CN115216531A

CN115216531A - Novel APC gene mutation c.794_795insG and diagnostic reagent thereof

Info

Publication number: CN115216531A
Application number: CN202210765619.6A
Authority: CN
Inventors: 曾桥; 伊宁; 罗娇娇
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2022-10-21

Abstract

The invention provides a novel APC gene mutation c.794_795insG and a diagnostic reagent thereof, belonging to the technical field of medical diagnosis. The invention discovers for the first time that the mutation of the APC site NM-000038.5. The research result of the invention can be used for genetic diagnosis of familial adenomatous polyposis.

Description

Novel APC gene mutation c.794_795insG and diagnostic reagent thereof

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to a novel APC gene mutation c.794_795insG and a diagnostic reagent thereof.

Background

Familial adenomatous polyposis is a hereditary disease with a predisposition to colon cancer, with an incidence of 1/8000-1/12000 in newborns and 1/24000 in the population. The penetrance of the disease is almost 100%, and accounts for about 1% of the etiology of colorectal cancer. Typical familial adenomatous polyposis, with hundreds or even thousands of adenomatous polyps present in the early adult colon as the main clinical manifestation, carries a high risk of carcinogenesis, and almost all patients will develop colorectal cancer if left untreated. Patients with classic familial adenomatous polyposis are often associated with various extra-intestinal pathologies, including fundal polyps, duodenal polyps, osteoma, tooth abnormalities, congenital retinal pigment epithelial cell hypertrophy, desmoid tumors, epidermal cysts and various related cancers. The syndrome also known as Gardner's syndrome, which accompanies extra-intestinal tumors.

Familial adenomatous polyposis is caused by mutation of the MUTYH gene (MIM 604933) in a few cases, and belongs to autosomal recessive inheritance. Most of the mutations in the APC (MIM 611731) gene are autosomal dominant inheritance. The APC gene is located on chromosome 5p22.2, has the full length of 139kb, comprises 16 exons and 15 introns and encodes 2828 amino acids; the APC gene mutation currently and internationally recorded in the Human Gene Mutation Database (HGMD) is more than one thousand, and the types of mutation involved include: nonsense, missense, splice, regulatory region, deletion, insertion, and complex rearrangement mutations, most of which are missense or frameshift mutations, will result in truncated APC protein products.

The APC gene is a cancer suppressor gene, and is expressed in many cells and tissues. The encoded APC protein is involved in Wnt signal pathway, and maintains low level of beta catenin in cytoplasm by regulating degradation of beta catenin, thereby inhibiting transcription of target oncogene. If the APC gene is mutated, the original stable state of the beta catenin is destroyed, and the transcription of the target oncogene is promoted, thereby causing the formation of a tumor. Therefore, gene mutation is an important genetic basis for the development of diseases, and gene diagnosis is an important genetic standard for determining the familial adenomatous polyposis. The clinical need is to establish corresponding detection technology aiming at different mutations and to be used for determining the cause and disease diagnosis.

Disclosure of Invention

In view of the above, the present invention aims to provide a novel APC gene mutation c.794_795insG and a diagnostic reagent thereof, which can assist in screening and diagnosing the gene mutation of the gonadal polyposis of family, and provide a novel technical support for drug screening, drug efficacy evaluation and targeted therapy.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a detection reagent for diseases caused by gene mutation, wherein the site of the gene mutation is APC (NM-000038.5);

the detection reagent comprises a specific amplification primer designed aiming at the site of the gene mutation.

Preferably, the disease caused by gene mutation comprises familial adenomatous polyposis.

Preferably, the specific amplification primer comprises APC-F and APC-R, the nucleotide sequence of the APC-F is shown as SEQ ID NO.1, and the nucleotide sequence of the APC-R is shown as SEQ ID NO. 2.

The invention also provides a detection kit for the familial adenomatous polyposis, which comprises the detection reagent.

Preferably, the kit further comprises reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

Preferably, the sequencing primer comprises APC-SeqF and APC-SeqR, the nucleotide sequence of the APC-SeqF is shown in SEQ ID NO.3, and the nucleotide sequence of the APC-SeqR is shown in SEQ ID NO. 4.

The invention also provides the application of the detection reagent or the detection kit in preparing a diagnostic reagent for familial adenomatous polyposis.

Preferably, the test sample of the diagnostic reagent comprises blood.

Has the advantages that: the invention provides a detection reagent for diseases caused by gene mutation, and particularly defines the gene mutation site as APC-NM-000038.5. The invention firstly discovers that the mutation of the APC-NM-000038.5-c.794-u 795 insG-p.265fs 10 site can cause the onset of familial adenomatous polyposis by exome sequencing technology. The invention is used for screening or diagnosing the genetic diagnosis of the familial adenomatous polyposis by detecting whether a subject carries the mutation or not in the embodiment so as to guide the treatment and the bearing and rearing of good prenatal and postnatal care. The detection kit provided by the invention can be used for quickly and effectively predicting or diagnosing the familial adenomatous polyposis. The invention lays an important foundation for the research of the pathogenesis of the familial adenomatous polyposis and provides a brand new theoretical basis for the treatment of the patients with the familial adenomatous polyposis. The invention can provide possible drug targets for treating familial adenomatous polyposis.

Drawings

FIG. 1 is a family genetic map of familial adenomatous polyposis No. 1; wherein □ represents a male normal individual, ● represents a female patient, ■ represents a male patient, ↗ represents a proband,

it is indicative of a female patient who is dead,

indicating a deceased male patient;

FIG. 2 is a graph showing the results of Sanger sequencing for the genotype of APC at the site of family 1, NM-000038.5;

FIG. 3 shows a family genetic map of familial adenomatous polyposis No. 2; wherein □ represents a male normal individual, ● represents a female patient, ■ represents a male patient, ↗ represents a proband,

it is meant that the female individual is dead,

indicating a deceased male patient;

fig. 4 shows a graph of the results of using the kit to detect the genotype of the APC site of family 2, NM — 000038.5.

Detailed Description

The invention provides a detection reagent for diseases caused by gene mutation, wherein the locus of the gene mutation is APC (NM-000038.5);

The disease caused by the gene mutation of the invention preferably comprises familial adenomatous polyposis. The site of the gene mutation of the invention has the gene mutation of c.794_795insG (figure 1), and if the genotype of the APC: NM-000038.5.

The specific amplification primer of the invention preferably comprises APC-F and APC-R, and the nucleotide sequence of the APC-F is preferably shown in SEQ ID NO. 1: CCCCTTACCGAGATAGTC, the nucleotide sequence of APC-R is shown in SEQ ID NO. 2: TTAGTGAAAGAGCAAACCT.

The kit of the present invention preferably further comprises reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing. The reagent for PCR amplification reaction of the present invention preferably comprises dNTP, PCR buffer solution, magnesium ions and Tap polymerase. The sequencing primer preferably comprises APC-SeqF and APC-SeqR, and the nucleotide sequence of the APC-SeqF is preferably shown in SEQ ID NO. 3: TAAGAAAGCCTACACCATTT, the nucleotide sequence of the APC-SeqR is preferably as shown in SEQ ID NO. 4: TCAAAATGCAGCTTAGAGTT.

The genotype of the aforementioned gene mutation site can be detected by using the detection reagent of the present invention or the detection kit, and the detection method preferably comprises: 1) Extracting sample genome DNA; 2) Amplifying an APC gene sequence; 3) DNA sequencing; 4) Comparing the DNA sequencing result of the sample to be detected with a normal human genome DNA sequence, and if the genotype of the APC, NM-000038.5; if the site has no mutation, the APC gene is judged to be wild type, and the individual is a normal person.

The sample according to the invention preferably comprises blood. The present invention is a system for performing PCR amplification using the above primer using genomic DNA extracted from blood as a template, and the amplification system preferably comprises, in 20. Mu.L: 2.0. Mu.L of 10 XPCR buffer, 0.4. Mu.L of 10mmol/L dNTPs, 0.5. Mu.L of 100 ng/mu.L LAPC-F,mu.L of 100 ng/. Mu.LAPC-R, 0.5. Mu.L of 100 ng/. Mu.L template, 0.2. Mu.L of 5U/. Mu.L Taq enzyme, and the balance ddH ₂ And (O). The procedure for amplification according to the invention preferably comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 48 ℃ for 30s, extension at 72 ℃ for 60s,30 cycles; extending for 7min at 72 ℃; storing at 4 ℃.

According to the invention, after the PCR amplified product is purified, the purified product is sequenced, the sequencing preferably comprises the utilization of APC-SeqF or APC-SeqR, and the sequencing procedure preferably comprises the following steps: pre-denaturation at 96 ℃ for 1min; denaturation at 96 ℃ for 30s, annealing at 55 ℃ for 15s, extension at 60 ℃ for 4min, and 33 cycles; storing at 4 ℃. The purification of the invention preferably comprises the steps of purifying PCR amplification products, performing BigDye reaction on the purified PCR products by using a sequencing primer, purifying the BiyDye reaction products, and sequencing the BiyDye reaction products.

The invention also provides application of the detection reagent or the detection kit in preparation of a diagnostic reagent for familial adenomatous polyposis.

The test sample of the diagnostic reagent of the present invention preferably includes blood. The method of using the diagnostic reagent of the present invention is preferably the same as described above, and will not be described herein.

The present invention provides a novel APC gene mutation c.794_795insG and a diagnostic reagent thereof, which are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention. In the present invention, the term "diagnosis" includes prediction of the risk of a disease, diagnosis of the presence or absence of the disease, and evaluation of the prognosis of the disease; the term "mutation" refers to a change in the sequence of a wild-type polynucleotide to a variant, which may be naturally occurring or non-naturally occurring; "primer" refers to a polynucleotide fragment, typically an oligonucleotide, for amplifying a target nucleic acid in a PCR reaction, e.g., a polynucleotide fragment containing at least 5 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the gene of interest to be amplified or its complementary strand, as long as it can specifically amplify the gene of interest. In the present invention, the term "specifically amplifying" means that a primer is capable of amplifying a target gene through a PCR reaction without amplifying other genes. For example, specifically amplifying the APC gene means that a primer amplifies only the APC gene, and does not amplify other genes in a PCR reaction.

Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: cold Spring Harbor laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1 sample acquisition

The inventor finds a family of gonadal adenomatous polyposis (abbreviated as APC family), and the clinical information of partial members of the APC family is shown in Table 1. FIG. 1 shows APC gene mutation pedigrees, wherein □ represents a male normal individual, ● represents a female patient, ■ represents a male patient, ↗ represents a proband,

indicating that the female patient is dead,

indicating a deceased male patient.

1. Diagnostic criteria:

refer to the characteristics and diagnosis and treatment standard of hereditary colorectal cancer syndrome of Chinese people 2015 edition:

1) Diagnostic criteria

The clinical diagnosis of familial adenomatous polyposis depends mainly on the clinical manifestations of the patient. The diagnosis standard of the familial adenomatous polyposis proposed by the Chinese hereditary colorectal cancer cooperative group conference in 2003 is as follows: (1) more than 100 diffuse adenomatous polyps in the large intestine; (2) adenomatous polyps do not exceed 100 but are associated with family history or congenital retinal pigment epithelial hypertrophy.

2) Clinical features

Colorectal widespread adenoma is the main characteristic of familial adenomatous polyposis and is often accompanied with appearance of intestines, such as gastroduodenal polyp, desmoid tumor, thyroid tumor, brain tumor, osteoma, congenital retinal pigment epithelial hypertrophy, multiple raw teeth, epidermoid cyst and the like. Familial adenomatous polyposis accompanied by extra-intestinal diseases is also called Gardner syndrome, wherein familial adenomatous polyposis accompanied by brain tumor is also called Turcot syndrome. Intestinal symptoms often appear in the early stage of the disease, and blood in the stool, anemia, malignant transformation and the like can appear in the later stage. Almost all patients with classical familial adenomatous polyposis develop colorectal cancer by the age of 40 to 50 years without treatment.

3) Genetic characterization

Typical familial adenomatous polyposis is autosomal dominant hereditary disease, caused by germline mutation of the APC gene, the greater the number of adenomas, the greater the probability of detecting mutation of the APC gene. The APC gene is a cancer suppressor gene, and can inhibit Wnt signal pathway and regulate cell proliferation and differentiation. Familial adenomatous polyposis has gene-phenotype correlation, namely, the clinical phenotype of patients with mutation at codons 1250-1464, particularly codon 1309 is more serious. According to statistics, 30-40% of patients with familial adenomatous polyposis have no clear family history, which indicates that the APC gene has new mutation.

TABLE 1 clinical information on family members of family No.1 of adenomatous polyposis of family

Note: in FIG. 1 and Table 1, the numbers are I (first generation) and II (second generation).

The peripheral blood DNA of family 1, II 1 (proband), II 2 (sister) and II 3 (brother) is used for sequencing analysis.

Example 2 exon sequencing

1. The instrumentation is shown in table 2.

Table 2 Instrument and Equipment List

Name of instrument	Manufacturer of the product
		High throughput sequencer NextSeq500	Illumina
QubitFluorometer nucleic acid quantitative meter	Invitrogen
		PCR instrument	Bio-RAD
Centrifuge 5810R	Eppendorf
		Centrifuge 5424	Eppendorf
5418 Small high-speed centrifuge	Eppendorf
		Biological safety cabinet	Sujing medicine
Super clean bench	Sujing medicine
		Ice maker	Grant
UPS power supply	Santa
		MilliQ ultrapure water instrument	Millipore
High performance computer (including server, cabinet, exchanger, storage, etc.)	DELL
		-25 ℃ refrigerator	Mitsubishi
Ultra-low temperature refrigerator	Eppendorf
		Microwave oven with a heat exchanger	Beauty treatment

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).

3. Reagent formulation

A stock solution of 5 XTBE electrophoresis solution was prepared as shown in Table 3.

TABLE 3 formulation of 5 XTBE electrophoretic solutions

Reagent	Volume/weight
		Tris	5.4g
Boric acid	750mg
		EDTA(pH8.0,0.5mol/L)	2mL
ddH ₂ O	90mL

By ddH ₂ O adjusted the final volume to 100mL.

Working solution of 0.5 XTBE electrophoresis solution by ddH ₂ Diluting with O by 10 times.

10 × erythrocyte lysates were prepared according to table 4.

TABLE 4 erythrocyte lysate recipe

Reagent	Volume/weight
		NH ₄ Cl	82.9g
KHCO ₃	10g
		EDTA	0.37g
Adding dH ₂ O	To 1000mL

Autoclaving, and storing at 4 deg.C.

1 × cell nucleus lysate was prepared according to Table 5.

TABLE 5 cell nucleus lysate recipe

Reagent	Volume/weight
		2MTris-HCl,pH8.2	0.5mL
4MNaCl	10mL
		2mMEDTA	0.4mL

4. Experimental procedure

After signing an informed consent, 3-5 mL of peripheral blood of the members II 1, II 2 and II 3 of the family are collected.

4.1 sample DNA extraction

1) If the sample is heparin anticoagulated peripheral blood, 3-5 mL of peripheral blood is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with 2-3 times volume is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30min until the solution becomes transparent.

2) Centrifuge at 3000rpm for 10min at 4 ℃ and carefully remove the supernatant. Adding 1mL of 1 × cell nucleus lysate to the precipitate, mixing, adding 2mL of 1 × cell nucleus lysate and 150 μ L of 20% SDS, shaking until a viscous and transparent state appears. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digesting for more than 6h or overnight at 37 ℃.

3) Adding equal volume of saturated phenol, shaking gently, mixing, and centrifuging at 3000rpm for 10min at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1 v/v), and centrifuged at 3000rpm for 10min at room temperature.

5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.

6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out with a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5min, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring the OD value by ultraviolet.

7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.

4.2 exon sequencing

1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering 150-250 bp fragments;

2) Carrying out end repair on the DNA fragment and adding A at the 3' end;

3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing agarose gel electrophoresis on a small sample for quality control analysis;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 results

Finally, 1 gene mutation APC of pathogenic significance was obtained, NM — 000038.5; the subsequent frame shift may occur, the 10 amino acid coding is terminated, and the mutated APC protein becomes a truncated protein with 275 amino acid residues and 2553 amino acid residues which are normal 2828 amino acid residues. The genotype at the APC-NM — 000038.5, exon8, c.794 \ u 795insg.

Example 3Sanger sequencing validation

The APC: NM — 000038.5, exon8, c.794 \ u 795insg, p.265fs 10 sites were further verified using Sanger sequencing for exome sequencing results. The site genotype test for APC, NM — 000038.5.

The method comprises the following specific steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 1.

2. Candidate primer design, validation and optimization.

2.1 primer design reference human genome sequence database hg 19/built 36.3. The primer sequence was synthesized by Shanghai Biotechnology.

2.2 aiming at the c.794_795insG locus, 15 pairs of candidate primers are respectively designed (see table 6, SEQ ID NO. 1-2 and SEQ ID NO. 6-33 in sequence), and PCR experiments are utilized to verify and evaluate the advantages and disadvantages of each pair of candidate primers.

TABLE 6 basic condition of each pair of candidate primers and a list of the results of the verification experiment

Note: only one specific band exists after electrophoresis of a normal PCR amplification result, and if a primer dimer band and a non-specific product band appear, the primer dimer band and the non-specific product band are both the results of primer abnormal reaction; the target primer avoids this as much as possible. The optimal primer pair is additionally evaluated and selected comprehensively with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G + C is preferably 40-60%, the amplification effect is poor when the content of G + C is too small, and a non-specific band is easy to appear when the content of G + C is too large. ATGC is preferably randomly distributed;

(3) avoid a tandem reference of more than 5 purine or pyrimidine nucleotides;

(4) no complementary sequence should be present inside the primer;

(5) there should be no complementary sequence between the two primers, especially to avoid complementary overlap at the 3' end;

(6) the homology of the primer with the sequence of the non-specific amplification region does not exceed 70 percent, and the continuous 8 bases at the tail end of the primer 3' can not have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easily caused;

2.3 candidate primer PCR validation reactions

PCR was performed according to the reaction system in table 7 and kept on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 7) were provided for each pair of primers.

TABLE 7 primer verification detection PCR reaction System

Reaction conditions are as follows: the test reaction tube is placed into a PCR instrument, and the following reaction procedures are carried out:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 sec → Tm,30 sec → 72 ℃,60 sec); (the PCR amplification parameters were set according to the Tm values of the primers in Table 6, and the Tm average value was taken for the double primers).

The third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

2.4 agarose gel electrophoresis detection of the candidate primer PCR results to evaluate the effectiveness and specificity of the primer reaction:

1) The two ends of the washed and dried gel sample former are sealed by an adhesive tape, the gel sample former is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample former.

2) Weighing 2g agar powder into a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, shaking, heating until the gel is completely melted, and cooling at room temperature.

3) And when the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sample injector to ensure that the thickness is about 5 mm.

4) The gel is solidified, the adhesive tape is removed, and the gel and the sample injector are placed into an electrophoresis tank.

5) Adding electrophoresis buffer solution to make the liquid level 1-2mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively and uniformly mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipette, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.

6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate the electrophoresis.

7) The power supply was cut off, the gel was taken out and placed in EB aqueous solution of 0.5g/ml to stain for 10-15 minutes.

8) The gel was placed under a transmission ultraviolet irradiator to observe the result at a wavelength of 254nm, and photographed with a camera with a red color filter or the electrophoresis result was recorded with a gel scanning system.

2.5 evaluation of results:

1) If the No. 7 tube only has a bright and clear target band and no other band, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;

2) If no target band appears in the No. 7 tube, judging that the pair of primers and the reaction system are invalid;

3) If the primer-primer dimer band outside the target entry appears in the No. 7 tube and the primer-dimer band also appears in the No.2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;

4) If the non-specific band outside the target band appears in the No. 7 tube and the non-specific band also appears in the No.5 and No.6 tubes, the specificity of the pair of primers and the reaction system is judged to be poor;

5) If the primer dimer and the non-specific band appear outside the target band in the No. 7 tube, and the primer dimer and the non-specific band also appear in the No.2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the results of statistics after the verification test in Table 7, the most preferable pair (pair No.1 in Table 6) was selected as a primer for detecting a mutant family.

3. Mutation sites of family 1 and 100 family members were PCR amplified.

PCR was performed according to the reaction system in Table 8 while keeping the reaction system on ice.

TABLE 8 mutant site PCR reaction System

Reagent	Volume of
		10 XPCR buffer	2.0μL
10mmol/L dNTPs	0.4μL
		100ng/μL APC-F	0.5μL
100ng/μL APC-R	0.5μL
		DNA extraction from 100 ng/. Mu.L peripheral blood	1.0μL
5 u/. Mu.L Taq enzyme	0.2μL
		ddH ₂ O	15.4μL

Reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction sequence was performed:

the first step is as follows: 95 ℃ for 5min;

the second step: 30 cycles (95 ℃,30s → 48 ℃,30s → 72 ℃,60 s);

the third step: 72 ℃ for 7min;

the fourth step: 4 ℃ until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. And (3) carrying out enzymolysis purification on a PCR product: mu.L of exonuclease I (Exo I) and 1. Mu.L of alkaline phosphatase (AIP) were added to 5. Mu.L of the LPCR product, respectively, and digested at 37 ℃ for 15min and the enzyme was inactivated at 85 ℃ for 15min.

6. BigDye reaction

The BigDye reaction system is shown in table 9.

TABLE 9 BigDye reaction System

Reagent	Dosage of
		Purity of PCR productPost-digestion DNA	2.0μL
3.2 pmol/. Mu.L sequencing primer	1.0μL
		BigDye	0.5μL
5 xBigDye sequencing buffer	2.0μL
		ddH ₂ O	4.5μL

7. Purification of BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, to the bottom of the tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added;

2) Adding 70 μ L70% ethanol, shaking and mixing for 4 times, standing at room temperature for 15min;

3) 3000g, centrifuging at 4 deg.C for 30min; immediately inverting 96-well plate, centrifuging at 185g for 1min;

4) Standing at room temperature for 5min, allowing residual ethanol to evaporate at room temperature, adding 10 μ L Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on computer.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, designing a nested primer (the second group of primers are designed in the range of the product sequence obtained by amplifying the first group of primers) as a sequencing primer on the basis of the PCR optimal primer, wherein the primer sequence is shown as SEQ ID NO.3 and SEQ ID NO. 4.

Sequencing PCR cycling conditions:

the first step is as follows: at 96 ℃ for 1min;

the second step: 33 cycles (96 ℃,30s → 55 ℃,15s → 60 ℃,4 min);

the third step: 4 ℃ until sampling.

9. Analysis of results

The Sanger sequencing results in figure 2 show that the genetype of the home-line 2 patients APC: NM — 000038.5. The positions indicated by arrows in the sequencing diagram of fig. 2 show that the a and B layers show that the APC for patients with familial adenomatous polyposis is a "c.794_795 insG" mutation.

Example 4APC gene c.794_795insG mutation diagnosis kit and application

1. The kit comprises the following components:

1) An amplification primer: as shown in example 3

2) Buffer solution

3) Taq enzyme

4)dNTPs

5) And C.794-795 insG positive mutation reference substance DNA, wherein the reference substance is a section of double-stranded DNA, and the specific sequence is shown as SEQ ID NO. 5.

6) Sequencing primer: as shown in example 3

2. The using method comprises the following steps:

the method is applied to the detection of the mutation of the No.2 family.

TABLE 10 clinical information on family members of family No.2 of adenomatous polyposis of family

As shown in FIG. 3, I (first generation), II (second generation) and III (third generation) are used as the numbers.

The peripheral blood DNA of family members II 1 (proband father), II 2 (proband mother) and III 1 (proband) is used for the detection and analysis of the kit.

1) Extracting genome DNA: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;

3) Purifying PCR amplification products;

4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;

5) Purifying the BiyDye reaction product;

6) The BiyDye reaction products were sequenced and the sequence compared to the normal sequence.

The kit test results in fig. 4 show that the genotype of the site of proband and mother in family 2, APC, NM — 000038.5. The positions indicated by arrows in the sequencing diagram of fig. 4 show that the B-and C-layers show that the APC for familial adenomatous polyposis patients is a "c.794_795 insG" mutation.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> Hunan Jiahui Biotechnology Ltd

<120> novel APC gene mutation c.794_795insG and diagnostic reagent therefor

<160> 33

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccccttaccg agatagtc 18

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttagtgaaag agcaaacct 19

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

taagaaagcc tacaccattt 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaaaatgca gcttagagtt 20

<210> 5

<211> 740

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccccttaccg agatagtcga ccgccaatcg tactggaggt tatgaagtgt aatacacagt 60

tccatgcctt tatcagtctg tataattgat gcattcagag ctttaaagca aaaaaagaaa 120

aaaagccttg ggctaagaaa gcctacacca tttttgcatg tactgatgtt aactccatct 180

taacagaggt catctcagaa caagcatgaa accggctcac atgatgctga gcggcagaat 240

gaaggtcaag ggagtgggag aaatcaacat ggcaacttct ggtaatggtc aggtaaataa 300

attattttat catatttttt aaaattattt aaatatcaga aaagtatgaa gcaagatggt 360

tctaagaatg atctataaat cttacctatt ttcttagtcc tgaatgcata tttccagaag 420

cattcagtac caatgtgctg tcatttctct ttattatatc agcaataatg ctgtaaggat 480

tttctagatc tatttctata gctatagatt gtgtgtttat gttttagtct aaaatgattg 540

tgagtagttt tttttaataa ctctaagctg cattttgatt atgtatatga tttgacctag 600

ttatttttgc ttgccttgaa taggtttgct ctttcactaa gaccttcaat gtaaagacat 660

ttttatggtt ttttttaaag ttataaaggc tttatttcct gttgtactta aagattatat 720

aaatctagaa atccaagtct 740

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cccttaccga gatagtc 17

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agtgaaagag caaacct 17

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gatggcattc ctgtgagtc 19

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttagtgaaag agcaaacct 19

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctacttgggt tatgttcct 19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcaaaatgca gcttagagt 19

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tatttgttct acttgggtt 19

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttcagtaag acttggatt 19

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agctccatta aatgtcaga 19

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttagtgaaag agcaaacct 19

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ttccccttac cgagatagt 19

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ttagtgaaag agcaaacct 19

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttccccttac cgagatagtc 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atcaaaatgc agcttagagt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gggttatgtt cctgatagta 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gtcttagtga aagagcaaac 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

acttgggtta tgttcctgat 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cattggtact gaatgcttct 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

cagctccatt aaatgtcaga 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

cttagtgaaa gagcaaacct 20

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gttatttgtt ctacttgggt t 21

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ttttcagtaa gacttggatt 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

ttccccttac cgagatagtc 20

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gtcttagtga aagagcaaac 20

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

gggttatgtt cctgatagta 20

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

cagtaagact tggatttcta 20

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

atgcctttat cagtctgtat a 21

<210> 33

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

ttaggccatg ttgccttact t 21

Claims

1. A reagent for detecting a disease caused by a gene mutation, wherein the gene mutation is at the site APC of NM-000038.5;

2. The detection reagent according to claim 1, wherein the disease caused by gene mutation comprises familial adenomatous polyposis.

3. The detection reagent according to claim 1, wherein the specific amplification primer comprises APC-F and APC-R, the nucleotide sequence of the APC-F is shown as SEQ ID No.1, and the nucleotide sequence of the APC-R is shown as SEQ ID No. 2.

4. A kit for detecting familial adenomatous polyposis, comprising the detection reagent according to any one of claims 1 to 3.

5. The detection kit of claim 4, further comprising reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

6. The detection kit according to claim 5, wherein the sequencing primer comprises APC-SeqF and APC-SeqR, the nucleotide sequence of the APC-SeqF is shown as SEQ ID No.3, and the nucleotide sequence of the APC-SeqR is shown as SEQ ID No. 4.

7. Use of the detection reagent according to any one of claims 1 to 3 or the detection kit according to any one of claims 4 to 6 for the preparation of a diagnostic reagent for familial adenomatous polyposis.

8. The use of claim 7, wherein the test sample of diagnostic reagent comprises blood.