1.08. Mu.g of plasmid pKG-GE3.

And a fourth group: the plasmid pKG-U6gRNA (APC-E15-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3.

A fifth group: the plasmid pKG-U6gRNA (APC-E15-gRNA 5) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 5): 1.08. Mu.g of plasmid pKG-GE3.

A sixth group: the plasmid pKG-U6gRNA (APC-E15-gRNA 6) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (APC-E15-gRNA 6): 1.08. Mu.g of plasmid pKG-GE3.

A seventh group: carrying out electrotransformation operation on primary pig fibroblasts with the same electrotransformation parameters and without plasmids.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After step 2 was completed, cells were digested and collected with trypsin, lysed, genomic DNA was extracted, PCR-amplified using a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR580, and then subjected to 1% agarose gel electrophoresis. And detecting the mutation condition of the target gene of the cell. The electrophoretogram is shown in FIG. 3.

And cutting and recovering the target product, sending the target product to a sequencing company for sequencing, and analyzing a sequencing peak map by using a webpage version Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first to sixth groups were 14%, 33%, 18%, 0, 47%, and 55% in this order, and no gene editing occurred in the seventh group. The result shows that the editing efficiency of the APC-E15-gRNA5 and the APC-E15-gRNA6 is higher.

Example 2 preparation of APC Gene knockout clone from Single cell of Jiangxiang pig

Two high-efficiency gRNA targets (APC-E15-gRNA 5 and APC-E15-gRNA 6) screened in example 4 were selected.

1. Preparation of gRNA

1. Preparation of APC-T7-gRNA5 transcription template and APC-T7-gRNA6 transcription template

The APC-T7-gRNA5 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 16.

The APC-T7-gRNA6 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 17.

2. In vitro transcription to obtain gRNA

Taking APC-T7-gRNA5 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM APC-gRNA5 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). APC-gRNA5 is a single-stranded RNA, as shown in SEQ ID NO:18, respectively.

Taking APC-T7-gRNA6 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The APC-gRNA6 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). The APC-gRNA6 is a single-stranded RNA, and is shown in SEQ ID NO:19, respectively.

APC-gRNA5(SEQ ID NO：18)：

GGAGAGAACGAGGUAUUAGCAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

APC-gRNA6(SEQ ID NO：19)：

GGCCAGGAACCUCUUCAAAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

2. Transfection of porcine primary fibroblasts

1. Co-transfecting the APC-gRNA5, the APC-gRNA6 and the NCN protein into a pig primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g APC-gRNA5:1 μ g APC-gRNA6: mu.g NCN protein. Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses). NCN protein was prepared as in example 3.

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 100. Mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and collected (cells obtained per well, approximately 2/3 of which were seeded into 6-well plates containing complete medium, the remaining 1/3 of which were collected in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 80% confluency, trypsinized and collected, and the cells were cryopreserved using a cell cryopreservation solution (90% complete medium +10% DMSO, vol.).

6. And (4) taking the centrifuge tube in the step (4), taking cells, carrying out cell lysis and extracting genomic DNA, carrying out PCR amplification by adopting a primer pair consisting of APC-E15-JDF96 and APC-E15-JDR580, and then carrying out electrophoresis. Porcine primary fibroblasts were used as wild type control (WT).

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

The sequencing result of the pig primary fibroblast cell is only one, and the genotype of the pig primary fibroblast cell is a wild type (also called a homozygous wild type). If the sequencing result of a single-cell clone has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is heterozygote; if the sequencing result of a single-cell clone is two, the single-cell clone is mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, and the genotype of the single-cell clone is a biallelic different mutant type; if the sequencing result of a single-cell clone is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is a biallelic identical mutant; if the sequencing result of a single cell clone is one and is consistent with the sequencing result of a pig primary fibroblast, the genotype of the single cell clone is wild type (also called homozygous wild type).

The results are shown in Table 1. The genotypes of the single cell clones numbered 4, 11, 16, 18, 24, 31 were wild-type. The genotypes of the single cell clones numbered 2, 3, 7, 10, 14, 20, 23, 27, 29, 32, 35, 36, 39, 42 were heterozygous. The genotypes of the single cell clones numbered 1, 5, 8, 12, 13, 15, 19, 22, 26, 28, 30, 33, 34, 37, 38, 40 are biallelic different mutants. The genotypes of the single cell clones numbered 6, 9, 17, 21, 25, 41 were biallelic mutants. The rate of single cell clones resulting from editing of the APC gene was 85.7%.

Exemplary sequencing alignments are shown in figures 4 to 7. FIG. 4 shows the alignment of the forward sequencing of single cell clone numbered 4 with the wild type sequence, and the wild type was identified. FIG. 5 shows the result of alignment of forward sequencing of single-cell clone No. 2 with the wild-type sequence, and it was judged as heterozygous. FIG. 6 is a sequence alignment of forward and reverse sequencing of single cell clone numbered 1 with the wild type sequence, as biallelic different mutants. FIG. 7 is a alignment of forward sequencing of single cell clone number 6 with the wild type sequence, as a biallelic identical mutant.

TABLE 1 genotype determination of single cell clones edited by APC Gene

The heterozygote single cell clone (homozygous cell embryo development death) with non-3 fold mutation can be used for subsequent clone pig production. The cells are taken as nuclear transplantation donor cells to carry out somatic cell cloning, and cloned pigs, namely, adenomatous polyposis model pigs can be obtained. Since mutation of the APC gene and the FAP caused by the mutation are considered as the main driving cause of CRC, the cloned pig partially develops into a colorectal cancer pig and can be used as a colorectal cancer model pig. Non-3-fold mutation means that deletion mutation and/or insertion mutation occur, and the number of nucleotides deleted and/or inserted is not a multiple of 3.

Example 3 preparation, purification and Performance of NCN proteins

1. Construction of prokaryotic Cas9 high-efficiency expression vector

The structure of plasmid pET-32a is schematically shown in FIG. 8.

The plasmid pKG-GE4 is obtained by modifying plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short), as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 9.

SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) ₆ Tag), 5638-5652 nucleotides encode enterokinase cleavage site (EK cleavage site), 5656-5670 nucleotides encode nuclear localization signal, 5701-9801 nucleotides encode spCas9 protein, 9802-9849 nucleotides encode nuclear localization signal, and 9902-9949 nucleotides constitute T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.

The main modifications of plasmid pKG-GE4 are as follows: (1) the coding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide before a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cut by prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag behind the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding the coding sequence of an enterokinase enzyme cutting site DDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of the coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for being expressed by an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.

The fusion gene in plasmid pKG-GE4 is shown in SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, the protein shown in SEQ ID NO: the protein shown in 3 is named NCN protein.

2. Inducible expression

1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.

3. Inoculating the bacterial liquid obtained in the step 2 to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD _600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to the system to give a concentration of 0.5mM, and the system was cultured at 25 ℃ for 12 hours with shaking at 230rpm, and then centrifuged at 4 ℃ for 15 minutes at 10000g, and the cells were collected.

4. The cells obtained in step 3 were washed with PBS buffer.

3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

1. And (3) adding the crude extraction buffer solution into the thalli obtained in the step two, suspending the thalli, then crushing the thalli by a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernate, filtering the supernate by a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus.

Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH ₂ O。

2. The fusion protein was purified by affinity chromatography.

Firstly, balancing a Ni-NTA agarose column by using a balancing solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Ni-NTA agarose column: ausrey, L00250/L00250-C, 10ml of filler.

Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH ₂ O。

Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH ₂ O。

Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH ₂ O。

4. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

1. 15ml of the post-column solution collected in step three was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.

2. Providing commercial source with His ₆ Tagged recombinant bovine enterokinase (biol., C620031, recombinant bovine enterokinase light chain, his-bearing ₆ The tag, recombinan Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.

3. The solution (about 6 ml) that completed step 2 was taken and mixed with 480. Mu.l of Ni-NTA resin (Kinseri, L00250/L00250-C), mixed by rotation at room temperature for 15min, and then 7000g was centrifuged for 3min, and the supernatant (4-5.5 ml) was collected.

4. And (3) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), adding the concentrated solution into an enzyme stock solution, and adjusting the protein concentration to be 5mg/ml to obtain the NCN protein solution.

And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, i.e., the NCN protein.

The NCN protein used in example 2 was provided by NCN protein solution.

Enzyme stock solution (ph 7.4): containing 10mM Tris,300mM NaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, and the balance ddH ₂ O。

5. Properties of NCN protein

The 2 gRNA targets targeting the TTN gene were selected as follows:

TTN-gRNA1：AGAGCACAGTCAGCCTGGCG；

TTN-gRNA2：CTTCCAGAATTGGATCTCCG。

primers used to identify target fragments comprising grnas in the TTN gene were as follows:

TTN-F55：TACGGAATTGGGGAGCCAGCGGA；

TTN-R560：CAAAGTTAACTCTCTGTGTCT。

1. preparation of gRNA

(1) Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.

The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.

(2) In vitro transcription to obtain gRNA

Taking TTN-T7-gRNA1 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: and 6.

Taking TTN-T7-gRNA2 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: shown in fig. 7.

2. gRNA and NCN protein dosage ratio optimization

(1) Co-transfected porcine primary fibroblasts

A first group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 ten thousand porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.

Second group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 ten thousand porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.

Third group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

And a fourth group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 million porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.

A fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

(2) After the step (1) is completed, the complete culture solution is adopted for culturing for 12 to 18 hours, and then the complete culture solution is replaced by a new complete culture solution for culturing. The total time of incubation after electroporation was 48 hours.

(3) After the completion of step (2), cells were collected by trypsinization, genomic DNA was extracted, PCR-amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 10. The 505bp band is wild type band (WT), and the about 254bp band (251 bp band is theoretically deleted from 505bp band of wild type) is deletion mutant band (MT).

Gene deletion mutation efficiency = (MT grayscale/MT band bp number)/(WT grayscale/WT band bp number + MT grayscale/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. The fifth group was not mutated.

The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, the actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN proteins was determined to be 1 μ g:1 μ g:4 μ g.

3. Comparison of Gene editing efficiency of NCN protein with that of the commercial Cas9 protein

(1) Co-transfected porcine primary fibroblasts

Cas9-a group: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-A protein to a porcine primary fibroblast. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.

pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

Cas9-B group: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-B protein into a porcine primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.

Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

(2) After the step (1) is completed, the complete culture solution is adopted for culturing for 12 to 18 hours, and then the complete culture solution is replaced by a new complete culture solution for culturing. The total time of incubation after electroporation was 48 hours.

(3) After the completion of step (2), cells were collected by trypsinization, genomic DNA was extracted, PCR-amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 11. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.

The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> Gene editing system for constructing adenomatosis polyposis model pig and colorectal cancer model pig and application thereof

<130> GNCYX213459

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 9974

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600

gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660

ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720

agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780

agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840

tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900

tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960

cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020

aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080

tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140

tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200

ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260

ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320

cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380

gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440

actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500

aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560

caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620

aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680

accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740

aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800

ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860

agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920

accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980

gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040

tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100

cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160

cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220

cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400

gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460

tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520

cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580

gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640

gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700

catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760

tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820

ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880

tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940

ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000

aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060

gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120

tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180

acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240

cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300

cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360

gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420

cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480

gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540

tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600

atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660

tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720

gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780

tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840

cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900

tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960

atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020

atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080

tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140

cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200

aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260

ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320

tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380

tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440

gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500

gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560

gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620

ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680

taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740

ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800

atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860

tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920

gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980

gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040

aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100

cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160

ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220

actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280

aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340

atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400

gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460

aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520

aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580

ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640

gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700

gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760

actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820

tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880

acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940

ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000

gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060

attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120

ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180

atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240

gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300

aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360

ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420

atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480

gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540

atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600

ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660

attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720

cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780

tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840

aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900

cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960

atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020

aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080

ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140

gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200

ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260

aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320

ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380

aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440

ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500

aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560

accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620

ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680

ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740

ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800

ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860

gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920

aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980

gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040

aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100

gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160

atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220

gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280

aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340

tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400

aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460

gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520

aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580

ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640

caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700

ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760

atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820

attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880

ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940

accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000

accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060

cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120

tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180

gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240

ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300

agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360

aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420

tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480

cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540

ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600

atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660

gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720

gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780

ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840

aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900

actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960

aactatatcc ggat 9974

<210> 2

<211> 1547

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr

1 5 10 15

Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp

20 25 30

Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp

35 40 45

Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu

50 55 60

Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu

65 70 75 80

Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly

85 90 95

Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys

100 105 110

Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn

115 120 125

Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp

130 135 140

Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly

145 150 155 160

Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr

165 170 175

Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser

180 185 190

Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys

195 200 205

Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala

210 215 220

Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn

225 230 235 240

Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val

245 250 255

Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu

260 265 270

Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu

275 280 285

Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys

290 295 300

Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala

305 310 315 320

Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp

325 330 335

Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val

340 345 350

Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly

355 360 365

Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg

370 375 380

Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu

385 390 395 400

Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys

405 410 415

Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp

420 425 430

Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln

435 440 445

Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu

450 455 460

Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu

465 470 475 480

Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr

485 490 495

Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu

500 505 510

Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly

515 520 525

Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu

530 535 540

Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp

545 550 555 560

Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln

565 570 575

Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe

580 585 590

Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr

595 600 605

Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg

610 615 620

Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn

625 630 635 640

Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu

645 650 655

Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro

660 665 670

Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr

675 680 685

Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser

690 695 700

Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg

705 710 715 720

Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu

725 730 735

Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala

740 745 750

Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp

755 760 765

Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu

770 775 780

Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys

785 790 795 800

Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg

805 810 815

Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly

820 825 830

Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser

835 840 845

Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser

850 855 860

Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly

865 870 875 880

Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile

885 890 895

Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys

900 905 910

Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg

915 920 925

Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met

930 935 940

Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys

945 950 955 960

Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu

965 970 975

Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp

980 985 990

Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser

995 1000 1005

Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp

1010 1015 1020

Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys

1025 1030 1035 1040

Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr

1045 1050 1055

Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser

1060 1065 1070

Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg

1075 1080 1085

Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr

1090 1095 1100

Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr

1105 1110 1115 1120

Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr

1125 1130 1135

Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu

1140 1145 1150

Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu

1155 1160 1165

Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met

1170 1175 1180

Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe

1185 1190 1195 1200

Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala

1205 1210 1215

Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr

1220 1225 1230

Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys

1235 1240 1245

Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln

1250 1255 1260

Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp

1265 1270 1275 1280

Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly

1285 1290 1295

Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val

1300 1305 1310

Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly

1315 1320 1325

Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe

1330 1335 1340

Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys

1345 1350 1355 1360

Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met

1365 1370 1375

Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro

1380 1385 1390

Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu

1395 1400 1405

Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln

1410 1415 1420

His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser

1425 1430 1435 1440

Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala

1445 1450 1455

Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile

1460 1465 1470

Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys

1475 1480 1485

Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu

1490 1495 1500

Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu

1505 1510 1515 1520

Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala

1525 1530 1535

Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

1540 1545

<210> 3

<211> 1399

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala

1 5 10 15

Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly

20 25 30

Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys

35 40 45

Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly

50 55 60

Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys

65 70 75 80

Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr

85 90 95

Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe

100 105 110

Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His

115 120 125

Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His

130 135 140

Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser

145 150 155 160

Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met

165 170 175

Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp

180 185 190

Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn

195 200 205

Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys

210 215 220

Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu

225 230 235 240

Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu

245 250 255

Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp

260 265 270

Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp

275 280 285

Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu

290 295 300

Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile

305 310 315 320

Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met

325 330 335

Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala

340 345 350

Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp

355 360 365

Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln

370 375 380

Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly

385 390 395 400

Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys

405 410 415

Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly

420 425 430

Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu

435 440 445

Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro

450 455 460

Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met

465 470 475 480

Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val

485 490 495

Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn

500 505 510

Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu

515 520 525

Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr

530 535 540

Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys

545 550 555 560

Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val

565 570 575

Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser

580 585 590

Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr

595 600 605

Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn

610 615 620

Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu

625 630 635 640

Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His

645 650 655

Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr

660 665 670

Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys

675 680 685

Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala

690 695 700

Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys

705 710 715 720

Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His

725 730 735

Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile

740 745 750

Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg

755 760 765

His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr

770 775 780

Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu

785 790 795 800

Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val

805 810 815

Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln

820 825 830

Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu

835 840 845

Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp

850 855 860

Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly

865 870 875 880

Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn

885 890 895

Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe

900 905 910

Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys

915 920 925

Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys

930 935 940

His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu

945 950 955 960

Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys

965 970 975

Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu

980 985 990

Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val

995 1000 1005

Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val

1010 1015 1020

Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser

1025 1030 1035 1040

Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn

1045 1050 1055

Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile

1060 1065 1070

Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val

1075 1080 1085

Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met

1090 1095 1100

Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe

1105 1110 1115 1120

Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala

1125 1130 1135

Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro

1140 1145 1150

Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys

1155 1160 1165

Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met

1170 1175 1180

Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys

1185 1190 1195 1200

Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr

1205 1210 1215

Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala

1220 1225 1230

Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val

1235 1240 1245

Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro

1250 1255 1260

Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr

1265 1270 1275 1280

Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile

1285 1290 1295

Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His

1300 1305 1310

Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe

1315 1320 1325

Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr

1330 1335 1340

Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala

1345 1350 1355 1360

Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp

1365 1370 1375

Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala

1380 1385 1390

Gly Gln Ala Lys Lys Lys Lys

1395

<210> 4

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 5

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 6

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 7

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 8

<211> 2847

<212> PRT

<213> Sus scrofa

<400> 8

Met Ala Ala Ala Ser Tyr Asp Gln Leu Leu Lys Gln Val Glu Ala Leu

1 5 10 15

Lys Met Glu Asn Ser Asn Leu Arg Gln Glu Leu Glu Asp Asn Ser Asn

20 25 30

His Leu Thr Lys Leu Glu Thr Glu Ala Ser Asn Met Lys Glu Val Leu

35 40 45

Lys Gln Leu Gln Gly Ser Ile Glu Asp Glu Ala Met Ala Ser Ser Gly

50 55 60

Gln Ile Asp Leu Leu Glu Arg Leu Lys Glu Leu Asn Leu Asp Ser Ser

65 70 75 80

Asn Phe Pro Gly Val Lys Leu Arg Ser Lys Met Ser Leu Arg Ser Tyr

85 90 95

Gly Ser Arg Glu Gly Ser Val Ser Ser Arg Ser Gly Glu Cys Ser Pro

100 105 110

Val Pro Met Gly Ser Phe Pro Arg Arg Gly Phe Val Asn Gly Ser Arg

115 120 125

Glu Asn Thr Ser Tyr Leu Glu Glu Leu Glu Lys Glu Arg Ser Leu Leu

130 135 140

Leu Ala Asp Leu Asp Lys Glu Glu Lys Glu Lys Asp Trp Tyr Tyr Ala

145 150 155 160

Gln Leu Gln Asn Leu Thr Lys Arg Ile Asp Ser Leu Pro Leu Thr Glu

165 170 175

Asn Phe Ser Leu Gln Thr Asp Met Thr Arg Arg Gln Leu Glu Tyr Glu

180 185 190

Ala Arg Gln Ile Arg Val Ala Met Glu Glu Gln Leu Gly Thr Cys Gln

195 200 205

Asp Met Glu Lys Arg Ala Gln Arg Arg Ile Thr Arg Ile Gln Gln Ile

210 215 220

Glu Lys Asp Ile Leu Arg Ile Arg Gln Leu Leu Gln Ser Gln Ala Thr

225 230 235 240

Glu Ala Glu Arg Ser Ser Gln Ser Lys His Glu Ala Gly Ser Tyr Glu

245 250 255

Ala Glu Arg Gln Asn Glu Gly Gln Gly Val Ala Glu Ile Ser Met Ala

260 265 270

Thr Ser Gly Asn Gly Gln Gly Ser Ser Thr Arg Val Asp His Glu Thr

275 280 285

Ala Ser Val Leu Ser Ser Ser Ser Thr His Ser Ala Pro Arg Arg Leu

290 295 300

Thr Ser His Leu Gly Thr Lys Val Glu Met Val Tyr Ser Leu Leu Ser

305 310 315 320

Met Leu Gly Thr His Asp Lys Asp Asp Met Ser Arg Thr Leu Leu Ala

325 330 335

Met Ser Ser Ser Gln Asp Ser Cys Ile Ser Met Arg Gln Ser Gly Cys

340 345 350

Leu Pro Leu Leu Ile Gln Leu Leu His Gly Asn Asp Lys Asp Ser Val

355 360 365

Leu Leu Gly Asn Ser Arg Gly Ser Lys Glu Ala Arg Ala Arg Ala Ser

370 375 380

Ala Ala Leu His Asn Ile Ile His Ser Gln Pro Asp Asp Lys Arg Gly

385 390 395 400

Arg Arg Glu Ile Arg Val Leu His Leu Leu Glu Gln Ile Arg Ala Tyr

405 410 415

Cys Glu Thr Cys Trp Glu Trp Gln Glu Ala His Glu Gln Gly Met Asp

420 425 430

Gln Asp Lys Asn Pro Met Pro Ala Pro Val Glu His Gln Ile Cys Pro

435 440 445

Ala Val Cys Val Leu Met Lys Leu Ser Phe Asp Glu Glu His Arg His

450 455 460

Ala Met Asn Glu Leu Gly Gly Leu Gln Ala Ile Ala Glu Leu Leu Gln

465 470 475 480

Val Asp Cys Glu Met Tyr Gly Leu Thr Asn Asp His Tyr Ser Ile Thr

485 490 495

Leu Arg Arg Tyr Ala Gly Met Ala Leu Thr Asn Leu Thr Phe Gly Asp

500 505 510

Val Ala Asn Lys Ala Thr Leu Cys Ser Met Lys Gly Cys Met Arg Ala

515 520 525

Leu Val Ala Gln Leu Lys Ser Glu Ser Glu Asp Leu Gln Gln Val Ile

530 535 540

Ala Ser Val Leu Arg Asn Leu Ser Trp Arg Ala Asp Val Asn Ser Lys

545 550 555 560

Lys Thr Leu Arg Glu Val Gly Ser Val Lys Ala Leu Met Glu Cys Ala

565 570 575

Leu Glu Val Lys Lys Glu Ser Thr Leu Lys Ser Val Leu Ser Ala Leu

580 585 590

Trp Asn Leu Ser Ala His Cys Thr Glu Asn Lys Ala Asp Ile Cys Ala

595 600 605

Val Asp Gly Ala Leu Ala Phe Leu Val Gly Thr Leu Thr Tyr Arg Ser

610 615 620

Gln Thr Asn Thr Leu Ala Ile Ile Glu Ser Gly Gly Gly Ile Leu Arg

625 630 635 640

Asn Val Ser Ser Leu Ile Ala Thr Asn Glu Glu His Arg Gln Ile Leu

645 650 655

Arg Glu Asn Asn Cys Leu Gln Thr Leu Leu Gln His Leu Lys Ser His

660 665 670

Ser Leu Thr Ile Val Ser Asn Ala Cys Gly Thr Leu Trp Asn Leu Ser

675 680 685

Ala Arg Asn Pro Lys Asp Gln Glu Ala Leu Trp Asp Met Gly Ala Val

690 695 700

Ser Met Leu Lys Asn Leu Ile His Ser Lys His Lys Met Ile Ala Met

705 710 715 720

Gly Ser Ala Ala Ala Leu Arg Asn Leu Met Ala Asn Arg Pro Ala Lys

725 730 735

Tyr Lys Asp Ala Asn Ile Met Ser Pro Gly Ser Ser Leu Pro Ser Leu

740 745 750

His Val Arg Lys Gln Lys Ala Leu Glu Ala Glu Leu Asp Ala Gln His

755 760 765

Leu Ser Glu Thr Phe Asp Asn Ile Asp Asn Leu Ser Pro Lys Ala Ser

770 775 780

His Arg Ser Lys Gln Arg His Lys Gln Asn Leu Tyr Gly Asp Tyr Ala

785 790 795 800

Phe Asp Ala Asn Arg His Asp Asp Asn Arg Ser Asp Asn Phe Asn Thr

805 810 815

Gly Asn Met Thr Val Leu Ser Pro Tyr Leu Asn Thr Thr Val Leu Pro

820 825 830

Ser Ser Ser Ser Ser Arg Gly Ser Leu Asp Ser Ser Arg Ser Glu Lys

835 840 845

Asp Arg Ser Leu Glu Arg Glu Arg Gly Ile Ser Ile Gly Asn Tyr His

850 855 860

Pro Ala Thr Glu Asn Pro Gly Thr Ser Ser Lys Arg Gly Leu Gln Ile

865 870 875 880

Ser Thr Thr Ala Ala Gln Ile Ala Lys Val Met Glu Glu Val Ser Ala

885 890 895

Ile His Pro Ser Gln Glu Asp Arg Asn Ser Gly Ser Thr Thr Glu Leu

900 905 910

His Cys Gly Thr Asp Glu Arg Asn Ala Leu Arg Arg Ser Ser Thr Ala

915 920 925

His Ser His Ala Asn Thr Tyr Asn Phe Thr Lys Ser Glu Asn Ser Asn

930 935 940

Arg Thr Cys Pro Met Pro Tyr Ala Lys Val Glu Tyr Lys Arg Ser Ser

945 950 955 960

Asn Asp Ser Leu Asn Ser Val Ser Ser Ser Asp Gly Tyr Gly Lys Arg

965 970 975

Gly Gln Met Lys Pro Ser Ile Glu Ser Tyr Ser Glu Asp Asp Glu Ser

980 985 990

Lys Phe Cys Ser Tyr Gly Gln Tyr Pro Ala Asp Leu Ala His Lys Ile

995 1000 1005

His Ser Ala Asn His Met Asp Asp Asn Asp Gly Glu Leu Asp Thr Pro

1010 1015 1020

Ile Asn Tyr Ser Leu Lys Tyr Ser Asp Glu Gln Leu Asn Ser Gly Arg

1025 1030 1035 1040

Gln Ser Pro Ser Gln Asn Glu Arg Trp Ala Arg Pro Lys His Ile Ile

1045 1050 1055

Glu Asp Glu Ile Lys Gln Asn Glu Gln Arg Gln Ser Arg Ser Gln Ser

1060 1065 1070

Thr Thr Tyr Pro Val Tyr Pro Glu Ser Thr Asp Asp Lys His Leu Lys

1075 1080 1085

Phe Gln Pro His Phe Gly Gln Gln Glu Cys Val Ser Pro Tyr Arg Ser

1090 1095 1100

Arg Ala Ala Asn Gly Ser Glu Ala Asn Arg Val Gly Ser Asn His Gly

1105 1110 1115 1120

Ile Asn Gln Asn Val Asn Gln Ser Leu Cys Gln Glu Asp Asp Tyr Glu

1125 1130 1135

Asp Asp Lys Pro Thr Asn Tyr Ser Glu Arg Tyr Ser Glu Glu Glu Gln

1140 1145 1150

His Glu Glu Glu Glu Arg Pro Thr Asn Tyr Ser Ile Lys Tyr Asn Glu

1155 1160 1165

Glu Lys His His Val Asp Gln Pro Ile Asp Tyr Ser Leu Lys Tyr Ala

1170 1175 1180

Thr Asp Ile Pro Ser Ser Gln Lys Pro Ala Phe Ser Phe Ser Lys Asn

1185 1190 1195 1200

Ser Ser Gly Gln Ser Thr Lys Thr Glu Arg Ile Ser Pro Ser Gly Glu

1205 1210 1215

Asn Thr Ser Thr Pro Ser Ser Asn Ala Lys Arg Gln Ser Gln Leu His

1220 1225 1230

Pro Ser Ser Ala Gln Ser Arg Ser Gly Gln Thr Pro Lys Ala Thr Ser

1235 1240 1245

Ser Ser Cys Lys Val Pro Ser Ile Asn Gln Glu Thr Ile Gln Thr Tyr

1250 1255 1260

Cys Val Glu Asp Thr Pro Ile Cys Phe Ser Arg Cys Ser Ser Leu Ser

1265 1270 1275 1280

Ser Leu Ser Ser Ala Glu Asp Glu Ile Gly Cys Asp Gln Gln Thr Gln

1285 1290 1295

Glu Thr Asp Ser Ala Asn Thr Leu Gln Ile Ala Glu Ile Lys Glu Asn

1300 1305 1310

Ser Gly Thr Arg Ser Thr Glu Glu Ser Val Ser Glu Val Pro Thr Val

1315 1320 1325

Pro Gln His Ile Arg Thr Lys Ser Ser Arg Leu Gln Ala Ser Gly Leu

1330 1335 1340

Ser Ser Glu Ser Thr Arg His Lys Ala Val Glu Phe Ser Ser Gly Ala

1345 1350 1355 1360

Lys Ser Pro Ser Lys Ser Gly Ala Gln Thr Pro Lys Ser Pro Pro Glu

1365 1370 1375

His Tyr Val Gln Glu Thr Pro Leu Met Phe Ser Arg Cys Thr Ser Val

1380 1385 1390

Ser Ser Leu Asp Ser Phe Glu Ser Arg Ser Ile Ala Ser Ser Val Gln

1395 1400 1405

Ser Glu Pro Cys Ser Gly Met Val Ser Gly Ile Ile Ser Pro Ser Asp

1410 1415 1420

Leu Pro Asp Ser Pro Gly Gln Thr Met Pro Pro Ser Arg Ser Lys Thr

1425 1430 1435 1440

Pro Pro Pro Pro Pro Pro Gln Thr Ser Gln Thr Lys Gln Glu Val Pro

1445 1450 1455

Lys Ser Lys Ala Pro Ser Ala Glu Lys Arg Glu Ser Gly Pro Lys Gln

1460 1465 1470

Ala Ala Val Asn Ala Ala Val Gln Arg Val Gln Val Leu Pro Asp Ala

1475 1480 1485

Asp Thr Leu Leu His Phe Ala Thr Glu Ser Thr Pro Asp Gly Phe Ser

1490 1495 1500

Cys Ser Ser Ser Leu Ser Ala Leu Ser Leu Asp Glu Pro Phe Ile Gln

1505 1510 1515 1520

Lys Asp Val Glu Leu Arg Ile Met Pro Pro Val Gln Glu Asn Asp Asn

1525 1530 1535

Gly Asn Glu Thr Glu Asn Glu Gln Pro Glu Lys Ser Asn Glu Asn Gln

1540 1545 1550

Glu Lys Glu Ala Glu Lys Pro Thr Asp Ser Glu Lys Asp Leu Leu Asp

1555 1560 1565

Asp Ser Asp Asp Asp Asp Ile Glu Ile Leu Glu Glu Cys Ile Ile Ser

1570 1575 1580

Ala Met Pro Thr Lys Ser Ser Arg Lys Ala Lys Lys Pro Ala Gln Thr

1585 1590 1595 1600

Ala Ser Lys Leu Pro Pro Pro Val Ala Arg Lys Pro Ser Gln Leu Pro

1605 1610 1615

Val Tyr Lys Leu Leu Pro Ser Gln Asn Arg Leu Gln Ala Gln Lys His

1620 1625 1630

Val Ser Phe Thr Pro Gly Asp Asp Val Pro Arg Val Tyr Cys Val Glu

1635 1640 1645

Gly Thr Pro Ile Asn Phe Ser Thr Ala Thr Ser Leu Ser Asp Leu Thr

1650 1655 1660

Ile Glu Ser Pro Pro Asn Glu Leu Ala Ala Gly Glu Gly Ala Arg Ala

1665 1670 1675 1680

Gly Ala Gln Ser Gly Glu Phe Glu Lys Arg Asp Thr Ile Pro Thr Glu

1685 1690 1695

Gly Arg Ser Thr Asp Glu Ala Gln Arg Gly Lys Ser Thr Ser Val Ala

1700 1705 1710

Ile Pro Glu Leu Asp Asp Asn Lys Thr Glu Glu Gly Asp Ile Leu Ala

1715 1720 1725

Glu Cys Ile Asn Ser Ala Met Pro Lys Gly Lys Ser His Lys Pro Phe

1730 1735 1740

Arg Val Lys Lys Ile Met Asp Gln Val Gln Gln Ala Ser Met Ser Ser

1745 1750 1755 1760

Ser Gly Ala Asn Lys Asn Gln Leu Asp Gly Lys Lys Lys Lys Pro Thr

1765 1770 1775

Ser Pro Val Lys Pro Ile Pro Gln Asn Ala Glu Tyr Arg Thr Arg Val

1780 1785 1790

Arg Lys Asn Thr Asp Thr Lys Asn Asn Leu Asn Ala Glu Arg Ala Phe

1795 1800 1805

Ser Asp Asn Lys Asp Ser Lys Lys Gln Ser Leu Lys Asn Asn Ser Lys

1810 1815 1820

Asp Phe Asn Asp Lys Leu Pro Asn Asn Glu Asp Arg Val Arg Gly Ser

1825 1830 1835 1840

Phe Thr Phe Asp Ser Pro His His Tyr Thr Pro Ile Glu Gly Thr Pro

1845 1850 1855

Tyr Cys Phe Ser Arg Asn Asp Ser Leu Ser Ser Leu Asp Phe Asp Asp

1860 1865 1870

Asp Asp Val Asp Leu Ser Arg Glu Lys Ala Glu Leu Arg Lys Gly Lys

1875 1880 1885

Glu Asn Lys Glu Ser Glu Ala Lys Val Ser Asn His Thr Glu Leu Ala

1890 1895 1900

Ser Asn Gln Gln Ser Ala Lys Thr Thr Gln Ala Val Thr Lys His Pro

1905 1910 1915 1920

Ile Asn Arg Gly Pro Ser Lys Pro Met Leu Gln Lys Gln Ser Thr Phe

1925 1930 1935

Pro Gln Ser Ser Lys Asp Ile Pro Asp Arg Gly Ala Ala Thr Asp Glu

1940 1945 1950

Lys Leu Gln Asn Phe Ala Ile Glu Asn Thr Pro Val Cys Phe Ser Arg

1955 1960 1965

Asn Ser Ser Leu Ser Ser Leu Ser Asp Ile Asp Gln Glu Asn Asn Asn

1970 1975 1980

Asn Lys Glu Ser Glu Pro Ile Lys Glu Thr Glu Pro Pro His Ser Gln

1985 1990 1995 2000

Gly Glu Pro Ser Lys Pro Gln Ala Ser Gly Tyr Ala Pro Lys Ser Phe

2005 2010 2015

His Val Glu Asp Thr Pro Val Cys Phe Ser Arg Asn Ser Ser Leu Ser

2020 2025 2030

Ser Leu Ser Ile Asp Ser Glu Asp Asp Leu Leu Gln Glu Cys Ile Ser

2035 2040 2045

Ser Ala Met Pro Lys Lys Lys Lys Pro Ser Arg Leu Lys Gly Asp Asn

2050 2055 2060

Glu Lys His Ser Pro Arg Asn Met Ser Gly Ile Leu Ala Glu Asp Leu

2065 2070 2075 2080

Thr Leu Asp Leu Lys Asp Ile Gln Arg Pro Asp Ser Glu His Gly Leu

2085 2090 2095

Ser Pro Asp Ser Glu Asn Phe Asp Trp Lys Ala Ile Gln Glu Gly Ala

2100 2105 2110

Asn Ser Ile Val Ser Ser Leu His Gln Ala Ala Ala Ala Ala Cys Leu

2115 2120 2125

Ser Arg Gln Ala Ser Ser Asp Ser Asp Ser Ile Leu Ser Leu Lys Ser

2130 2135 2140

Gly Ile Ser Leu Gly Ser Pro Phe His Leu Thr Pro Asp Gln Glu Glu

2145 2150 2155 2160

Lys Pro Phe Thr Ser Asn Lys Gly Pro Arg Ile Leu Lys Pro Gly Glu

2165 2170 2175

Lys Ser Thr Leu Glu Thr Lys Lys Met Glu Ser Glu Asn Lys Gly Ile

2180 2185 2190

Lys Gly Gly Lys Lys Val Tyr Lys Ser Leu Ile Thr Gly Lys Val Arg

2195 2200 2205

Ser Asn Ser Glu Ile Ser Ser Gln Met Lys Gln Pro Leu Gln Thr Asn

2210 2215 2220

Met Pro Ser Ile Ser Arg Gly Arg Thr Met Ile His Ile Pro Gly Val

2225 2230 2235 2240

Arg Asn Ser Ser Ser Ser Thr Ser Pro Val Ser Lys Lys Gly Pro Pro

2245 2250 2255

Leu Lys Thr Pro Ala Ser Lys Ser Pro Ser Glu Ser Gln Ala Ala Thr

2260 2265 2270

Thr Ser Pro Arg Gly Ala Lys Pro Ser Val Lys Ser Glu Leu Ser Pro

2275 2280 2285

Val Thr Arg Gln Thr Ser Gln Thr Ala Gly Ser Asn Lys Gly Pro Ser

2290 2295 2300

Arg Ser Gly Ser Arg Asp Ser Thr Pro Ser Arg Pro Ala Gln Gln Pro

2305 2310 2315 2320

Leu Ser Arg Pro Met Gln Ser Pro Gly Arg Asn Ser Ile Ser Pro Gly

2325 2330 2335

Arg Asn Gly Ile Ser Pro Pro Asn Lys Leu Ser Gln Leu Pro Arg Thr

2340 2345 2350

Ser Ser Pro Ser Thr Ala Ser Thr Lys Ser Ser Gly Ser Gly Lys Met

2355 2360 2365

Ser Tyr Thr Ser Pro Gly Arg Gln Met Ser Gln Thr Asn Leu Thr Lys

2370 2375 2380

Gln Thr Gly Leu Ser Lys Asn Gly Ser Ser Ile Pro Arg Ser Glu Ser

2385 2390 2395 2400

Ala Ser Lys Gly Leu Asn Gln Met Ser Cys Ser Asn Gly Ser Asn Lys

2405 2410 2415

Lys Val Glu Leu Ser Arg Met Ser Ser Thr Lys Ser Ser Gly Ser Glu

2420 2425 2430

Ser Asp Arg Ser Glu Arg Pro Val Leu Val Arg Gln Ser Thr Phe Ile

2435 2440 2445

Lys Glu Ala Pro Ser Pro Thr Leu Arg Arg Lys Leu Glu Glu Ser Ala

2450 2455 2460

Ser Phe Glu Ser Leu Ser Pro Ser Ser Arg Pro Asp Ser Pro Thr Arg

2465 2470 2475 2480

Ser Gln Ala Gln Thr Pro Val Leu Ser Pro Ser Leu Pro Asp Met Ser

2485 2490 2495

Leu Ser Thr His Ser Ser Val Gln Ala Gly Gly Trp Arg Lys Leu Pro

2500 2505 2510

Pro Asn Leu Ser Pro Thr Ile Glu Tyr Asn Asp Gly Arg Pro Ile Lys

2515 2520 2525

Arg His Asp Ile Ala Arg Ser His Ser Glu Ser Pro Ser Arg Leu Pro

2530 2535 2540

Ile Asn Arg Ser Gly Thr Trp Lys Arg Glu His Ser Lys His Ser Ser

2545 2550 2555 2560

Ser Leu Pro Arg Val Ser Thr Trp Arg Arg Thr Gly Ser Ser Ser Ser

2565 2570 2575

Ile Leu Ser Ala Ser Ser Glu Ser Ser Glu Lys Ala Lys Ser Glu Asp

2580 2585 2590

Glu Lys His Val Asn Ser Ile Ser Gly Thr Lys Gln Thr Lys Glu Ser

2595 2600 2605

Gln Val Ser Thr Lys Gly Thr Trp Arg Lys Ile Lys Glu Ser Glu Ile

2610 2615 2620

Ser Pro Thr Asn Thr Thr Ser Gln Thr Thr Ser Ser Gly Ala Ala Asn

2625 2630 2635 2640

Gly Ala Glu Ser Lys Thr Leu Ile Tyr Gln Met Ala Pro Ala Val Ser

2645 2650 2655

Lys Thr Glu Asp Val Trp Val Arg Ile Glu Asp Cys Pro Ile Asn Asn

2660 2665 2670

Pro Arg Ser Gly Arg Ser Pro Thr Gly Asn Thr Pro Pro Val Ile Asp

2675 2680 2685

Thr Ile Ser Glu Lys Gly Asn Pro Asn Ala Lys Asp Ser Lys Asp Asn

2690 2695 2700

Gln Gly Lys His Asn Val Ser Asn Gly Gly Ala Pro Thr Arg Thr Met

2705 2710 2715 2720

Gly Leu Glu Asn Arg Leu Asn Ser Phe Ile Gln Val Asp Ala Pro Asp

2725 2730 2735

Gln Lys Gly Thr Glu Thr Lys Pro Gly Gln Ser Asn Ser Val Pro Ala

2740 2745 2750

Ser Glu Thr Asn Glu Ser Ser Ile Ala Glu Arg Thr Pro Phe Ser Ser

2755 2760 2765

Ser Ser Ser Ser Lys His Ser Ser Pro Ser Gly Thr Val Ala Ala Arg

2770 2775 2780

Val Thr Pro Phe Asn Tyr Asn Pro Ser Pro Arg Lys Ser Ser Ala Asp

2785 2790 2795 2800

Ser Thr Ser Ala Arg Pro Ser Gln Ile Pro Thr Pro Val Asn Asn Asn

2805 2810 2815

Thr Lys Lys Arg Asp Ser Lys Thr Asp Asn Thr Asp Ser Ser Gly Thr

2820 2825 2830

Gln Ser Pro Lys Arg His Ser Gly Ser Tyr Leu Val Thr Ser Val

2835 2840 2845

<210> 9

<211> 1081

<212> DNA

<213> Sus scrofa

<400> 9

cttattacaa cacttgaaat ctcacagttt gacaatagtc agtaatgcat gtggaacctt 60

gtggaatctc tcagccagaa atcctaaaga ccaggaagca ttatgggaca tgggggcagt 120

cagcatgctc aagaacctca ttcattcaaa gcacaaaatg attgctatgg ggagcgccgc 180

agctttaagg aatctgatgg caaatagacc tgcaaagtat aaagatgcca atatcatgtc 240

tcctggttca agcttgcctt ctcttcatgt caggaaacaa aaagccctag aagcagaatt 300

agacgcccag catttatcag aaacttttga caatattgac aatttaagtc ccaaggcatc 360

tcatcgtagt aagcaaagac acaagcaaaa tctctacggt gactatgctt ttgatgccaa 420

tcgacatgac gataataggt cagacaattt taatactgga aacatgactg tcctgtcacc 480

atatttaaat actacagtgt tgcccagctc ctcttcatca aggggaagtt tagatagttc 540

tcgttctgag aaagacagaa gtttggagag agaacgaggt attagcatag gcaactacca 600

tccagcaaca gaaaatccag gaacctcttc aaagcgaggt ttgcagattt ccaccactgc 660

agcccagatc gccaaagtca tggaagaagt atcagccatt catccctccc aggaagacag 720

aaattctggg tcaaccacgg agttgcactg tgggacagat gagaggaatg cactgagaag 780

aagctctact gcccactcac acgcaaacac gtacaacttc accaagtcag aaaactcaaa 840

caggacatgt ccaatgccat atgccaaagt agaatataag agatcttcaa atgatagttt 900

aaatagtgtc agtagtagtg atggttatgg taaaagaggc cagatgaaac cttcaattga 960

atcctattct gaagacgatg aaagtaaatt ttgcagctat ggtcagtatc cagctgacct 1020

agcccataaa atacatagtg caaatcatat ggatgataat gatggagaac tagatacacc 1080

a 1081

<210> 10

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccccuugaug aagaggagcu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cccagcuccu cuucaucaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 12

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

uucugagaaa gacagaaguu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agaaguuugg agagagaacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agagaacgag guauuagcau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 15

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccaggaaccu cuucaaagcg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 16

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggagaga acgaggtatt agcatgtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 17

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggccagg aacctcttca aagcggtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210> 18

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ggagagaacg agguauuagc auguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

<210> 19

<211> 102

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ggccaggaac cucuucaaag cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60

uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims (16)

1, application of APC-gRNA5, APC-gRNA6 and NCN proteins in preparation of a kit;

the APC-gRNA5 is sgRNA, and a target sequence binding region is shown as SEQ ID NO:18, nucleotides 3-22; the APC-gRNA6 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:19 at nucleotides 3-22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing a cell model of adenomatous polyposis or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing colorectal cancer model pigs; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

2, application of APC-gRNA5, APC-gRNA6 and PRONCN proteins in preparation of a kit;

APC-gRNA5 is the APC-gRNA5 of claim 1; the APC-gRNA6 is the APC-gRNA6 described in claim 1;

the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing an adenomatous polyposis cell model or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing colorectal cancer model pigs; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

Application of APC-gRNA5, APC-gRNA6 and idiosyncratic particles in preparation of a kit;

APC-gRNA5 is APC-gRNA5 described in claim 1; the APC-gRNA6 is the APC-gRNA6 described in claim 1;

the specific plasmid sequentially comprises the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a PRONCN protein coding gene and a terminator; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing a cell model of adenomatous polyposis or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing a colorectal cancer model pig; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

4. A kit comprising APC-gRNA5, APC-gRNA6, and NCN protein;

APC-gRNA5 is the APC-gRNA5 of claim 1; APC-gRNA6 is the APC-gRNA6 of claim 1; the NCN protein is the NCN protein described in claim 1;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing an adenomatous polyposis cell model or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing colorectal cancer model pigs; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

5.A kit comprises APC-gRNA5, APC-gRNA6, and PRONCN protein;

APC-gRNA5 is the APC-gRNA5 of claim 1; APC-gRNA6 is the APC-gRNA6 of claim 1; the PRONCN protein is the PRONCN protein of claim 2;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing an adenomatous polyposis cell model or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing colorectal cancer model pigs; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

6.A kit comprises APC-gRNA5, APC-gRNA6 and specific plasmids;

APC-gRNA5 is the APC-gRNA5 of claim 1; APC-gRNA6 is the APC-gRNA6 of claim 1; the specific plasmid is the specific plasmid described in claim 3;

the application of the kit is as follows (a), (b), (c), (d) or (e): (a) preparing a recombinant cell; (b) preparing adenomatous polyposis model pigs; (c) Preparing an adenomatous polyposis cell model or an adenomatous polyposis tissue model or an adenomatous polyposis organ model; (d) preparing a colorectal cancer model pig; (e) Preparing a colorectal cancer cell model or a colorectal cancer tissue model or a colorectal cancer organ model.

7. A method of making a recombinant cell comprising the steps of: co-transfecting pig cells with APC-gRNA5, APC-gRNA6 and NCN protein to obtain recombinant cells; APC-gRNA5 is the APC-gRNA5 of claim 1; the APC-gRNA6 is the APC-gRNA6 described in claim 1; the NCN protein is the NCN protein according to claim 1.

8. The use according to claim 1 or the kit according to claim 4 or the method according to claim 7, characterized in that: the NCN protein is shown as SEQ ID NO:3, respectively.

9. The use or kit or method according to claim 8, wherein:

the preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain recombinant bacteria;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-D-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting the strain;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of His-bearing protein from the crude protein solution using affinity chromatography ₆ A tagged fusion protein;

(5) By means of a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence SEQ ID NO:1, 5209 to 9852 th nucleotide.

10. Recombinant cells produced by the method of claim 7 or 8 or 9.

11. Use of the recombinant cell of claim 10 for the preparation of a swine model for adenomatous polyposis.

12. Pig tissue, pig organs or pig cells of a model pig with adenomatous polyposis prepared using the recombinant cell of claim 10.

13. The use of the recombinant cell of claim 10, the porcine tissue of claim 12, the porcine organ of claim 12, the porcine cell of claim 12, or the adenomatous polyposis model porcine prepared by using the recombinant cell of claim 10, wherein the cell is (d 1) or (d 2) or (d 3) or (d 4):

(d1) Screening a medicine for treating adenomatosis polyposis;

(d2) Evaluating the drug effect of the adenomatous polyposis drug;

(d3) Evaluating the efficacy of gene therapy and/or cell therapy for adenomatous polyposis;

(d4) The pathogenesis of adenomatous polyposis was studied.

14. Use of the recombinant cell of claim 10 for the preparation of a colorectal cancer model pig.

15. Porcine tissue, porcine organ or porcine cells of a colorectal cancer model pig prepared using the recombinant cells of claim 10.

16. Use of the recombinant cell of claim 10, the porcine tissue of claim 15, the porcine organ of claim 15, the porcine cell of claim 15, or a colorectal cancer model pig prepared using the recombinant cell of claim 10, in (e 1) or (e 2) or (e 3) or (e 4) as follows:

(e1) Screening a drug for treating colorectal cancer;

(e2) Evaluating the drug effect of the colorectal cancer drug;

(e3) Performing an evaluation of the efficacy of gene therapy and/or cell therapy of colorectal cancer;

(e4) The pathogenesis of colorectal cancer is studied.

Images