CN115154478A

CN115154478A - Application of ZDHHC22 gene in preparing medicine for treating neuroblastoma

Info

Publication number: CN115154478A
Application number: CN202210769656.4A
Authority: CN
Inventors: 应美丹; 何俏军; 杨波; 邵雪晶; 王金湖; 曹戟; 许爱笑; 黄云鹏
Original assignee: Childrens Hospital of Zhejiang University School of Medicine
Current assignee: Childrens Hospital of Zhejiang University School of Medicine
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2022-10-11
Anticipated expiration: 2042-06-30
Also published as: CN115154478B

Abstract

The invention discloses application of a ZDHHC22 gene in preparation of a neuroblastoma treatment drug, and particularly relates to application of interfering siRNAs targeting the ZDHHC22 gene in preparation of a neuroblastoma treatment drug. According to the invention, by using siRNA interference technology, cell proliferation and clone formation capability of neuroblastoma cells are obviously inhibited after ZDHHC22 is reduced. Therefore, the invention not only discloses the application of the ZDHHC22 gene, but also provides a new therapeutic target for neuroblastoma. The invention provides possibility for preparing a novel neuroblastoma medicament, improving the curative effect of a patient and improving prognosis and survival.

Description

Application of ZDHHC22 gene in preparing medicine for treating neuroblastoma

Technical Field

The invention belongs to the technical field of medical biology, relates to an application of a ZDHHC22 gene in preparing a neuroblastoma treatment medicament, and particularly relates to an application of interfering siRNAs of a targeted ZDHHC22 gene in preparing a neuroblastoma treatment medicament.

Background

Neuroblastoma (NB) is the most common solid extracranial tumor in children, accounting for 8% -10% of the total malignant tumors in children and accounting for about 15% of the total death of children due to malignant tumors. At present, neuroblastoma can be divided into a low-risk type, a medium-risk type and a high-risk type according to risk rating, low-risk type and medium-risk type patients are good in prognosis, and 5-year survival rate exceeds 90%. However, about 60% of patients are high-risk patients, and the overall treatment prognosis is still poor due to the molecular characteristics such as MYCN gene amplification, ALK gene amplification or mutation. Therefore, the search for new potential targets and intervention means for neuroblastoma therapy is of great significance in promoting the clinical therapy of neuroblastoma.

The ZDHHC protein acts as a palmitoyl transferase, catalyzing the formation of a thioester bond between palmitic acid and a cysteine residue of a substrate protein. The family of ZDHHC proteins is highly conserved among eukaryotes, there are 23 subtypes in humans, and almost all membrane proteins are mediated by S-type palmitoylation modification. The ZDHHC protein is closely related to various diseases, including tumor and nervous system diseases, and has very important biological functions. For example, in 8-26% of cases of prostate cancer, there is a gene abnormal amplification of palmitoyltransferase ZDHHC9 of H-Ras and N-Ras; abnormal amplification of ZDHHC11 was observed in 14-17% lung adenocarcinoma, 10% bladder cancer, 19% prostate cancer. These studies all suggest that the ZDHHC protein has important regulatory effects on tumor initiation and progression. However, the role of the ZDHHC22 gene in neuroblastoma has not been reported in the literature. Therefore, the role of ZDHHC22 in neuroblastoma remains to be studied further.

Disclosure of Invention

The invention aims to provide an application of a ZDHHC22 gene in preparing a neuroblastoma treatment medicament, in particular an application of interfering siRNAs of a targeted ZDHHC22 gene in preparing a neuroblastoma treatment medicament, wherein the ZDHHC22 gene nucleotide sequence is shown as SEQ ID NO. 1, the ZDHHC22 gene coded protein sequence is shown as SEQ ID NO. 2, and the nucleotide sequences of the interfering siRNAs of the targeted ZDHHC22 gene are respectively:

SEQ ID NO:3：5’AGGCACGACCATCACTGTTTC 3’(﹟1)

SEQ ID NO:4：5’TGCGCAACTTCGTCCTGTTCT 3’(﹟2)

the preparation form of the medicament is liquid preparation or solid preparation.

The invention achieves the effect of down-regulating ZDHHC22 by applying siRNAs aiming at ZDHHC22 gene, thereby researching the effect of ZDHHC22 in neuroblastoma. 2 siRNAs (SEQ ID NO:3-SEQ ID NO: 4) aiming at the ZDHHC22 gene can inhibit the expression of ZDHHC22, thereby inhibiting neuroblastoma. Specifically, the compound has obvious inhibition effect on the cell proliferation and clone formation capability of the cells of the neuroblastoma SK-N-DZ and SK-N-BE (2).

After the ZDHHC22 is reduced by adopting an RNA interference technology, the cell proliferation and clone formation capability of neuroblastoma cells are obviously inhibited. Therefore, the invention not only discloses the application of the ZDHHC22 gene, but also provides a new therapeutic target for neuroblastoma.

The invention can obviously inhibit the cell proliferation and clone formation capability of neuroblastoma cells (SK-N-DZ and SK-N-BE (2)) by reducing the expression of ZDHHC22 by utilizing siRNA interference technology. Therefore, the ZDHHC22 gene is firstly proposed to be a key gene for malignant progression of neuroblastoma, and the siRNAs molecules of ZDHHC22 can be used as an effective intervention means for treating neuroblastoma.

The invention provides an application of ZDHHC22 siRNA in preparing a neuroblastoma treatment medicine. The down-regulation of ZDHHC22 can effectively inhibit the cell proliferation and the clonogenic capacity of neuroblastoma, and provides a new direction for the development of the current neuroblastoma treatment drugs. In a word, the down-regulation of ZDHHC22 can inhibit the cell proliferation and clonogenic capacity of neuroblastoma, and provides possibility for preparing a novel neuroblastoma medicament, improving the curative effect of patients and improving prognosis and survival.

Drawings

FIG. 1 shows that 2 siRNAs against the ZDHHC22 gene (SEQ ID NO:3, SEQ ID NO.

FIG. 2 shows that when siRNA against ZDHHC22 gene (SEQ ID NO:3, SEQ ID NO.

FIG. 3 shows that when siRNA against ZDHHC22 gene (SEQ ID NO:3, SEQ ID NO.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention.

The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, for example as described in Sambrook et al, molecular cloning: A Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the conditions as recommended by the manufacturer.

The application of the ZDHHC22 siRNA can refer to the conventional drug configuration method and the actual development. The pharmaceutical and biological preparations are any medically approved dosage forms, such as powder, injection, capsule, tablet or oral liquid.

Example 1:

2 ZDHHC22 siRNAs (SEQ ID NO:3, SEQ ID NO. The results showed that all of the above ZDHHC22 siRNAs (SEQ ID NO:3, SEQ ID NO. The results are shown in FIG. 1.

Example 2:

2 ZDHHC22 siRNAs targeting different sequences (SEQ ID NO:3, SEQ ID NO. The results show that the ZDHHC22 siRNA can remarkably inhibit the proliferation of the cells of the neuroblastoma SK-N-DZ and SK-N-BE (2). The results are shown in FIG. 2.

Example 3:

2 ZDHHC22 siRNAs targeting different sequences (SEQ ID NO:3, SEQ ID NO. The results show that the ZDHHC22 siRNA can remarkably inhibit the clonogenic capacity of the cells of neuroblastoma SK-N-DZ and SK-N-BE (2). The results are shown in FIG. 3.

Sequence listing

<110> Zhejiang university college of medicine subsidiary children hospital

Application of <120> ZDHHC22 gene in preparation of neuroblastoma treatment drug

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 792

<212> DNA

<213> person (Homo sapiens)

<400> 1

atgctggccc tgcggctgct caacgtggtg gcccccgcct acttcttgtg catctccctg 60

gtgaccttcg tgctgcagct cttcctcttc ctgcccagca tgcgcgagga ccccgcggcc 120

gcccggctct tctcgcccgc cctgctccac ggggcgctct tcctattcct ctcggccaac 180

gccctgggca attacgtcct tgtcatccag aactccccag acgacctggg ggcctgccag 240

ggggcctcgg ccaggaagac tccatgcccc tcacctagca cccacttctg ccgagtgtgc 300

gccagagtca ccctgaggca cgaccatcac tgtttcttca ccggcaactg catcggcagc 360

aggaacatgc gcaacttcgt cctgttctgc ctctacacct ccctggcctg cctctactcc 420

atggtggccg gcgtggccta catctccgct gtcctttcca tctccttcgc ccaccccttg 480

gccttcctca cgctcctgcc cacctccatc agccagttct tctccggagc tgtcctgggt 540

tctgaaatgt tcgtcatcct catgctctac ctctggttcg ccatcggcct ggcctgcgcc 600

ggcttctgct gccaccagct gctgttgatc ctccgcgggc agacccgcca ccaggtgcgg 660

aagggggtgg cagtgagggc ccggccctgg cgcaagaact tacaagaggt cttcggaaag 720

aggtggctgc tgggcctgct ggtccccatg ttcaatgtcg gaagtgagag ctccaagcag 780

caggataagt ag 792

<210> 2

<211> 263

<212> PRT

<213> person (Homo sapiens)

<400> 2

Met Leu Ala Leu Arg Leu Leu Asn Val Val Ala Pro Ala Tyr Phe Leu

1 5 10 15

Cys Ile Ser Leu Val Thr Phe Val Leu Gln Leu Phe Leu Phe Leu Pro

20 25 30

Ser Met Arg Glu Asp Pro Ala Ala Ala Arg Leu Phe Ser Pro Ala Leu

35 40 45

Leu His Gly Ala Leu Phe Leu Phe Leu Ser Ala Asn Ala Leu Gly Asn

50 55 60

Tyr Val Leu Val Ile Gln Asn Ser Pro Asp Asp Leu Gly Ala Cys Gln

65 70 75 80

Gly Ala Ser Ala Arg Lys Thr Pro Cys Pro Ser Pro Ser Thr His Phe

85 90 95

Cys Arg Val Cys Ala Arg Val Thr Leu Arg His Asp His His Cys Phe

100 105 110

Phe Thr Gly Asn Cys Ile Gly Ser Arg Asn Met Arg Asn Phe Val Leu

115 120 125

Phe Cys Leu Tyr Thr Ser Leu Ala Cys Leu Tyr Ser Met Val Ala Gly

130 135 140

Val Ala Tyr Ile Ser Ala Val Leu Ser Ile Ser Phe Ala His Pro Leu

145 150 155 160

Ala Phe Leu Thr Leu Leu Pro Thr Ser Ile Ser Gln Phe Phe Ser Gly

165 170 175

Ala Val Leu Gly Ser Glu Met Phe Val Ile Leu Met Leu Tyr Leu Trp

180 185 190

Phe Ala Ile Gly Leu Ala Cys Ala Gly Phe Cys Cys His Gln Leu Leu

195 200 205

Leu Ile Leu Arg Gly Gln Thr Arg His Gln Val Arg Lys Gly Val Ala

210 215 220

Val Arg Ala Arg Pro Trp Arg Lys Asn Leu Gln Glu Val Phe Gly Lys

225 230 235 240

Arg Trp Leu Leu Gly Leu Leu Val Pro Met Phe Asn Val Gly Ser Glu

245 250 255

Ser Ser Lys Gln Gln Asp Lys

260

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Unknow)

<400> 3

aggcacgacc atcactgttt c 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Unknow)

<400> 4

tgcgcaactt cgtcctgttc t 21

Claims

1. An application of interfering siRNAs targeting a ZDHHC22 gene in preparing a neuroblastoma treatment medicament is characterized in that the ZDHHC22 gene nucleotide sequence is shown as SEQ ID NO:1, the protein sequence coded by the ZDHHC22 gene is shown as SEQ ID NO:2, and the ZDHHC22 gene interfering siRNAs have the nucleotide sequences respectively as follows:

SEQ ID NO:3：5’AGGCACGACCATCACTGTTTC 3’

SEQ ID NO:4：5’TGCGCAACTTCGTCCTGTTCT 3’。

2. the use according to claim 1, wherein the medicament is formulated as a liquid formulation or a solid formulation.