CN115191523B

CN115191523B - Production method of water quality improved type fermented feed and application of water quality improved type fermented feed in aquaculture

Info

Publication number: CN115191523B
Application number: CN202210734463.5A
Authority: CN
Inventors: 陈华友; 蔡康涛; 吴正粉; 卢晨曦; 姚丹; 陈华撑
Original assignee: Individual
Current assignee: Individual
Priority date: 2022-06-27
Filing date: 2022-06-27
Publication date: 2023-12-26
Anticipated expiration: 2042-06-27
Also published as: CN115191523A

Abstract

The invention belongs to the field of biological feeds, and relates to a water quality improvement type fermented feed production method and application thereof in aquaculture; the method comprises the following steps: screening candida utilis with better inorganic nitrogen conversion capability in fermentation strains, activating bifidobacterium lactis, lactobacillus plantarum and bacillus subtilis cooperatively to obtain fermentation seed liquid, inoculating the fermentation seed liquid into an anaerobic fermentation medium for fermentation, and obtaining a finished feed product after fermentation; and detecting the number of candida utilis viable bacteria in the fermented feed by using a PMA-qPCR method; alpha-starch and xanthan gum can be further added to serve as an adhesive, so that the stability of the feed in water can be improved when the feed is used for aquaculture. The feed can effectively purify water quality, efficiently convert inorganic nitrogen and remarkably improve aquaculture benefits; in addition, carbon sources can be added to control the carbon-nitrogen ratio to be 10-20, so that inorganic nitrogen in the water body can be converted better and faster, the flora structure of the water body can be optimized, disease and other bacteria can be inhibited, the animal production performance can be improved, and the immune index can be improved.

Description

Production method of water quality improved type fermented feed and application of water quality improved type fermented feed in aquaculture

Technical Field

The invention belongs to the field of biological feeds, and particularly relates to a production method of a water quality improvement type fermented feed and application of the water quality improvement type fermented feed in aquaculture.

Background

In recent years, aquaculture has the problems of poor water quality, low feeding benefit and the like caused by the excretion of cultured animals due to excessive feed feeding and low feed utilization rate. The biological flocculation technology is applied to solve the problems of excessive inorganic nitrogen and frequent water change in the aquaculture, and the addition of probiotics is a common means for helping to purify water quality, reduce disease bacteria and improve animal immunity. However, when the carbon source is blindly added to improve the water quality, a great amount of mixed bacteria grow in the water body, and a certain risk is brought to the aquaculture. Microorganisms are important constituent units in a water body, and the functions of biological flocs are affected by the change of microbial community structures. How to artificially and directionally control the flora structure is a key technology in the regulation and control of aquaculture. The mode of strain throwing includes direct bacterial liquid throwing, feeding bacterial liquid mixed feed, preparing live bacterial fermentation material, etc. and the bacterial liquid throwing has high work load and high cost.

At present, a plurality of researches are carried out on applying candida utilis to various feed preparations, for example, a plant extract and a probiotics preparation containing candida utilis are compounded in patent CN202210051444.2 to improve animal immunity. CN202011394949.6 adopts different traditional Chinese medicine combinations as fermentation raw materials, and utilizes probiotics containing candida utilis to prepare the preparation by fermentation. The two patent patents do not describe the reason of selecting candida utilis and matching other strains in terms of strain influence, and the influence of candida utilis viable bacteria in the corresponding application examples is not accurately explored. In particular, like in patent CN202011394949.6, the candida utilis culture solution and the solid base material are mixed and fermented for 24 hours in step 3, and then dried at 45 ℃ for 48 hours, the viable count is difficult to ensure, so that the viable count of candida utilis is ensured by supplementing viable in later step 6, the manufacturing steps are relatively complex, and the effect is still to be improved. The candida utilis used in these documents as a whole does not play a role in improving water quality; meanwhile, researches on fermented feeds for improving water quality in aquaculture are also freshly reported.

Disclosure of Invention

According to the invention, from strain screening, the candida utilis which efficiently utilizes tri-state inorganic nitrogen is obtained through screening probiotics, and the live bacteria of the candida utilis can be found to effectively inhibit the growth of the live bacteria of aeromonas hydrophila, so that the candida utilis is determined to be used as a main fermentation strain for preparing fermented feed, and a certain live bacteria content of the candida utilis in the fermentation process is ensured, thus providing a foundation for water quality improvement. The invention aims to provide a special preparation method of water quality improvement type aquatic fermentation feed, which can improve the utilization rate of the feed and the intestinal tract, particularly improve the water quality, convert ammonia nitrogen, control bacterial colony and inhibit harmful bacteria. The fermentation conditions are controlled by screening candida utilis for efficiently converting ammonia nitrogen, matching lactobacillus bifidus, lactobacillus plantarum and bacillus subtilis to perform anaerobic solid fermentation on bean pulp, bean dregs and wheat middling, so that the fermented feed rich in candida utilis viable bacteria is prepared, the content of small peptide is high, the acid fragrance is provided, the candida utilis viable bacteria is high, the palatability is good, the feed utilization rate is high, the production cost is low, and the water quality improvement effect of the culture pond is strong.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

(1) Inoculating bacillus subtilis, candida utilis, lactobacillus plantarum and bifidobacterium lactis into corresponding liquid culture mediums respectively for activation culture, and obtaining fermentation seed liquid of each strain after culture;

(2) Respectively inoculating the seed liquid obtained in the step (1) into anaerobic fermentation culture mediums, and uniformly mixing to obtain an anaerobic fermentation mixture, wherein the anaerobic fermentation culture mediums comprise the following components in percentage by weight: 40-55% of bean pulp, 35-40% of bean dregs and 8-10% of secondary powder;

the fermentation temperature is adjusted to be 20-35 ℃, the water content of the culture medium is 38-55%, anaerobic fermentation is carried out under a sealed condition, and the finished product is obtained after 4-30 days of anaerobic fermentation, thus obtaining the candida utilis fermented feed, namely the water quality improvement type fermented feed.

Preferably, the inoculation amount of the candida utilis seed solution in the step (2) is 2-4% of the weight of the anaerobic fermentation medium (v/m, mL/g; namely, 2-4 mL of seed solution is added per 100g of medium; the same applies below); the total viable count of the candida utilis seed solution is 1.3x10 ⁷ ～2.7×10 ⁸ cfu/mL。

Preferably, the inoculation amount of the bacillus subtilis seed liquid in the step (2) is 1% -3% of the weight of the anaerobic fermentation medium; the total number of viable bacteria of the bacillus subtilis seed liquid is 1.0x10 ⁸ ～2.1×10 ⁹ cfu/mL。

Preferably, the lactic acid bacteria seed liquor in step (2) comprises one or more of a bifidobacterium lactis seed liquor and a lactobacillus plantarum seed liquor; the inoculation amount of the bifidobacterium lactis seed liquid is 4-6% (v/m, mL/g) of the weight of the anaerobic fermentation culture medium, and the total viable bacteria of the bifidobacterium lactis seed liquid is 2.5X10 ⁸ ～5.3×10 ⁹ cfu/mL; the inoculation amount of the lactobacillus plantarum seed solution is 1% -4% (v/m, mL/g) of the weight of the anaerobic fermentation medium, and the total number of viable bacteria of the lactobacillus plantarum seed solution is 1.1X10 ⁸ ～3.7×10 ⁹ cfu/mL。

Preferably, the fermentation in step (2) is carried out at a temperature of 25 to 32℃for a period of 5 to 15 days.

Preferably, the water content of the adjustment medium in the step (2) is 40% -50%.

The water quality improvement type fermented feed prepared by the invention is used for being added into aquaculture feed to carry out aquaculture, and the specific operation is as follows: adding candida utilis fermented feed into aquaculture feed to obtain mixed feed for feeding; the addition amount of the candida utilis fermented feed accounts for 25-50% of the weight of the mixed feed, and simultaneously, xanthan gum accounting for 0.2-0.6% of the weight of the mixed feed and/or alpha-starch accounting for 2.5-5% of the weight of the mixed feed are added.

Preferably, when the addition amount of the candida utilis fermented feed is 25% of the weight of the mixed feed, 0.2% -0.4% of xanthan gum is added.

Preferably, when the addition amount of the candida utilis fermented feed is 50% of the weight of the mixed feed, 2.5% -5% of alpha-starch is added.

Preferably, when the mixed feed is fed, after the mixed feed is put into a water body, a carbon source is put into the water body, so that the carbon-nitrogen ratio of the carbon source to the whole mixed feed is 10-20; the carbon source is glucose or molasses.

Preferably, after the preparation of the candida utilis fermented feed is completed, when the addition amount of the candida utilis fermented feed is 25% of the weight of the mixed feed, 0.4% of xanthan gum is added; when the adding amount of the candida utilis fermented feed accounts for 50% of the weight of the mixed feed, adding 2.5% -5% of alpha-starch; which can increase the stability of the feed in water.

The alpha-starch is obtained by preparing soft balls from 8 kinds of starch, namely potato starch, alpha-starch, tapioca starch, corn starch, carboxymethyl starch, barley starch and mung bean starch, matching candida utilis fermented feed and fish meal complete feed, measuring the weight loss rate, comparing and screening.

The xanthan gum is selected from 12 kinds of adhesives of different factories and types in the market: carrageenan, konjaku flour, guar gum, sodium alginate, xanthan gum, L-type carrageenan, K-type carrageenan, guar gum 1600, guar gum 6000 and the like are used for matching biological feed instead of 25% and 50% of fish meal complete feed, and the weight loss rate is measured, compared and screened to obtain the feed.

Preferably, in order to make the benefit better, the effect is best when the C/N is controlled to be 10-20 when the culture water body is put together with the carbon source. Through the use of the cooperation probiotics, the carbon source is added to control the carbon nitrogen ratio entering the water body to be 10-20, so that the released probiotics can be effectively promoted to colonize the water body, the flora structure in the water body is optimized, the water body purification function is enhanced, and the growth of disease miscellaneous bacteria is reduced. Wherein, when the C/N is 15, the candida utilis colonizes the water body with the maximum bacterial count, and the effect is most remarkable.

Strain sources: bacillus subtilis (Bacillus subtilis) CGMCC1.921, bifidobacterium lactis (Bifidobacterim animalis subsp. Lactis) CGMCC1.15623, candida utilis (Candida) CGMCC2.587 and lactobacillus plantarum (Lactobacillus plantarum) CGMCC1.557; the strains are purchased from China general microbiological culture Collection center.

The process is as follows: by expanding and cultivating each fermentation strain, inoculating fermentation strain seed liquid into a solid culture medium for anaerobic fermentation, candida utilis (inoculated with 2% -4%), bacillus subtilis (inoculated with 1% -3%), bifidobacterium lactis (inoculated with 4% -6%) and lactobacillus plantarum (inoculated with 1% -4%), then fermenting at 20-35 ℃ and 38% -55% of water content until 6-30 days are optimal. When the fish meal complete feed is replaced, the stability can be improved by matching 2.5% of alpha-starch and 0.4% of xanthan gum, so that better application of the feed is realized; the feed is matched with a carbon source and put into a culture water body, and the effect is optimal when the C/N is controlled to be 10-20.

1. Screening probiotics with better water quality inorganic nitrogen treatment and conversion

Determination of inorganic nitrogen conversion ability of fifteen strains including bacillus, yeast and lactic acid bacteria: selecting five bacillus, four saccharomycetes and six lactic acid bacteria, and carrying out activation and expansion culture on the five bacillus, the four saccharomycetes and the six lactic acid bacteria by using different culture mediums to obtain seed liquid after activation;

inoculating 1% (V/V) of seed solution to artificial culture wastewater, namely inoculating 1ml of seed solution to 100ml of wastewater, adding inorganic nitrogen sources in single different forms, giving sufficient quick-acting carbon sources (glucose), culturing at 150rpm and 30 ℃ for 24 hours, and measuring the residual content of each inorganic nitrogen in the wastewater; three parallel groups are provided.

From fig. 1, 2 and 3, it can be seen that candida utilis in the probiotics is the strain with the best inorganic nitrogen conversion and utilization capacity; the candida utilis obtained in fig. 4 can be directly used for converting three inorganic nitrogen into mycoprotein.

2. Antibacterial test of candida utilis

1mL of activated aeromonas hydrophila is inoculated into 100mL of culture medium respectively, and the groups are set as single aeromonas hydrophila, 1mL of candida utilis viable bacteria liquid (activated) +aeromonas hydrophila and 1mL of candida utilis dead bacteria liquid (activated, boiled and frozen) +aeromonas hydrophila are added, and shaking table 30 ℃ is used for culturing at 150rpm after the activation. And (3) taking bacterial liquid after 12 hours, performing PMA treatment, and extracting genes to perform aeromonas hydrophila primer qPCR.

The activated aeromonas hydrophila was spread on a solid medium plate, and a small round filter paper sheet (6 mm) was placed, and 10uL of liquid was dropped on the filter paper sheet: respectively a culture medium liquid, an ampicillin (0.2 mg/mL), a candida utilis live bacteria liquid and a candida utilis dead bacteria liquid; placing the culture medium in a constant temperature incubator at 30 ℃ for culturing for 24 hours, and observing the size of the bacteriostasis ring.

As can be seen from the PMA-qPCR data of FIG. 5, the live strain of Candida utilis is effective in inhibiting the growth of live strain of Aeromonas hydrophila (P < 0.01), but the inactivated strain is inactive.

From the zone of inhibition of candida utilis at panel C shown in figure 6, it can be seen that candida utilis viable bacteria can grow on panels coated with aeromonas hydrophila and that a circular filter paper sheet range is grown with a small range of zone inhibition. The above shows that the live candida utilis has an inhibitory effect on aeromonas hydrophila. However, inactivated candida utilis does not inhibit live aeromonas hydrophila. It is very important to ensure the viable count of candida utilis in the microbial feed.

The selected fermentation yeast is candida utilis obtained by screening, can directly and effectively convert tri-state inorganic nitrogen in water, synthesize self-mycoprotein, help purify the water, optimize the structure of water flora, inhibit the growth of aquaculture disease bacteria such as aeromonas hydrophila, reduce bacterial diseases infected by cultured animals, and facilitate the improvement of aquaculture benefits.

3. Candida utilis fermentation collocation strain screening

When candida utilis is selected to prepare the fermented feed, the selected matched strain is selected after PMA-qPCR detection fermentation live bacteria experiment:

5kg of bean pulp, 4kg of bean dregs and 1kg of secondary powder are weighed as fermentation raw materials, 3% (V/m, mL/g) of seed solution of the strain is inoculated according to the first and second table, namely 3mL of seed solution of the strain is inoculated to each 100g of fermentation raw materials, the following strain combinations (table 1 and table 2) are respectively inoculated, the water content of a fermentation system is controlled to be 45%, and the package fermentation is directly carried out at 30 ℃. Samples were taken at days 0, 1, 3, 5, 7 of fermentation for PMA treatment and DNA was extracted in preparation for subsequent qPCR experiments.

TABLE 1 determination of the viable count of candida utilis by fermentation of different species

TABLE 2 determination of viable count of Candida utilis by single-cell co-fermentation of different lactic acid bacteria

Measurement results:

as can be seen from FIG. 7, comparison of the peaks of live candida utilis bacteria in each group shows that lactic acid bacteria group (c) alone > lactic acid bacteria bacillus subtilis group (d) > candida utilis alone group (a) > bacillus subtilis group (b) alone. In the subsequent fermentation process, the live candida utilis bacteria of each group start to descend.

As can be seen from FIG. 8, the peak value of the number of live candida utilis bacteria in each group also appears on the first day, and the largest group is bifidobacterium lactis group (F) (2.528X 10) ⁷ Lactobacillus plantarum group (A) (2.498X 10) ⁷ cobies/g), lactobacillus casei group (D) (2.254X 10) ⁷ The number of live bacteria of the individual growth peak of candida utilis (H) is low, and the number of live bacteria of the group of candida utilis alone is similar to that of the group of candida utilis, namely the group of lactobacillus paracasei (E) and the group of six lactic acid bacteria are added together. Can seeThe lactobacillus rhamnosus group (B) and the total lactobacillus (G) added groups can keep higher viable bacteria until seven days of fermentation, but the number of candida utilis viable bacteria is reduced all the time with the time, and the number of viable bacteria in each group is very low until two weeks, but the remaining viable bacteria are higher as the lactobacillus plantarum group (a), the bifidobacterium lactis group (F) and the total lactobacillus (G) added groups. The number of live candida utilis added with lactobacillus plantarum group (A) can be maintained to be 8.34 multiplied by 10 on the eleventh day of fermentation ⁵ cobies/g. As can be seen by comparing the single strain groups of the candida utilis, the viable count of the candida utilis can be effectively improved no matter whether a single lactobacillus or a plurality of lactobacillus are added, and the best effect is lactobacillus plantarum and bifidobacterium lactis.

The design is that candida utilis, lactobacillus and bacillus subtilis are fermented together, and the existence of the bacillus subtilis reduces the number of active candida utilis, but the bacillus subtilis can efficiently produce enzymes to degrade proteins, phytic acid, high polysaccharide and the like, so that the candida utilis is a fermentation strain which is researched frequently in the fermentation process and has the widest application range. In the experiment, the live candida utilis of the lactobacillus group and the lactobacillus and bacillus subtilis group are higher than that of the candida utilis single-strain control group, and the inhibition effect of the bacillus subtilis is not obvious under the condition of the existence of the lactobacillus, so that the strain is selected for matching for subsequent fermentation.

The method adopts the plant lactobacillus and the bifidobacterium lactis to match with candida utilis for fermentation, can effectively improve the number of the live yeasts in the solid state fermentation, can be conveniently prepared, and does not need to be supplemented with bacterial liquid subsequently to ensure the put live yeasts. And the live candida utilis bacteria added into the feed enter the culture water body, so that the step of pouring candida utilis bacteria liquid into the water body in the aquaculture process is omitted, and the feed is more convenient. Meanwhile, the feed is used in combination with fish meal complete feed, so that the use pressure of the fish meal is reduced, and the feed absorptivity is improved.

4. Process optimization of candida utilis fermented feed

As can be seen from FIG. 9, the small peptide content is higher after 5 days of fermentation in the single factor experiment of fermentation time, so that the fermentation shelf life of the candida utilis fermented feed needs to be selected after 6 days.

The fermentation raw materials comprise: 5kg of bean pulp, 4kg of bean dregs and 1kg of secondary powder;

according to the single factor experiment result of FIG. 9, candida utilis, lactobacillus plantarum, bifidobacterium lactis and bacillus subtilis are inoculated, the inoculation amount is determined to be 5% (V/m, mL/g), the fermentation time is 7 days, and the added protease types are 0.33% of acid protease, 0.33% of bromelain and 0.33% of papain. And (3) taking the small peptide content as a response value, taking the enzyme addition amount, the fermentation temperature and the solid state fermentation water content as response variables, and designing a response surface optimization experiment by using a Box-Behnken Design (BBD) of Design Expert 8.0.6.

The designed experimental groups and data are shown in table 3;

TABLE 3 response surface Experimental design and results

Performing multiple regression fitting on the data to obtain a quadratic polynomial model equation between A (enzyme addition amount), B (fermentation temperature), C (solid state fermentation water content) and small peptide content (X) in candida utilis fermented feed, wherein the quadratic polynomial model equation is as follows:

X＝-838.058+9.183*A+6.95515*B+29.24425*C+0.059*A*B+0.019*A*C0.0216*B*C-3.984*A ² -0.12114*B ² -0.29214*C ²

the response surface 3D and contour diagrams are shown in fig. 10. The optimal fermentation process predicted by the response surface model equation is as follows: inoculating candida utilis, lactobacillus plantarum, bifidobacterium lactis and bacillus subtilis, wherein the inoculum size is 15%, the protease is acid protease, papain and bromelain, the enzyme addition amount is 1.351%, the fermentation temperature is 33.954 ℃, and the solid state fermentation water content is 51.607%. At this time, the theoretical value of the small peptide content was 36.61%. To facilitate verification, the parameters were modified: the fermentation raw materials are as follows: weighing 5kg of bean pulp, 4kg of bean dregs and 1kg of secondary powder; the inoculation amount is 15% (V/m, mL/g), the fermentation temperature is 34 ℃, and the water content of solid state fermentation is 51.5%. The experiment was repeated 3 times with an average of 36.54% small peptide content, close to the theoretical value. Therefore, the process is selected for fermentation, so that the candida utilis small peptide content is higher. The method adopts bean products with low price, such as bean dregs and bean pulp, as fermentation raw materials, and has low production cost; and the one-step method mixed bacteria synergistic anaerobic fermentation process is adopted, so that the material loss is less, the pollution is not easy to occur in the production process, the production process is simple and convenient to operate, and the small peptide content of the fermented feed can be ensured while the higher candida utilis viable bacteria are reserved.

5. Method for determining live bacteria of candida utilis fermented feed

Preparing a candida utilis standard curve, namely carrying out PCR amplification on candida utilis genome DNA by using candida utilis specific primers which are designed by taking candida utilis genes internal transcribed spacer and 5.8S ribosomal RNA gene as target genes, wherein the upstream primer F is GCGGCTCCAACCAATACACA, the downstream primer R is GTATCGCATTTCGCTGCGTT, and the amplified fragment size is 178bp; the obtained PCR product is diluted to 1X 10 after being cut and recovered ² ～1×10 ⁹ Copy/. Mu.L, performing a fluorescent quantitative PCR (qPCR) reaction as a standard, and recording the minimum cycle number (Ct value) required to generate a detectable fluorescent signal during the fluorescent quantitative PCR reaction; converting the measured DNA concentration of the standard substance into copy number, and generating a standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate;

wherein the copy number calculation formula is as follows: copy number = DNA concentration (ng/. Mu.l). Times.10 ^-9 X 6.023 x 1023/(660 x base number);

taking the candida utilis fermented feed prepared in the example 1, carrying out PMA treatment, extracting DNA, carrying out qPCR detection, weighing 2g of candida utilis fermented feed, adding 20L of PBS Buffer solution, oscillating for 20 minutes, filtering with 8 layers of gauze, taking 1L of filtrate, centrifuging for 5 minutes at 12000pm, discarding the supernatant, adding 400L of TE Buffer, adding PMA diluent into 400 mu L of sample to be detected to enable the final concentration of PMA to be 50 mu M, reversing and shaking for many times, fully mixing, and carrying out light-shielding reaction for 10 minutes. After light shielding, the sample is placed in ice, and is irradiated by a halogen lamp for 5min to control the distance to be about 20 cm. After the completion of the light reaction, the reaction was centrifuged at 12000rpm for 2min, and the supernatant was discarded, and the pellet was washed with PBS buffer for 2 times and stored at-20℃for subsequent DNA extraction. Boiling at 100 ℃ for 3 minutes, freezing at-20 ℃ for 10 minutes, boiling at 100 ℃ for 3 minutes, cooling, centrifuging at 8000rpm for 1 minute, and sucking the supernatant to obtain a feed sample DNA template; and then qPCR is carried out to obtain a Ct value, and the number of candida utilis is calculated according to the obtained standard curve. The qPCR reaction system is SYBR Green Premix Ex Taq mu L, rox Reference Dye 0.4.4 mu L, each of the upstream primer and the downstream primer is 0.8 mu L, the DNA template is 2 mu L, and the ddH2O is 6 mu L; the qPCR reaction conditions: pre-denaturation at 95℃for 30s, amplification at 95℃for 5s and 60℃for 30s for 40 cycles.

The invention uses the PMA-qPCR method to detect the number of the viable bacteria of the candida utilis in the fermentation process of the candida utilis fermented feed, has short detection time and high sensitivity, and provides guarantee for accurately detecting the change of viable bacteria in the solid state fermentation process of the biological feed.

6. Formulation proportion design is carried out on soft-shelled turtle and eel, and adhesive adding process is optimized

Wherein the aquaculture feed selects fish meal complete feed; the fish meal complete feed is purchased from the Jiang Bao compound feed in the city of bergamot, guangdong province.

The candida utilis fermented feed prepared in the application example 1 is used for replacing partial fish meal complete feed in turtle and eel culture, 25% and 50% of the fish meal feed replacing complete feed are subjected to adhesive collocation, and the water stability of the prepared feed balls is determined by considering practical application.

Group 1:25% candida utilis fermented feed and 75% fish meal complete feed;

group 2:50% candida utilis fermented feed plus 50% fish meal complete feed;

reference is made to the general technical requirements SC/T1077-2004 of the standard fish compound feed in the aquatic products industry of the people's republic of China. In order to meet the requirement of the powdery feed (dough) for the tortoise and turtle, the soaking time is 60min, and the dissolution rate is within 5%. Preparing feeds of different groups into soft groups, preparing 12 feeds in one part, dividing into four groups, weighing each feed, putting one group into a 105 ℃ oven for drying and weighing in comparison, calculating the dry weight rate, soaking the other three groups for 60min, fishing out, drying and weighing in the 105 ℃ oven, comparing with the corresponding dry weight calculated before, and calculating the weight loss rate according to a formula 1.

M ₀ For soaking the initial wet weight of each group of balls, M ₁ For the dry weight of the soaked balls in the soaking experimental group, A is the dry weight rate calculated by the control group.

Group 3: the adhesive formulation is optimized for 50% candida utilis fermented feed plus 50% fish meal complete feed.

Three levels (2.5%, 5% and 10%) of each group were set, and different kinds of starches (alpha-starch, potato starch, tapioca starch, carboxymethyl starch, barley starch, corn starch and mung bean starch, respectively) were added, as can be seen from fig. 11, and it was found that the alpha-starch has a good effect on improving the stability in water of the feed dough. Some starches may increase the weight loss rate after being added, and may be related to different starch quality and variety; therefore, alpha-starch is selected for subsequent testing.

When 25% candida utilis fermented feed is added (namely 25% candida utilis fermented feed plus 75% fish meal complete feed), 0.4% of different binders (guar gum, konjaku flour, carrageenan, sodium alginate and xanthan gum respectively) of the total weight of the total feed are added (after compatibility), so that the stability of feed dough in water is improved, and the loss of nutrient substances in water is reduced. As shown in fig. 12, the weight loss ratio can be normalized as follows: konjak flour, xanthan gum, carrageenan L and guar gum. And (3) taking price into consideration, selecting xanthan gum for subsequent tests.

As shown in fig. 13, the 0.2% xanthan gum was not well matched with the 0.2% other four binders, compared with the 0.4% xanthan gum, so that the addition of xanthan gum alone was continued.

Therefore, the candida utilis fermented feed can be used for replacing 25% of fish meal complete feed, 0.4% of xanthan gum can be added for better stability in water, and 2.5% of alpha-starch can be added for replacing 50% of fish meal complete feed for better stability in water. When the complete feed of the candida utilis fermented feed and the fish meal is used by the cooperation of the alpha starch and the xanthan gum, the water dissolution rate of the soft-ball feed is low, the dissolved parts of nutrient substances are fewer, the high efficiency of the intake of the cultured animals is ensured, the nitrogen pollution of the feed is reduced, the water quality is facilitated, the utilization efficiency of the cultured animals is improved, and the cost is reduced.

The beneficial effects of the invention are as follows:

(1) The selected fermentation yeast is candida utilis obtained by screening, can directly and effectively convert tri-state inorganic nitrogen in water, synthesize self-mycoprotein, help purify the water, optimize the structure of water flora, inhibit the growth of aquaculture disease bacteria such as aeromonas hydrophila, reduce bacterial diseases infected by cultured animals, and facilitate the improvement of aquaculture benefits.

(2) The method adopts the plant lactobacillus and the bifidobacterium lactis to match with candida utilis for fermentation, can effectively improve the number of the live yeasts in the solid state fermentation, can be conveniently prepared, and does not need to be supplemented with bacterial liquid subsequently to ensure the put live yeasts. And the live candida utilis bacteria added into the feed enter the culture water body, so that the step of pouring candida utilis bacteria liquid into the water body in the aquaculture process is omitted, and the feed is more convenient. Meanwhile, the feed is used in combination with fish meal complete feed, so that the use pressure of the fish meal is reduced, and the feed absorptivity is improved.

(3) When the complete feed of the candida utilis fermented feed and the fish meal is used by the cooperation of the alpha starch and the xanthan gum, the water dissolution rate of the soft-ball feed is low, the dissolved parts of nutrient substances are fewer, the high efficiency of the intake of the cultured animals is ensured, the nitrogen pollution of the feed is reduced, the water quality is facilitated, the utilization efficiency of the cultured animals is improved, and the cost is reduced.

(4) Through the use of the cooperation probiotics, the carbon source is added to control the carbon nitrogen ratio entering the water body to be 10-20, so that the released probiotics can be effectively promoted to colonize the water body, the flora structure in the water body is optimized, the water body purification function is enhanced, and the growth of disease miscellaneous bacteria is reduced.

(5) The method adopts bean products with low price, such as bean dregs and bean pulp, as fermentation raw materials, and has low production cost; and the one-step method mixed bacteria synergistic anaerobic fermentation process is adopted, so that the material loss is less, the pollution is not easy to occur in the production process, the production process is simple and convenient to operate, and the small peptide content of the candida utilis fermented feed can be ensured while the higher candida utilis viable bacteria are reserved.

(6) The invention uses the PMA-qPCR method to detect the number of the viable bacteria of the candida utilis in the candida utilis fermented feed, has short detection time and high sensitivity, and provides a method reference for researching the viable bacteria group change in the solid state fermentation process of the biological feed.

Drawings

FIG. 1 is a comparative graph of five Bacillus species for inorganic nitrogen conversion utilization, wherein (a) ammonia nitrogen, (b) nitrite nitrogen, (c) nitrate nitrogen;

FIG. 2 is a graph showing a comparison of the conversion and utilization capacities of four yeasts for inorganic nitrogen, (a) ammonia nitrogen, (b) nitrite nitrogen, and (c) nitrate nitrogen;

FIG. 3 is a graph showing a comparison of the conversion and utilization capacities of six lactic acid bacteria for inorganic nitrogen, (a) ammonia nitrogen, (b) nitrite nitrogen, and (c) nitrate nitrogen;

FIG. 4 shows the three-state nitrogen law of candida utilis conversion, (a) ammonia nitrogen, (b) nitrite nitrogen, (c) nitrate nitrogen;

FIG. 5 is a co-existence experiment of candida utilis and aeromonas hydrophila;

FIG. 6 is an experiment of the candida utilis in inhibiting the growth of a flat filter paper sheet of aeromonas hydrophila; wherein: antibiotics, B: inactivating candida utilis, C: candida utilis viable bacteria, D: a sterile medium;

FIG. 7 shows the number of viable bacteria for fermentation of Candida utilis in combination with different species of bacteria;

FIG. 8 shows the number of viable bacteria for fermentation of Candida utilis in combination with different lactic acid bacteria;

FIG. 9 is a one-factor experiment; wherein (a) fermentation time, (b) inoculation amount, (c) fermentation temperature, (d) water content, (e) protease addition amount, and (f) aerobic fermentation time;

FIG. 10 is a response surface 3D plot and a contour plot; wherein (a) a response surface 3D graph and a contour plot of the effect of the enzyme addition amount and the fermentation temperature on the small peptide content of the candida utilis fermented feed, (b) a response surface 3D graph and a contour plot of the effect of the enzyme addition amount and the solid state fermentation water content on the small peptide content of the candida utilis fermented feed, (c) a response surface 3D graph and a contour plot of the effect of the fermentation temperature and the solid state fermentation water content on the small peptide content of the candida utilis fermented feed;

FIG. 11 is a screen of different starch addition ratios;

FIG. 12 is a screen experiment of candida utilis fermented feed instead of 25% fish meal complete feed with different binders;

FIG. 13 is a single xanthan gum addition and co-addition with other binders;

FIG. 14 is a SDS-PAGE of feed proteins before and after fermentation; (a) Soluble proteins in supernatant after trichloroacetic acid leaching of feed, (b) feed holoprotein; wherein M: protein Marker (5-245 kDa); 1: raw materials before fermentation; 2: fermented feed; 3 fish meal complete feed;

FIG. 15 shows the viable count of the solid state fermented feed Candida utilis;

Fig. 16 is a graph showing ammonia nitrogen in six groups of aquaculture water under different treatments, wherein (a) C/n=20 experimental and control groups, (b) C/n=15 experimental and control groups, and (C) C/n=10 experimental and control groups;

FIG. 17 shows the results of qPCR for a specific flora of a body of water, wherein (a) total bacteria, (b) Candida utilis, (c) Aeromonas, and (d) Enterobacter;

FIG. 18 is a high throughput sequencing result; (a) Percentage of colony abundance at the level of each group of bacteria genus (b) percentage of colony abundance at the level of each group of bacteria phylum;

FIG. 19 shows the result of Candida utilis qPCR in water; (a) total bacteria, (b) candida utilis, (c) aeromonas and (d) enterobacteria;

FIG. 20 shows the ammonia nitrogen in water of the candida utilis fermented feed replacing 15% of the fish meal complete feed at different carbon nitrogen ratios;

FIG. 21 is a graph of water quality of a farming experiment in which (a) ammonia nitrogen, (b) nitrite nitrogen, (c) total nitrogen, (d) nitrate nitrogen;

FIG. 22 shows the turtle blood smear coloration wherein (a) and (b) fish meal complete feed groups, (c) and (d) candida utilis fermented feed partial replacement groups;

FIG. 23 shows paraffin sections of small intestine, wherein (a) and (b) fish meal complete feed groups and (c) and (d) candida utilis fermented feed partial replacement groups.

Detailed description of the preferred embodiments

The invention is further described below in connection with specific embodiments.

Example 1:

(1) Preparation of bacillus subtilis, saccharomyces cerevisiae, lactobacillus plantarum and lactobacillus rhamnosus by activation culture and fermentation seed liquid:

A. preparing a strain culture medium: slant and plate medium: 5g of yeast extract, 10g of peptone, 10g of sodium chloride, 10g of glucose, 20g of agar and 1000mL of distilled water, and sterilizing for 30min at 121 ℃;

liquid medium: 5g of yeast extract, 10g of peptone, 10g of sodium chloride, 10g of glucose, 1000mL of distilled water and sterilizing at 121 ℃ for 30min;

B. activating various strains and preparing fermentation seed liquid:

preparation of bacillus subtilis activation and fermentation seed liquid: inoculating bacillus subtilis strain stored at 4 ℃ to a slant culture medium, and culturing at 37 ℃ for 36 hours; then, single colony is scratched on a flat plate, the culture is carried out for 36 hours at 37 ℃ in an inverted way, the single colony is selected and inoculated in a 250mL conical flask containing 50mL of seed liquid culture medium, and the seed liquid is obtained by culturing for 18 hours at 37 ℃ and 150 r/min. The fermentation seed liquid was obtained by performing an expansion culture at a 3% inoculum size (v/v, i.e., 100mL medium was inoculated with 3mL seed liquid, the same applies hereinafter) as required, and culturing was carried out at 37℃and 150r/min for 24 hours.

Activation of candida utilis and preparation of fermentation seed liquid: the candida utilis strain preserved at 4 ℃ is inoculated in a slant culture medium and cultured for 36 hours at 30 ℃. Then, single colony is scratched on a flat plate, the culture is carried out for 36 hours at the temperature of 30 ℃ in an inverted way, the single colony is selected and inoculated in a 250mL conical flask containing 50mL of seed liquid culture medium, and the seed liquid is obtained by culturing for 18 hours at the temperature of 30 ℃ and 150 r/min. The fermentation seed liquid is obtained by carrying out expansion culture with the inoculum size (v/v) of 3 percent according to the requirement, and the culture condition is 28 ℃ and 150r/min for 24 hours.

Preparation of lactobacillus plantarum and bifidobacterium lactis activation and fermentation seed liquid: lactobacillus plantarum and bifidobacterium lactis preserved at 4 ℃ are respectively inoculated in a slant culture medium and cultured for 48 hours at 37 ℃. Then, single colony is scratched on a flat plate, the culture is carried out for 48 hours at 37 ℃ in an inverted way, the single colony is selected and inoculated in a 250mL anaerobic bottle filled with 230mL of seed liquid culture medium, and the seed liquid is obtained by culturing for 18 hours at 37 ℃. The fermentation seed liquid is obtained by carrying out expansion culture according to the requirement with the inoculum size (v/v) of 3 percent, and the culture condition is that the culture is carried out for 24 hours at 37 ℃.

(2) Preparation of solid fermentation medium: the mass ratio of each component is as follows: 50% of bean pulp, 40% of bean dregs and 10% of secondary powder;

(3) Inoculating the prepared bacillus subtilis fermentation seed liquid into a fermentation medium according to the inoculation amount of 3% of the mass of the solid fermentation medium, adding water to ensure that the water content is 45%, uniformly stirring, and placing into a fermentation bag containing a one-way exhaust hole for anaerobic fermentation, wherein the fermentation temperature is 32 ℃, so as to obtain candida utilis fermentation feed; namely the water quality improved type fermented feed.

The prepared candida utilis fermented feed is subjected to protein electrophoresis to compare the molecular weight distribution of proteins before and after fermentation, and the whole feed protein electrophoresis method is that a dried feed sample and a protein loading buffer solution (loading buffer) are used for directly 1:10, and then carrying out protein electrophoresis. The method for soluble protein electrophoresis is to weigh 1.00g of dried candida utilis fermented feed, add 30ml of 0.03mol/L Tris-HCl solution, shake and soak for 1h, centrifuge for 10min at 10000rpm, take supernatant mixed protein loading buffer solution and carry out SDS-PAGE analysis.

As shown in FIG. 14, the protein band of 27kDa or more in the Candida utilis fermented feed was substantially lost when compared with the unfermented raw material for seven days. This indicates that the macromolecular proteins in the candida utilis fermented feed are basically hydrolysed to small molecular proteins and small peptides below about 27kDa, whereas the control shows that the fish meal complete feed also contains macromolecular proteins.

As can be seen from FIG. 15, the number of live candida utilis reaches the peak value in the first day of fermentation, and the number of live bacteria of the optimized group can reach 1.698×10 ⁸ The copies/g and the live candida utilis bacteria were higher than in the control group (only candida utilis was fermented). The strain is matched with the prion strain within 30 days of fermentation in the fermentation timeThe improvement effect of the yeast live bacteria is obvious, and the improvement effect of the fermentation time on the small peptide amount is considered, so that the use effect of the candida utilis fermented feed is optimal when the candida utilis fermented feed is prepared and used for 6-30 days.

Example 2:

in the ecological cycle agricultural base turtle breeding test field of the free town Di Fei ecological cycle in Danyang city of Jiangsu province, the breeding pool is 1.57m long, 1.22m wide, 0.72m high and 0.5m deep. Each group is provided with three parallel groups, each parallel group breeds 20 Chinese soft-shelled turtles (male and female halves) with similar sizes and weights, and the water source for breeding is pond water after precipitation and filtration. The test period was 25 days, and the feed was fed twice daily (12:00, 21:00) in an amount of 2% of the animal mass.

The feed is fish meal complete feed, and is purchased from the south strong brand compound feed in the bergamot city of Guangdong province. An experimental group to which candida utilis was additionally added and a control group to which candida utilis was not added were set.

The weight is randomly weighed every week, and the feeding amount is adjusted according to the weight change. During the cultivation period, glucose or molasses is added into each group of cultivation water bodies after feeding, and the glucose is added according to different C/N settings of 10, 15 and 20.

Three samples per day (8:00, 16:00, 21:00) were taken in the culture pond and mixed evenly at three points, and ammonia Nitrogen (NH) ₄ ⁺ -N), nitrite nitrogen (NO ₂ ^- -N) concentration. Daily (8:00) sampling for determination of nitrate Nitrogen (NO) ₃ ^- -N) and Total Nitrogen (TN).

As can be seen from FIG. 16, the denitrification effect of different carbon-nitrogen ratios on the water body is different. In the three control groups, the higher the carbon nitrogen ratio, the faster the ammonia nitrogen is reduced. In the aquaculture water, when the C/N is more than 10, the growth of heterotrophic bacteria can be effectively promoted, and the water quality is improved by utilizing an inorganic nitrogen source. When C/N is less than 10 in the aquaculture environment, heterotrophic microorganisms mainly utilize organic nitrogen sources, especially ammoniation, which can lead to the increase of ammonia nitrogen content; when C/N is more than 10, microorganisms in the water body can utilize carbon sources and simultaneously utilize organic nitrogen and inorganic nitrogen in the culture environment to form biological floccules, and ammonia nitrogen and nitrite nitrogen are consumed simultaneously. This conclusion is consistent with the experimental results, and it can be seen that the ammonia nitrogen content in water is immediately reduced at different rates while the carbon nitrogen ratio is increased in the three control groups. As the carbon to nitrogen ratio increases, the conversion rate of ammonia nitrogen increases, probably because higher C/N levels will promote the utilization of the heterotrophic bacteria to grow, inhibit autotrophic bacteria by growth competition, and at the same time better convert and utilize inorganic nitrogen. Through observation of three test groups, the conversion rate of ammonia nitrogen in the water body is high even in the group with low carbon nitrogen ratio (C/N=10), and the conversion rates of ammonia nitrogen in the groups with C/N=15 and C/N=20 are both very high and kept at a low level. The result shows that the candida utilis can absorb and assimilate ammonia nitrogen in water to a certain extent, and has obvious regulation effect on water quality.

TABLE 4 determination of the Water State Nitrogen content at the time of sampling at day 30

Note that: CG20 refers to a control group (control group) having a carbon to nitrogen ratio of 20, EG20 refers to a test group (control group) having a carbon to nitrogen ratio of 20, CG15 refers to a control group (control group) having a carbon to nitrogen ratio of 15, EG15 refers to a test group (control group) having a carbon to nitrogen ratio of 15, CG10 refers to a control group (control group) having a carbon to nitrogen ratio of 15, and EG10 refers to a test group (control group) having a carbon to nitrogen ratio of 10.

It can be seen from table 4 that the total nitrogen content of each group is different, and each carbon nitrogen ratio level experimental group is greater than that of the control group (P < 0.05), and the other three inorganic nitrogen contents are smaller than the total nitrogen, and the total nitrogen content is smaller, indicating that the organic nitrogen content of the experimental group is higher. Meanwhile, the addition of candida utilis groups can effectively convert inorganic nitrogen into microbial proteins, and the content of biological flocs is improved.

From the amount of candida utilis shown in fig. 17, candida utilis can be planted in the culture water body, and the optimal carbon-nitrogen ratio is 15. As the carbon to nitrogen ratio increases, the total bacterial count per 100mL increases, which promotes the growth of total bacteria, which is also responsible for the inorganic nitrogen removal effect of heterotrophic bacteria. It can also be seen that the total bacterial count was greater in the control group than in the experimental group (P < 0.01) for each carbon to nitrogen ratio level. It is presumed that the competition for growth by the addition of candida utilis resulted in a smaller total bacterial inhibition than the control group. With the increase of the carbon nitrogen ratio, the number of aeromonas and enterobacteria per 100mL of water body is increased. At each carbon-nitrogen ratio level, the control group had higher numbers of aeromonas and enterobacteria than the group to which candida utilis was added (P < 0.05). It is thought that candida utilis inhibits the growth of both bacteria. Both bacteria are main disease bacteria causing turtle breeding diseases.

The addition of candida utilis can be found to effectively reduce the quantity of aeromonas and enterobacteria in the aquaculture water body, and is beneficial to aquaculture.

Table 5 feed factors for each group

From table 5 it can be obtained that with increasing carbon-nitrogen ratio, the feed coefficient was reduced and the feed coefficient of the experimental group was slightly lower than that of the control group (P < 0.05). So that candida utilis in water has a certain influence on the growth of soft-shelled turtle, and the feed coefficient of the test group is lower than that of the control group.

As shown in FIG. 18, while the proportion of Aeromonas increased with increasing carbon nitrogen ratio, which is consistent with the qPCR test results, the copy number of Aeromonas per 100mL of water increased. The quantity of aeromonas in the experimental group is obviously lower than that in the control group, which is consistent with the qPCR experimental result, so that the quantity and proportion of aeromonas can be effectively reduced by adding candida utilis.

Example 3:

the cultivation test field of the ecological cycle agricultural base soft-shelled turtle is 1.57m long, 1.22m wide, 0.72m high and 0.5m deep in the fuzhendi ecological cycle agricultural base soft-shelled turtle in the Danyang city of Jiangsu province. Three parallel groups are arranged in each group, and 20 Chinese soft-shelled turtles with similar sizes and weights are bred in each parallel group. The water source for cultivation is pond water after precipitation and filtration, and the test period is 25 days. Feeding twice daily (12:00, 21:00), one group of fed fish meal complete feed serves as a control (100% fish meal complete feed); the other two groups are compared with the control group, 25% (experimental group 1) and 50% (experimental group 2) of the fish meal complete feed is replaced by the candida utilis fermented feed to serve as experimental groups. The feeding amount is 2% of the mass. The animals were weighed randomly weekly and the feeding was adjusted according to the weight change. During the cultivation period, the mass of glucose required to be added for regulation and control is calculated according to the ratio of C/N=15, and after the feed is put in, the glucose is added into each group of cultivation water bodies. One month after cultivation, qPCR was performed by extracting water sample DNA.

As shown in FIG. 19, the results of qPCR of candida utilis are obtained, when candida utilis fermented feed is fed instead of 25% and 50% of fish meal complete feed, candida utilis can be planted in water bodies, and the difference of candida utilis copies in two groups of water bodies is found to be not large (P is more than 0.05) through data analysis and comparison. Although the number of candida utilis copies in the water body to be planted is smaller than that of the direct addition of the bacterial liquid, it is also described that the bacterial bodies can be retained by partial direct water loss or by discharging the bacterial bodies out of the body after the gastrointestinal tract by feeding.

TABLE 6 cultivation experiment group

As can be obtained from table 6, 25% of the biological feed additive results in a slight decrease in feed coefficient, and improves absorption efficiency and weight gain rate, and 50% of the biological feed additive significantly increases feed coefficient, but most importantly, the cost of the biological feed is about 5000 yuan per ton, which is much lower than the total price of fish meal per ton of ten thousand yuan, so that the economic benefit is obvious. The subsequent experiments were continued by selecting 25% biological feed.

Example 4:

the cultivation test field of the ecological cycle agricultural base soft-shelled turtle is 1.57m long, 1.22m wide, 0.72m high and 0.5m deep in the fuzhendi ecological cycle agricultural base soft-shelled turtle in the Danyang city of Jiangsu province. Three parallel groups are arranged in each group, and 20 Chinese soft-shelled turtles with similar sizes and weights are bred in each parallel group. The water source for cultivation is pond water after precipitation and filtration, and the test period is 25 days. Feed was fed twice daily (12:00, 21:00) and the groupings are as shown in Table 7. The feeding amount is 2% of the mass. The animals were weighed randomly weekly and the feeding was adjusted according to the weight change.

TABLE 7 turtle raising feed group

As shown in Table 8, when the candida utilis fermented feed replaces 25% of fish meal complete feed, the feed coefficients are slightly smaller than those of the control group when the adhesive xanthan gum is added by 0.2%, 0.4% and 0.6%, and the proportion of the adhesive xanthan gum is increased in the claimed protection range of the invention, so that the effect is not obvious. However, when the candida utilis fermented feed replaces 50% of the fish meal complete feed, the feed coefficient is found to be obviously increased, and when the addition amount of the adhesive alpha-starch is increased to 5%, the feed coefficient is obviously increased, which means that the nitrogen source of the feed is obviously reduced due to excessive alpha-starch addition, and the weight gain of the soft-shelled turtle is reduced.

TABLE 8 feed coefficient for the cultivation group

Example 5:

the cultivation scheme is cooperated with case III, one group is fed with fish meal complete feed as a control, the other group is fed with candida utilis fermented feed instead of fish meal complete feed 15%, and the experimental group is obtained. The feeding amount is 2% of the mass. The animals were weighed randomly weekly and the feeding was adjusted according to the weight change. During the cultivation period, the mass of glucose required to be added for regulation is calculated according to C/N=0, 5, 10, 15 and 20, and after the feed is put in, the glucose is added into each group of cultivation water bodies.

As shown in fig. 20, it is observed that when candida utilis fermented feed is used to replace 25% of fish meal complete feed, the ammonia nitrogen content will be reduced, and when the carbon nitrogen ratio is increased, the degree of conversion of ammonia nitrogen will be increased, i.e. the ammonia nitrogen content will be reduced more rapidly.

Example 6:

the breeding scheme is as in case 3, and the feed with different substitution ratios is selected for feedingThe nitrogen ratio is controlled to be 15, sampling is carried out twice daily (9:00, 21:00) in a culture pond by adopting three-point sampling and mixing evenly, and then ammonia Nitrogen (NH) ₄ ⁺ -N), nitrite nitrogen (NO ₂ ^- -N) concentration. Daily measurement and sampling of nitrate Nitrogen (NO) ₃ ^- -N) and Total Nitrogen (TN). The Control Group (CG) was fed with fish meal complete feed, and the Experimental Group (EG) was fed with candida utilis instead of 25% of fish meal complete feed.

As can be seen in fig. 21, the ammonia nitrogen, nitrite nitrogen, was mostly lower than the control group for seven days. The total nitrogen is not greatly changed in two groups, but the nitrate nitrogen is also a candida utilis fermented feed additive group which is far smaller than a fish meal complete feed control group. The feed additive can effectively purify water quality, and has a faster and better effect of converting inorganic nitrogen in water when the carbon-nitrogen ratio is 15.

In conclusion, various inorganic nitrogen in the water body of the candida utilis fermented feed which replaces 25% of fish meal complete feed groups is lower than that of fish meal complete feed control groups, and the water quality purifying effect is better.

Example 7:

one group of the feed fish meal complete feed is used as a control, and the other group of the feed candida utilis fermented feed is used as an experimental group to replace 25% of the fish meal complete feed. The feeding amount is 2% of the mass. The animals were weighed randomly weekly and the feeding was adjusted according to the weight change. During the cultivation period, the mass of glucose required to be added for regulation and control is calculated according to the ratio of C/N=15, and after the feed is put in, the glucose is added into each group of cultivation water bodies. After three months of feeding, the turtle organism is observed by measuring blood convention, serum biochemical index, immune index and small intestine section villus.

As shown in fig. 22, since the red blood cells of the soft-shelled turtle are found to be low in the conventional measurement of blood, the red blood cells of the soft-shelled turtle are found to be nucleated red blood cells by making a blood smear from fresh soft-shelled turtle blood, and thus the blood analyzer has an error in measuring the blood cell content. Thus, the red blood cell count of soft-shelled turtles was counted using a hemocytometer. The red blood cells in the turtle blood smear of the fish meal complete feed are less, and the white blood cells are more, and the result shows that the feeding of the candida utilis fermented feed has a certain gain effect on the hematopoietic function of the turtle and the immune function of the participation of the red blood cells.

TABLE 9 influence of candida utilis fermented feed on biochemical index of Trionyx sinensis

Note that: the same row of data marked letters indicate that the difference is not significant (P > 0.05), and the unmarked letters indicate that the difference is significant (P < 0.05)

As shown in Table 9, the biochemical indexes of the soft-shelled turtle are measured, the glutamic-pyruvic transaminase and the glutamic-oxaloacetic transaminase of the experimental group are lower than those of the control group, and the two enzymes are liver cell secretase and mainly participate in-vivo transamination, and are the most sensitive indexes for judging the damage of liver cells. It may be that tissue damage promotes the enzyme into the blood, or that the control group has excessive protein or macromolecular protein content, resulting in an overburdening of the liver.

TABLE 10 influence of fermented feeds on serum antioxidant immune index of Trionyx sinensis Wiegmann

As can be seen from Table 10, the total antioxidant capacity (T-AOC) of the experimental group is significantly higher than that of the control group, indicating that the body immunity of the soft-shelled turtle of the experimental group is stronger. Lysozyme is an alkaline protein that can act as a phagocytic and bacterial killing function by hydrolyzing the cell wall of gram-positive bacteria. The lysozyme of the experimental group is higher than that of the fish meal complete feed group, which reflects the physiological defense level of the turtle body, possibly caused by the contact of the body with antigenic substances or immunostimulants, and also reflects the nonspecific humoral immunity state of the turtle to a certain extent. The two enzyme activities can represent that the capability of the turtle for resisting organism oxidation and immunity germ is improved. The difference between the experimental group acid phosphatase (ACP) and the control group was not significant, but alkaline phosphatase (AKP) was significantly higher. Alkaline phosphatase is usually deposited in bone tissue by converting an organic phosphate compound into inorganic phosphate ions which combine with calcium ions to form calcium phosphate in osteoblasts and hepatocytes. The high enzyme activity can reflect the states of bone cells and liver cells, and also shows that the calcium supply to bones and organs is better, and the activity, the condition and the metabolism of phosphorus of the osteoblasts are higher than those of the fish meal complete feed group. It is also considered that the addition of the candida utilis fermented feed can improve the absorption of the elements such as calcium, phosphorus and the like by the Chinese soft-shell turtle, and is beneficial to mineralization of bones such as the dorsal beetles, the abdominal beetles and the like of the Chinese soft-shell turtle. Presumably, calcium chelate is formed in the candida utilis fermented feed, so that the turtle body is more easily absorbed. This is presumably because small peptide chelated mineral ions in probiotic fermented feed are more able to aid in absorption.

TABLE 11 villus height and crypt depth of small intestine

The small intestine of the soft-shelled turtle is used as an important organ for assimilating feed nutrition, and the digestion and absorption functions of the soft-shelled turtle can be intuitively evaluated by measuring the villus height of the small intestine of the soft-shelled turtle and the ratio of the villus height to the depth of the crypt. As a basic functional unit of the small intestine, the longer the villus of the small intestine is, the larger the ratio of the villus to the depth of the crypt is, which indicates that the better the digestion and absorption functions of the organism are. As shown in fig. 23 and table 11, it can be seen from the microstructure of the small intestine morphology that the control group had shorter small intestine villi and deeper crypt. The control group did have a much lower VH/CD value for the villus length to crypt depth ratio than the experimental group, i.e., was considered poorly digested.

In conclusion, the routine measurement of the turtle blood finds that the biological feed partially replaces the routine normal items of 25% group blood in the fish meal complete feed, and the red blood cells are more. The physiological and biochemical index measurement shows that the glutamic pyruvic transaminase and the glutamic oxaloacetic transaminase of the experimental group are lower than the complete fish meal feed group, but the serum GLU content is higher than that of the control group. The total antioxidant capacity of the experimental group is found in the turtle serum antioxidant immune index measurement, and the enzyme activities of alkaline phosphatase and lysozyme are higher than those of the control group. The small intestine slices find that the addition of the candida utilis fermented feed can obviously improve the ratio of the small intestine villus height and the crypt depth of the soft-shelled turtle; further illustrates that the addition of the candida utilis fermented feed has remarkable effect.

Description: the above embodiments are only for illustrating the present invention and not for limiting the technical solution described in the present invention; thus, while the invention has been described in detail with reference to the various embodiments described above, it will be understood by those skilled in the art that the invention may be modified or equivalents; all technical solutions and modifications thereof that do not depart from the spirit and scope of the present invention are intended to be included in the scope of the appended claims.

Claims

1. The use of a water quality improving fermented feed for adding into an aquaculture feed for aquaculture and water quality improvement is characterized by comprising the following preparation steps:

(2) Respectively inoculating the seed liquid obtained in the step (1) into anaerobic fermentation culture mediums, and uniformly mixing to obtain an anaerobic fermentation mixture; the anaerobic fermentation medium comprises the following components in percentage by weight: 40-55% of bean pulp and 35-40% of bean dregs; 8% -10% of secondary powder;

Adjusting the fermentation temperature to 20-35 ℃, adjusting the water content of the culture medium to 38-55%, carrying out anaerobic fermentation under a sealed condition, and obtaining a finished product after anaerobic fermentation for 4-30 days, thereby obtaining candida utilis fermented feed, namely the water quality improvement type fermented feed;

(3) The candida utilis fermented feed is added into the aquaculture feed to obtain mixed feed for feeding, so that the purposes of aquaculture and water quality improvement are realized; the addition amount of the candida utilis fermented feed accounts for 25-50% of the weight of the mixed feed, and xanthan gum accounting for 0.2-0.6% of the weight of the mixed feed and/or alpha-starch accounting for 2.5-5% of the weight of the mixed feed are added;

when the mixed feed is fed, after the mixed feed is put into a water body, a carbon source is put into the water body, so that the carbon-nitrogen ratio of the carbon source to the whole mixed feed is 10-20; the carbon source is glucose or molasses.

2. The use according to claim 1, wherein the ratio of the inoculation amount of candida utilis seed solution to the weight of anaerobic fermentation medium in step (2) is 2-4 mL:100g; the total viable count of the candida utilis seed solution is 1.3x10 ⁷ ～2.7×10 ⁸ cfu/mL。

3. The use according to claim 1, wherein the ratio of the inoculum size of the bacillus subtilis seed liquid to the weight of anaerobic fermentation medium in step (2) is 1-3 mL:100g; the total number of viable bacteria of the bacillus subtilis seed liquid is 1.0x10 ⁸ ～2.1×10 ⁹ cfu/mL。

4. The use according to claim 1, wherein the lactic acid bacteria seed liquor in step (2) comprises one or more of bifidobacterium lactis seed liquor and lactobacillus plantarum seed liquor; the ratio of the inoculation amount of the bifidobacterium lactis seed solution to the weight of the anaerobic fermentation culture medium is 4-6 mL:100g, the total number of viable bacteria of the bifidobacterium lactis seed liquid is 2.5X10 ⁸ ～5.3×10 ⁹ cfu/mL; the ratio of the inoculation amount of the lactobacillus plantarum seed solution to the weight of the anaerobic fermentation culture medium is 2-4 mL:100g, the total number of viable bacteria of the lactobacillus plantarum seed solution is 1.1X10 ⁸ ～3.7×10 ⁹ cfu/mL。

5. The use according to claim 1, wherein the fermentation in step (2) is carried out at a temperature of 25 to 32 ℃ for a period of 5 to 15 days; the water content of the culture medium is adjusted to be 40-50%.

6. The use according to claim 1, wherein the xanthan is added in an amount of 0.2 to 0.4% based on 25% by weight of the mixed feed.

7. The use according to claim 1, wherein the alpha-starch is added in an amount of 2.5 to 5% based on the weight of the mixed feed, when the amount of the feed added is 50% based on the weight of the mixed feed.