CN115161332A

CN115161332A - VdERF2 gene of Vitis davidii, and coding protein and application thereof

Info

Publication number: CN115161332A
Application number: CN202210741007.3A
Authority: CN
Inventors: 陈婷; 雷龑; 刘鑫铭
Original assignee: Pomology Research Institute Fujian Academy of Agricultural Sciences
Current assignee: Pomology Research Institute Fujian Academy of Agricultural Sciences
Priority date: 2022-06-28
Filing date: 2022-06-28
Publication date: 2022-10-11
Anticipated expiration: 2042-06-28
Also published as: CN115161332B

Abstract

The invention relates to the technical field of biology, in particular to a vitis davidii VdERF2 gene and a coding protein and application thereof. The VdERF2 gene of the Vitis davidii is located on chromosome 2 of the Vitis davidii and is distributed in 177614-179312 regions. The amino acid sequence of the protein coded by the gene is shown as SEQ ID No. 2. The invention further verifies that the resistance of the plants to anthracnose can be enhanced by the over-expression of the VdERF2 gene. Therefore, the VdERF2 gene provided by the invention can improve the resistance of plants to anthracnose and provide a theoretical basis for plant anthracnose-resistant breeding.

Description

Vitis davidii VdERF2 gene and encoding protein and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a vitis davidii VdERF2 gene and a coding protein and application thereof.

Background

Grapes are important economic fruit trees in the world, can be eaten fresh, and are widely used for brewing wine, making juice and the like. However, most grape varieties are highly sensitive to various pathogenic bacteria, among which grape anthracnose caused by c. The chemical properties of wine are also affected as the fungus mainly infects mature fruits. Under warm and humid conditions, typical symptoms of grape anthracnose are seen on fruit grains, branch tips and leaves.

At present, in the grape cultivation production, the anthracnose pathogen is mainly controlled by a bactericide, but the use of the bactericide not only harms the environment and the health, but also enhances the drug resistance of pathogenic bacteria. Because of the adverse effects of using bactericides to control the spread of anthracnose, people are more and more concerned about crossing European and American hybrids with European and Asian grape seeds to breed anthracnose-resistant fresh-eating grapes. In recent years, the identification of the anti-anthracnose gene locus (Cgr 1) of grapes has been reported in related researches, but the molecular mechanism of grape anthracnose infection is not clear at present. Therefore, anthracnose resistance breeding of grapes is an urgent problem to be solved in southern grape cultivation production.

Disclosure of Invention

The invention aims to solve the technical problem of providing a vitis davidii VdERF2 gene and a coding protein thereof, which can improve the resistance of plants to anthracnose.

The invention is realized by the following steps:

the invention firstly provides a VdERF2 gene of Vitis davidii, which is located on chromosome 2 of Vitis davidii and distributed in the region 177614-179312.

Specifically, the nucleotide sequence of the vitis amurensis VdERF2 gene is shown as SEQ ID No. 1.

The invention also provides a protein coded by the VdERF2 gene of the Vitis davidii, the amino acid sequence of which is shown as SEQIDNO.2, the protein contains an AP2 structural domain, and the homology of the protein and the Vitis davidii is the highest.

And a recombinant expression vector containing the vitis davidii VdERF2 gene.

Further, the recombinant expression vector comprises the vitis davidii VdERF2 gene and a pCambia2300-GFP vector operably connected with the vitis davidii VdERF2 gene.

Finally, the invention provides application of the vitis davidii VdERF2 gene in improving the resistance of plants to pathogenic bacteria. The expression level of the VdERF2 gene is increased under the stress of pathogenic bacteria, and the PR gene on an SA passage is excited, so that the resistance to the pathogenic bacteria is enhanced.

Further, the pathogenic bacteria are pathogenic anthrax bacteria.

Further, the plant comprises tomato.

The invention has the following advantages:

the invention provides a VdERF2 gene of Vitis davidii, the nucleic acid sequence of which is shown in SEQ ID No.1, the full length is 849bp, 282 amino acids are coded, the amino acid sequence is shown in SEQ ID No.2, the gene contains an AP2 structural domain, and is highly homologous with Vitis davidii, and the coded protein is positioned on a cell nucleus.

The invention analyzes the expression condition of VdERF2 in the fruit peel of the Vitis davidii after the Vitis davidii is infected by anthrax, and experiments prove that the VdERF2 expression quantity is continuously increased along with the infection, and the VdERF2 can respond to grape anthracnose to induce expression when the peak is reached at the 7 th d.

According to the invention, the VdERF2 sequence is cloned, an overexpression vector pCambia2300-VdERF2-GFP is constructed, the Micro-Tom tomatoes are transformed to obtain the transgenic tomatoes, after the fruits are inoculated with the anthrax, the morbidity symptoms are lighter compared with wild tomatoes, and the expression quantity of SlPR1 and SlPR2 genes in the VdERF2 transgenic fruits is obviously increased in each time period after the anthracnose is inoculated. Further verifies that the VdERF2 gene overexpression can enhance the resistance of the plant to anthracnose. Therefore, the VdERF2 gene provided by the invention can improve the anthracnose resistance of plants and provides a theoretical basis for anthracnose resistance breeding of plants.

Drawings

The invention will be further described with reference to the following examples and figures.

FIG. 1 is a graph showing the cluster analysis of the homologous protein sequences of Vitis davidii and part of the species ERF2, wherein the red font represents the Vitis davidii (Vitis davidii) VDER F2, and I, II and III represent different classes.

FIG. 2 shows the construction of VdERF2 gene into pCambia2300-GFP vector.

FIG. 3 is an analysis diagram of VdERF2 protein domain of Vitis davidii.

FIG. 4 shows VdERF2 chromosomal location of Vitis davidii.

FIG. 5 is an analysis chart of VdERF2 induced expression in response to grape anthracnose.

FIG. 6 is a view of VdERF2 subcellular localization analysis (scale 25 μm).

FIG. 7 shows the result of PCR detection of positive transgenic plants; a, detecting the transgenic tomato by PCR; qRT-PCR detects the transgenic tomato; DNAmaker (D5000); po is positive control; WT: wild type.

FIG. 8 is an agronomic trait plot of VdERF2 transgenic lines, wherein A is the VdERF2 transgenic tomato plant and the control group plant (left is wild type, right is transgenic type), and B is the fruit size of the VdERF2 transgenic tomato plant and the control group plant (left is wild type, right is transgenic type).

FIG. 9 is the fruit character index analysis of VdERF2 transgenic tomato, in which A is the comparison of the fruit single fruit weight of VdERF2 transgenic tomato and the control group, and B is the comparison of the fruit transverse and longitudinal diameter of VdERF2 transgenic tomato and the control group.

FIG. 10 is an analysis of the resistance of tomato fruits overexpressing VdERF2 to anthrax, where A is the phenotype of tomato fruits inoculated with anthrax for 72h (wild type on the left, transgenic type on the right); B-C is the relative expression quantity of the transgenic lines and wild tomato fruits SlPR1 (B) and SlPR2 (C) after 0h, 6h, 12h, 24h, 48h and 72h of inoculation of the anthrax.

Detailed Description

The present invention will be described in detail below by way of examples with reference to the accompanying drawings, but the present invention is not limited thereto, and is described by way of example only.

The experimental procedures used in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Species and plasmids used in the examples:

the over-expression vector used in the test was pCambia2300-GFP; the agrobacterium infection used for the analysis of the transgene and the positioning of tobacco epidermal cells is GV3101 (p 19+ pSoup) strain; the E.coli Top10 competent cells used were purchased from Tianggen.

The main reagents used in the examples include reverse transcription kit, qRT-pcrrsuppermix (Transgen), plasmid extraction kit, plant RNA extraction kit, gel recovery kit, LA high fidelity enzyme, sucrose, MS powder, tris, agar powder, CTAB,75% ethanol, absolute ethanol.

Media and hormone concentrations during tomato transgenesis in the examples:

MS liquid culture medium: 4.43g of MS powder and 30g of sucrose were dissolved in 1L of distilled water. MS solid culture medium: 4.43g of MS powder and 30g of sucrose were dissolved in 1L of distilled water, while 1.5g of agar powder (pH =6.0, adjusted 2 mol/LNaOH) was added. Pre-culturing: MS solid medium +1mg/L KT. Differentiation culture: after MS solid culture medium is sterilized, 300mg/L Tim +2mg/L ZT +50mg/L Kan is added at 55 ℃. Rooting culture: after MS solid medium sterilization, 300mg/L Tim +1mg/L IAA +50mg/L Kan was added at 55 ℃.

Example 1VdERF2 CDS sequence cloning and vector construction

1. Extraction of RNA

The skin of the Vitis davidii is used as a material to extract RNA.

cDNA Synthesis

And (2) synthesizing cDNA by reverse transcription by taking the RNA as a template, wherein the specific operation is as follows: mu.l of total RNA, 1. Mu.l of Oligo dT Primer (50. Mu.M) and 1. Mu.l of dNTPs (10 mM) are taken, and the mixture is supplemented to 20. Mu.l without RNase water, mixed uniformly, incubated at 65 ℃ for 5min, placed on ice for 3min and centrifuged briefly. Reaction components are shown in table 1, and the reaction solution is firstly placed at 42 ℃ for incubation for 30min; then incubating for 15min at 70 ℃; and (4) incubating for 10min at 4 ℃ to finally obtain cDNA which can be used for subsequent experiments.

TABLE 1 preparation of reaction solution

3. Cloning of target Gene VdERF2

Taking cDNA as a template, carrying out PCR amplification by using primers p2300-VdERF2-BamHI-F SEQ ID No.3 and p2300-VdERF2-SalI-R SEQ ID No.4, wherein an amplification system is as follows:

PCR cycling reaction conditions: pre-denaturation at 94 ℃ for 1min, (denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 1min, extension at 72 ℃ for 2 min) for 29 cycles, and final extension at 72 ℃ for 5min. PCR products were detected by electrophoresis on a 1% agarose gel and the intensity of the band of interest was analyzed by Bioimaging Systems software (Syngene, cambridge, UK).

SEQ ID No.3：

p2300-VdERF2-BamHI-F:

tcggtacccggggatccATGTGTGATTACAGTAGTAATCC；

SEQ ID No.4：

p2300-VdERF2-SalI-R:

gctcaccatggtgtcgacGCGAACCAATAGCTGTGGGCCATGTG

Note: the lower case is the adapter primer (vector sequence) and the upper case is the gene sequence.

Recovery of PCR amplification product

PCR products were detected using 1% agarose gel electrophoresis and single bands of electrophoresis were excised under UV light. The recovery process was performed with reference to kit instructions: adding 500 μ L of equilibrium liquid into adsorption column, centrifuging at 12000rpm for 1min, discarding waste liquid, and adsorbing column for use. Adding 3 times of sol solution by weight into the gel block, dissolving completely in water bath at 50 deg.C, and standing at room temperature for 10min. Adding the dissolved solution into prepared adsorption column, standing for 1min, centrifuging at 12000rpm for 30s, and discarding waste liquid. Add 600. Mu.L of rinsing solution to the adsorption column, centrifuge at 12000rpm for 30s, discard the waste solution, repeat once. Discarding rinsing liquid, centrifuging for 2min, and opening the adsorption column for 5min; adding 30. Mu.L ddH ₂ Standing at room temperature for 2min, and centrifuging at 12000rpm for 2min for later use.

5. Construction of vectors

The homologous recombination reaction was carried out by referring to a seamless cloning kit (see FIG. 2) of Bomeide, and the recovered product of the gel obtained above was mixed with a linearized vector pCambia2300 in a reaction system of 10. Mu.L, reacted at 50 ℃ for 15min, and then cooled in ice for 15min to carry out the subsequent reaction.

6. Transformation of competent cells

To the above-mentioned recombinant reaction solution, 25. Mu.L of Top10 competent cells were added, and gently mixed. Ice-cooling for 20min, heat shock at 42 deg.C for 90s, ice-cooling for 5min, adding 300 μ L liquid LB, recovering at 37 deg.C for 30min, and coating at 50 mg. L ^-1 Positive clone screening was performed by overnight incubation at 37 ℃ on Kan plates.

7. Recombinant cloning vector identification

Adding 50 mg. L to 1mL ^-1 Kan LB liquid medium was filled into 2mL centrifuge tubes, and single colonies were picked from LB plates and inoculated therein, followed by overnight culture at 37 ℃ with shaking. Carrying out PCR amplification by using overnight-cultured bacterial liquid as a template, wherein an amplification system is as follows:

the PCR amplification conditions were: 94 ℃ for 1min, (94 ℃ 30s,57 ℃ for 1min,72 ℃ for 2 min) 31 cycles, 72 ℃ for 5min. The PCR product was detected by 1% agarose gel electrophoresis, the correct target band was confirmed on a gel imaging system, and the correct bacterial solution was applied to 10m liquid LB (50 mg. Multidot.L addition) ^-1 Kan) was cultured with shaking at 37 ℃ for subsequent experiments.

8. Extraction of recombinant plasmid

500 mu L of the cultured bacterial liquid is taken for sequencing, and another 500 mu L of the bacterial liquid is uniformly mixed with the 30% glycerol 1. Extracting the rest plasmids, taking 2mL bacterial liquid, and centrifuging at 12000rpm for 1min; the thallus is resuspended in 250 μ L of solution I; adding 250 μ L of solution II, mixing, and standing at room temperature for 2min; adding 350 mu L of the solution III, and gently and uniformly mixing; centrifuging at 12000rpm for 10min; taking the supernatant, passing through an adsorption column, and centrifuging at 12000rpm for 1min; adding 700 μ L of rinsing liquid, cleaning twice, discarding the rinsing liquid, centrifuging for 2min, and opening the adsorption column for 5min; adding 50 μ L ddH2O, standing at room temperature for 2min, centrifuging at 12000rpm for 2min, and storing at-20 deg.C.

9. Enzyme digestion analysis

Taking 1 ug aboveThe plasmid is used for enzyme digestion detection, and the reaction system is 20 mu L:10 Xenzyme Buffer 2. Mu.L, bamH I/Sal I each 0.5. Mu.L, using ddH ₂ The O content was increased to 20. Mu.L, and the reaction was carried out at 37 ℃ for 3 hours. The cleavage products were detected using 1% gel electrophoresis, the correctly cleaved plasmids were used for sequencing and finally confirmed for subsequent experiments.

Example 2VdERF2 bioinformatics analysis

The amino acid sequence of VdERF2 is placed on a BLAST website for sequence alignment, and homologous sequences of different species are downloaded for constructing a phylogenetic tree. Amino acid sequence similarity of VdERF2, multiple comparisons were performed using DNAMAN (v 6.0). The results of the sequence multiple comparison analysis were exported using the GenDoc (v2.7.0) software. The chromosomal location of the VdERF2 gene was predicted to be analyzed in the grape Genome website Genosope Genome Browser. As a result, as shown in FIG. 4, the cloned VdERF2 is located on chromosome 2 and is distributed in the region from 177614 to 179312. Phylogenetic trees are constructed on phenyl, frplatform (http:// www. Phenyl, fr) using the Maximum likelihood method (Maximum likelihood).

Alignment was performed with VdERF2 amino acid sequence using the Clustw program with Vitis vinifera, arabidopsis thaliana, oryza sativa, tobacco, tomato and maize. As shown in FIG. 3, VDER F2 is 849bp long, encodes 282 amino acids, and is found to contain AP2 domain (137 aa-200 aa) after being aligned with other species. The VdERF2 amino acid sequence in the vitis amurensis is compared with the ERF amino acid sequences of other plants searched in GenBank for homology, and a maximum likelihood method in Phylogy. The VdERF2 gene cloned from the Vitis davidii is clustered with the Vitis davidii into a small cluster, which shows that the gene is closely related to the Vitis davidii.

A common feature of the AP2/ERF transcription factor superfamily is that they all have a conserved AP2/ERF domain. The AP2/ERF transcription factor superfamily is divided into three families according to the number of the AP2/ERF structural domains and whether other structural domains are contained: the AP2 family (containing two repeated AP2/ERF domains), the ERF family (containing only one AP2/ERF domain), and the RAV family (containing one AP2/ERF domain and another B3 domain). In addition, the ERF transcription factor family is divided into an ERF subfamily and a CBF/DREB subfamily according to the difference of conserved amino acids of the AP2/ERF structural domain. ERF2 is a member of the ERF subfamily of the ERF family.

Example 3 analysis of expression Pattern of VdERF2 Gene

Adopting a needle punching method to inoculate the colletotrichum gloeosporioides, and collecting grape peels infected by the colletotrichum gloeosporioides as test materials. Designing a quantitative primer according to the sequence of the VdERF2 gene, wherein qPCR-ERF2-F: AACGGCTCAAACTGGAATCG; qPCR-ERF2-R: TAGCTGTGGGCCATGTGTAA. Real-time fluorescent quantitative PCR is carried out, and the expression pattern of the VdERF2 gene is analyzed.

As shown in FIG. 5, the expression level of VdERF2 in 0d, 1d, 3d and 7d peels of Vitis davidii after inoculation of the grape anthracnose continuously increases with the progress of infection, and reaches the peak at the 7 th d. Indicating that VdERF2 can induce expression in response to grape anthracnose.

Example 4 tobacco epidermal cell localization assay

The correctly sequenced recombinant plasmid was transferred to Agrobacterium GV3101 containing 50 mg. Multidot.L by electroporation ^-1 Kan、50mg·L ^-1 Gent and 50 mg. L ^-1 Rif resistance plate in 28 ℃ culture 2d. Colonies were picked in 5mL LB liquid medium (containing 50 mg. Multidot.L) ^-1 Kan、50mg·L ^-1 Gent and 50 mg. L ^-1 Rif,) shaking the bacteria at 180rpm at 28 ℃ for 16-18h, and performing PCR detection. The correct bacterial suspension was cultured in 10mL of LB liquid medium containing the same antibiotic in an expanded state. After centrifugation at 5000rpm for 5min, the supernatant was discarded, and the cells were resuspended in a resuspension solution (MES 2.130g/L + MgCl 22.03g/L + sucrose 20 g/L) and washed 3 times. Diluting the resuspended bacterial liquid to OD ₆₀₀ =0.4, then AS (200 mmol. L) is added ^-1 ) Standing the light-shielding strip at room temperature for 3h to activate the agrobacterium. The resuspended bacterial solution was injected into the back of healthy burley tobacco leaves with a 1mL syringe without needle, cultured in an illumination incubator for 72h, the distribution of GFP fusion protein in the tobacco leaves was observed under a laser confocal microscope (lycra TCSSP 8), and the pictures were saved. The results are shown in FIG. 6, which indicates that VdERF2-GFP protein is localized in the nucleus.

EXAMPLE 5 transformation of tomato with overexpression vector

1. Obtaining aseptic tomato seedlings

Cleaning tomato seeds (Micro-Tom) with sterile water for 5 times in a sterile operating platform, soaking for 30min, soaking with 70% ethanol for 1min, and soaking with sterile water for 3 times. Then rinsed with 10% NaClO for 10min, and sterilized water for 5 times. The seeds were blotted with sterile filter paper, inoculated onto MS solid medium, and cultured in dark at 25 ℃ for 4-5 days in an incubator. The light is 25 ℃,16 h/dark is 16 ℃,8h.

2. Agrobacterium infection and co-cultivation

When the tomato grows out of two cotyledons and is just spread flatly, cutting the cotyledons of the seedlings, cutting the cotyledons into squares, spreading a piece of sterilizing filter paper on an MS differentiation culture medium, spreading the cotyledons with the back side upward on the culture medium, and placing the culture medium in an illumination culture box for overnight culture at the illumination temperature of 25 ℃,16 h/dark 16 ℃ and 8h.

The agrobacterium solution containing the recombinant plasmid (GV 3101) is mixed according to the ratio of 1:250 is added into LB culture medium for activation, and cultured for 48h at 28 ℃ and 180 rpm. 2mL of activated bacteria liquid is respectively sucked by 2mL centrifuge tubes, after centrifugation is carried out for 5min at 5000rpm, the supernatant is discarded, and 1mL of MS liquid culture medium (containing 50 MuM AS) is added to fully suspend the thalli; one third of the height of the MS liquid medium was poured into a 90mm petri dish. Adding the suspended 2 tubes of bacterial liquid into a culture dish, then placing the prepared tomato leaf disc into the invasion dye solution for 5min, and continuously shaking the culture dish during the period to ensure that the thalli are fully combined with the cotyledon disc. And (3) after the time is over, quickly sucking out the staining solution, sucking the residual bacterial solution on the surface of the leaves by using filter paper, flatly paving the leaves on an MS culture medium, sealing the openings, and then putting the leaves in a dark incubator at 25 ℃ for culture for 2d.

3. Bacteria removal and differentiation culture

The dark-cultured leaf disks were sterilized with sterile water containing antibiotics (300 mg/LTim), washed 5 times, and excess water was removed by sterile filter paper. Placing into differentiation medium, and irradiating at 25 deg.C for 16 h/dark at 16 deg.C for 8h.

Observing the differentiation condition of the leaf disc during the differentiation culture period until callus is formed at the wound of the leaf and seedlings are differentiated, transferring the seedlings into an MS differentiation culture medium, and cutting the seedlings and inserting the cut seedlings into a rooting culture medium after the seedlings grow up.

4. Rooting culture and seedling formation

After 3 weeks of culture in rooting medium, selecting tomato seedlings with well developed root systems, moving out from a tissue culture bottle, putting into a nutrition pot with a transparent cover for hardening seedlings, hardening seedlings for 2 weeks, and gradually uncovering the cover in the period. After the tomato after seedling formation is detected, the subsequent test can be carried out.

5. Detection of transgenic tomato

Taking 0.5g of T0 generation tomato young leaves after seedling establishment, and extracting genome DNA by adopting a CTAB method. Using genome DNA as a template, a universal primer (p 2300-F: TCCTTCGCAAGACCCTTCTCTCTAT; p2300-R: CAGGGTCAGCTTGCCGTAG) of a pCambia2300 vector is used for detecting whether VdERF2 is inserted or not. Selecting young leaves of the plants which are detected to be positive by PCR, extracting total RNA, obtaining cDNA after reverse transcription, and carrying out semi-quantitative analysis by taking SlActin (SlActinF: ATTCCCTGACTGTTTGCTAGT; slActinR: TCCAACAATACCGGTGGT) as an internal reference primer and VdERF2 quantitative primer (qPCR-ERF 2-F: AACGGCTCAAACTGGAATCG; qPCR-ERF2-R: TAGCTGTGGGGCATGTAA).

The results are as follows (as shown in fig. 7): the method comprises the steps of transforming the VdERF2 into tomatoes by utilizing an agrobacterium-mediated plant transformation method, refining the tomatoes which are transplanted into seedlings, taking young leaves of the plants to extract DNA, and carrying out PCR detection by using a universal primer of a pCambia2300 vector. The pCambia2300-VdERF2-GFP plasmid is used as a positive control, the leaf DNA of a wild tomato plant is used as a negative control, and the PCR electrophoresis result shows that the candidate plants (# 12, #13, #16, # 17) have consistent bands with the positive control, which indicates that the candidate plants contain VdERF2 genes and the wild tomato plant cannot detect target bands. In order to further verify whether the VdERF2 gene is expressed in the candidate plants, RNA of young leaves of the candidate plants is extracted and subjected to reverse transcription, specific primers are designed according to the sequence of the VdERF2 gene, PCR semi-quantitative detection is carried out by taking tomato SlActin as an internal reference, target bands are detected in the #12 and #16 plants through 28-cycle PCR detection, no band exists in wild-type plants, and the #12 and #16 plants can be identified as positive plants. The results showed that VdERF2 gene was expressed in positive plants (# 12, # 16).

Phenotypic observation of the obtained transgenic plants (see fig. 8 and fig. 9) shows that the wild type tomato plants are not significantly different from the VdERF2 overexpression plants in phenotype, and the wild type tomato plants are not significantly different from the VdERF2 overexpression tomato #12 and #16 plants in the length of the tomato fruit in single fruit weight, transverse diameter and longitudinal diameter.

Example 6 identification of transgenic tomato for resistance to anthracnose

Collecting mature tomato fruits without disease spots, sterilizing the surface of the tomato fruits by using 75% ethanol solution for 15s, and cleaning the tomato fruits for 3 times by using sterile water. Tomato colletotrichum (c.aculatum) was kept by the laboratory. Before inoculation, the fruit was first treated for wound healing using a dissecting needle, and a 6mm piece of PDA bacteria (preculture 7 d) was punched out using a punch and inoculated into the wound site. Inoculating wild type (control) and transgenic fruit, performing dark culture at 28 deg.C under moisture retention, removing bacterial block after 48 hr, collecting fruit peel at 0 hr, 6 hr, 12 hr, 24 hr, 48 hr and 72 hr after inoculation, quick freezing with liquid nitrogen, and storing in refrigerator at-80 deg.C. The RNA of the sample is extracted and is reversely transcribed into cDNA (100 ng/. Mu.L), tomato SlActin is used as an internal reference, and the expression quantity of SlPR1 (accession number: EU589238, slPR1-F: ATAAAGTGATCGGATTGTCGAGGA; slPR1-R: TAAGCTGCAACACACACACACTAC) and SlPR2 (accession number: EU589238, slPR2-F: TCTGTAGACATGACGTTGATTGG; slPR2-R: AGCATACGGAAGTGAATCTG) of the tomato in different time periods after the tomato is inoculated with anthracnose is compared by adopting a qRT-PCR method.

As shown in fig. 10, after the VdERF2 transgenic tomato fruit and the wild type tomato fruit were inoculated for 72 hours, it was found that the disease spot diameter in the VdERF2 transgenic tomato fruit becomes smaller and the disease symptom is less after the VdERF2 transgenic tomato fruit was inoculated. Further, inoculating anthracnose bacteria to wild tomato fruits and VdERF2 transgenic tomato fruits, collecting tomato peels at 0h, 6h, 12h, 24h, 48h and 72h after inoculation, extracting RNA, performing reverse transcription, taking SlActin as an internal reference, and analyzing the change of expression amounts of SlPR1 and SlPR2 genes in different time periods after the VdERF2 transgenic tomato fruits are inoculated with the anthracnose bacteria by real-time fluorescence quantitative PCR. Results show that compared with wild tomato fruits, the expression amounts of SlPR1 and SlPR2 genes in VdERF2 transgenic tomato fruits are obviously increased in each time period after the anthracnose is inoculated, and the resistance of the tomato fruits over-expressing VdERF2 to the anthracnose is improved.

While specific embodiments of the invention have been described, it will be understood by those skilled in the art that the specific embodiments described are illustrative only and are not limiting upon the scope of the invention, as equivalent modifications and variations as will be made by those skilled in the art in light of the spirit of the invention are intended to be included within the scope of the appended claims.

Sequence listing

<110> research institute for fruit trees of academy of agricultural sciences in Fujian province

<120> Vitis davidii VdERF2 gene, and coding protein and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 849

<212> DNA

<213> Vitis davidii (vitas davidii)

<400> 1

atgtgtgatt acagtagtaa tccctcttct gacttcgctc tcctggagtc tgttcgccgc 60

cacttgttcg acgactccga ctctcgtcgc ttcgacgctc ccctgtattg ccgtagcaat 120

agttttagta gcttgtttga aactgggggt gaattgcctt tgaaggagga tgattccgac 180

gacatggtga tctatggctt tctccgcgac gccgccagcg gaggctggac acccacgctc 240

gctccactct tttcagagac tgcctcctac ggtttctcta ccgcccccgc ggtggccgtg 300

aaatcggagc cggaagtttt tccggcggag gttattggag tgcccgagaa gacggtggac 360

ccaccggcga aattacctgc tccggcggtg gtgccggcga aggggaagca ttacaggggc 420

gtgcgacaga ggccgtgggg gaagttcgct gcggagatta gggatccggc gaagaacggg 480

gctagggttt ggctggggac gttcgagacg gcagaggacg ccgcactggc ctatgacaga 540

gccgcttatc ggatgcgcgg ctctcgcgca ctgctcaatt tcccactccg agttaactcg 600

ggggagcccg atccagtccg agtgacctca aaacgatcct cacctgagcc ttcctcttca 660

tcaacgtcgt catcatcatc agataatagc tcacccaagc gtagaaagaa agtgagtagc 720

ttggctgctc ccgctgtggc gccggcaacg gctcaaactg gaatcgaaat agggaagtca 780

atggagggat cccaggcggg atatgaggtg gcacagctta cacatggccc acagctattg 840

gttcgctaa 849

<210> 2

<211> 282

<212> PRT

<213> Vitis davidii (vitas davidii)

<400> 2

Met Cys Asp Tyr Ser Ser Asn Pro Ser Ser Asp Phe Ala Leu Leu Glu

1 5 10 15

Ser Val Arg Arg His Leu Phe Asp Asp Ser Asp Ser Arg Arg Phe Asp

20 25 30

Ala Pro Leu Tyr Cys Arg Ser Asn Ser Phe Ser Ser Leu Phe Glu Thr

35 40 45

Gly Gly Glu Leu Pro Leu Lys Glu Asp Asp Ser Asp Asp Met Val Ile

50 55 60

Tyr Gly Phe Leu Arg Asp Ala Ala Ser Gly Gly Trp Thr Pro Thr Leu

65 70 75 80

Ala Pro Leu Phe Ser Glu Thr Ala Ser Tyr Gly Phe Ser Thr Ala Pro

85 90 95

Ala Val Ala Val Lys Ser Glu Pro Glu Val Phe Pro Ala Glu Val Ile

100 105 110

Gly Val Pro Glu Lys Thr Val Asp Pro Pro Ala Lys Leu Pro Ala Pro

115 120 125

Ala Val Val Pro Ala Lys Gly Lys His Tyr Arg Gly Val Arg Gln Arg

130 135 140

Pro Trp Gly Lys Phe Ala Ala Glu Ile Arg Asp Pro Ala Lys Asn Gly

145 150 155 160

Ala Arg Val Trp Leu Gly Thr Phe Glu Thr Ala Glu Asp Ala Ala Leu

165 170 175

Ala Tyr Asp Arg Ala Ala Tyr Arg Met Arg Gly Ser Arg Ala Leu Leu

180 185 190

Asn Phe Pro Leu Arg Val Asn Ser Gly Glu Pro Asp Pro Val Arg Val

195 200 205

Thr Ser Lys Arg Ser Ser Pro Glu Pro Ser Ser Ser Ser Thr Ser Ser

210 215 220

Ser Ser Ser Asp Asn Ser Ser Pro Lys Arg Arg Lys Lys Val Ser Ser

225 230 235 240

Leu Ala Ala Pro Ala Val Ala Pro Ala Thr Ala Gln Thr Gly Ile Glu

245 250 255

Ile Gly Lys Ser Met Glu Gly Ser Gln Ala Gly Tyr Glu Val Ala Gln

260 265 270

Leu Thr His Gly Pro Gln Leu Leu Val Arg

275 280

<210> 3

<211> 40

<212> DNA

<213> (Artificial sequence)

<400> 3

tcggtacccg gggatccatg tgtgattaca gtagtaatcc 40

<210> 4

<211> 44

<212> DNA

<213> (Artificial sequence)

<400> 4

gctcaccatg gtgtcgacgc gaaccaatag ctgtgggcca tgtg 44

Claims

1. A VdERF2 gene of spine grape, which is characterized in that: the VdERF2 gene of the Vitis davidii is located on chromosome 2 of the Vitis davidii and is distributed in 177614-179312 regions.

2. The Vitis davidii VdERF2 gene according to claim 1, wherein: the nucleotide sequence of the vitis davidii VdERF2 gene is shown in SEQ ID No. 1.

3. The VderF2 gene of Vitis davidii according to claim 1 or 2, wherein the protein encoded by the VderF2 gene: the amino acid sequence is shown in SEQ ID No. 2.

4. A recombinant expression vector comprising the VdERF2 gene of Vitis davidii as defined in claim 1 or 2.

5. Use of the Vitis davidii VdERF2 gene according to claim 1 or 2 for increasing the resistance of plants to pathogenic bacteria.

6. Use according to claim 5, characterized in that: the pathogenic bacteria are pathogenic anthrax bacteria.

7. Use according to claim 5, characterized in that: the plant comprises tomato.