CN113288909A

CN113288909A - Application of KLHL37 gene in preparing neuroblastoma treatment medicine

Info

Publication number: CN113288909A
Application number: CN202110469291.9A
Authority: CN
Inventors: 应美丹; 何俏军; 杨波; 王金湖; 曹戟; 项森峰; 邵雪晶
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-04-28
Filing date: 2021-04-28
Publication date: 2021-08-24
Anticipated expiration: 2041-04-28
Also published as: CN113288909B

Abstract

The invention discloses an application of a KLHL37 gene in preparing a neuroblastoma treatment medicament, in particular an application in preparing a neuroblastoma treatment medicament. After the expression of KLHL37 is reduced by adopting an RNA interference technology, the cloning capacity of neuroblastoma cells and the growth of a xenograft tumor are obviously inhibited. Therefore, the invention not only discloses the application of the KLHL37 gene, but also provides a new therapeutic target point for neuroblastoma.

Description

Application of KLHL37 gene in preparing neuroblastoma treatment medicine

Technical Field

The invention belongs to the technical field of medical biology, and particularly relates to application of a KLHL37 gene in preparation of a neuroblastoma treatment drug.

Background

Neuroblastoma is a type of malignant tumor of the peripheral nervous system originating from the sympathetic nerves of the neural crest, the most common and deadliest extracranial solid tumor in infants and young children, with about 90% of patients diagnosed to be no older than 5 years of age. Primary neuroblastoma is often located in tissues of sympathetic nervous system, adrenal medulla, or paraspinal ganglion origin. Neuroblastoma can be classified into low-risk type, medium-risk type and high-risk type according to the risk rating, the prognosis of low-risk type and medium-risk type patients is usually better (the survival rate without events is about 80% -95%), but high-risk type patients have quick disease progression due to molecular characteristics such as MYCN gene amplification, ALK gene amplification or mutation, Trk abnormal expression and the like, the clinical cure rate is lower than 35%, and the prognosis and survival conditions are not optimistic. Therefore, the search for new potential targets and intervention means for neuroblastoma therapy is an urgent need for clinical therapy.

The KLHL37 protein belongs to a substrate adapter of a Cullin3-RING ubiquitination E3 enzyme, and plays a specific selection role on substrate protein in the process of regulating and controlling protein ubiquitination. The current research on KLHL37 protein has less reports, and mainly comprises the following steps: 1) the KLHL37 protein can promote the development of colorectal cancer by inhibiting the differentiation of colon cells; 2) abnormal upregulation in medulloblastoma; 3) closely related to poor prognosis in patients with ovarian and breast cancer. These studies suggest that KLHL37 protein may be involved in the development of tumors, but the role of KLHL37 protein in neuroblastoma has not been reported clearly in the literature. Therefore, the role of KLHL37 protein in neuroblastoma remains to be studied further.

Disclosure of Invention

The invention aims to provide application of a KLHL37 gene in preparing a neuroblastoma therapeutic drug, and relates to application of interfering siRNAs targeting the KLHL37 gene in preparing a neuroblastoma therapeutic drug. The nucleotide sequence of the KLHL37 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the targeted KLHL37 gene is shown as SEQ ID NO. 2. The nucleotide sequences of the interfering siRNAs are respectively as follows:

SEQ ID NO:3：5’CGAGTCTGCAATTAACTGGAT 3’ (﹟1)

SEQ ID NO:4：5’CTCTCTAAAGCAGGTAGAACA 3’ (﹟2)

the preparation form of the medicament is liquid preparation or solid preparation.

The invention achieves the effect of down-regulating KLHL37 by applying siRNAs aiming at the KLHL37 gene, thereby researching the effect of KLHL37 in neuroblastoma. 2 siRNAs (SEQ ID NO:3-SEQ ID NO:4) aiming at the KLHL37 gene can inhibit the expression of KLHL37 so as to inhibit neuroblastoma. The specific expression is that the compound has obvious inhibition effect on the clone forming capability of the cells of the neuroblastoma SK-N-DZ and the SK-N-BE (2) and the growth of the SK-N-BE (2) xenograft tumor.

After the RNA interference technology is adopted to reduce KLHL37, the cloning capacity of neuroblastoma cells is obviously inhibited, and the growth of neuroblastoma xenograft tumors is obviously inhibited. Therefore, the invention not only discloses the application of the KLHL37 gene, but also provides a new therapeutic target point for neuroblastoma.

The invention utilizes siRNA interference technology, can obviously inhibit the clone forming capability of neuroblastoma cells (SK-N-DZ and SK-N-BE (2)) by reducing the expression of KLHL37, and obviously inhibit the growth of SK-N-BE (2) xenograft tumor. Therefore, the KLHL37 gene is proposed to be a key gene for malignant progression of neuroblastoma for the first time, and siRNAs molecules of KLHL37 can be used as an effective intervention means for treating neuroblastoma.

The invention provides application of KLHL37 siRNA in preparing a neuroblastoma treatment medicament. The down-regulation of KLHL37 can effectively inhibit the clonogenic capacity of neuroblastoma and the growth of xenograft tumor, and provides a new direction for the development of the current neuroblastoma treatment drugs. In a word, the down-regulation of KLHL37 can inhibit the clonogenic capacity of neuroblastoma and the growth of xenograft tumor, and provides possibility for preparing a new neuroblastoma medicament, improving the curative effect of patients and improving the prognosis and survival.

Drawings

FIG. 1 shows that 2 siRNAs (SEQ ID NO: 3; SEQ ID NO:4) directed against the KLHL37 gene all had the effect of significantly down-regulating the protein expression of KLHL 37.

FIG. 2 shows that when siRNA (SEQ ID NO: 3; SEQ ID NO:4) against KLHL37 gene was applied to neuroblastoma SK-N-DZ and SK-N-BE (2) cells, the clonogenic potential of neuroblastoma cells was significantly inhibited.

FIG. 3 shows that when siRNA against KLHL37 gene (SEQ ID NO: 3; SEQ ID NO:4) was applied to neuroblastoma SK-N-BE (2) cells, the growth of SK-N-BE (2) xenograft tumors was significantly inhibited.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention.

The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, for example as described in Sambrook et al, molecular cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the conditions as recommended by the manufacturer.

The application of the KLHL37 gene can refer to the conventional medicine preparation method and actual development. The pharmaceutical and biological preparations are any medically approved dosage forms, such as powder, injection, capsule, tablet or oral liquid.

Example 1:

2 KLHL37 siRNAs (SEQ ID NO: 3; SEQ ID NO:4) targeting different sequences and a negative control NC were introduced into SK-N-DZ and SK-N-BE (2) cells (purchased from cell banks of Chinese academy of sciences) by lipofection, the cells were harvested after 72 hours, lysed with cell lysate to extract proteins, and then Western blot was performed using KLHL37 antibody (purchased from Abcam). The results show that all of the above KLHL37 siRNAs (SEQ ID NO: 3; SEQ ID NO:4) are effective in inhibiting the protein expression of KLHL 37. The results are shown in FIG. 1.

Example 2:

2 KLHL37 siRNAs targeting different sequences (SEQ ID NO: 3; SEQ ID NO:4) and negative control NC were introduced into neuroblastoma SK-N-DZ and SK-N-BE (2) cells (purchased from cell bank of Chinese academy of sciences) by lipofection, digested and counted using a hemocytometer after treatment of D2, and 10000 cells were inoculated into a six-well plate for clonal culture. The results show that the KLHL37 siRNA can remarkably inhibit the clonogenic capacity of the cells of the neuroblastoma SK-N-DZ and SK-N-BE (2). The results are shown in FIG. 2.

Example 3:

2 KLHL37 siRNAs targeting different sequences (SEQ ID NO: 3; SEQ ID NO:4) and negative control NC were introduced into neuroblastoma SK-N-BE (2) cells (purchased from cell bank, Chinese academy of sciences) by lipofection, digested and counted using a hemocytometer after treatment D2, resuspended in 1X 10 by 100. mu.l of serum-free medium⁷SK-N-BE (2) cells were mixed with 100. mu.l of Matrigel Matrix (available from Corning), inoculated into the axilla of nude mice, and the growth of nude mice transplanted tumors was continuously monitored. The results show that KLHL37 siRNA (SEQ ID NO: 3; SEQ ID NO:4) can obviously inhibit the growth of SK-N-BE (2) xenograft tumor. See figure 3 and table 1 for results.

TABLE 1

Group of	Tumor weight (g)	Inhibition ratio (%)	Relative tumor volume	Treatment group/control group (%)
					shCtrl	1.30±0.87	-	19.21±11.41	-
SiKLHL37#1	0.05±0.06*	96.4	1.33±1.46*	6.9
					SiKLHL37#2	0.28±0.36*	78.2	5.34±7.06*	27.8

Sequence listing

<110> Zhejiang university

Application of <120> KLHL37 gene in preparation of neuroblastoma treatment drug

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1770

<212> DNA

<213> human (Homo sapiens)

<400> 1

atgtcagtca gtgtgcatga gaaccgcaag tccagggcca gcagcggctc cattaacatc 60

tatctgtttc acaagtcctc ctacgctgac agcgtcctca ctcacctgaa tcttttacgc 120

cagcagcgtc tcttcactga cgtccttctc catgccggaa ataggacctt cccttgccac 180

cgggcagtgc tggctgcatg cagtcgctac tttgaggcca tgttcagtgg tggcctgaaa 240

gagagccagg acagtgaggt caactttgac aattccatcc acccagaagt cttggagctg 300

ctgcttgact atgcgtactc ctcccgggtc atcatcaatg aagaaaatgc agaatcgctc 360

ctggaagctg gtgacatgct ggagtttcaa gacatccggg atgcatgtgc agagttcctg 420

gaaaagaacc tgcatcccac caactgcctg ggcatgctgc tgctgtctga tgcacaccag 480

tgcaccaagc tgtacgaact atcttggaga atgtgtctca gcaacttcca aaccatcagg 540

aagaatgaag atttcctcca gctgccccag gacatggtag tgcaactctt gtccagtgaa 600

gagctggaga cagaggatga aaggcttgtg tacgagtctg caattaactg gatcagctat 660

gacctgaaga agcgctattg ctacctccca gaactgttgc agacagtaag gctggcactt 720

ctgccagcca tctatctcat ggagaatgtg gccatggagg aactcatcac caagcagaga 780

aagagtaagg aaattgtgga agaggccatc aggtgcaaac tgaaaatcct gcagaatgac 840

ggtgtggtaa ccagcctctg tgcccgacct cggaaaactg gccatgccct cttccttctg 900

ggaggacaga ctttcatgtg tgacaagttg tatctggtag accagaaggc caaagaaatc 960

attcccaagg ctgacattcc cagcccaaga aaagagttta gtgcatgtgc gattggctgc 1020

aaagtgtaca ttactggggg gcgggggtct gaaaatgggg tctcaaaaga tgtctgggtt 1080

tatgataccc tgcacgagga gtggtccaag gctgccccca tgctggtggc caggtttggc 1140

catggctctg ctgaactgaa gcactgcctg tatgtggttg gggggcacac ggccgcaact 1200

ggctgcctcc cggcctcccc ctcagtctct ctaaagcagg tagaacatta tgaccccaca 1260

atcaacaaat ggaccatggt ggccccactc cgagaaggcg ttagcaacgc cgcagtagtg 1320

agtgccaaac ttaagttatt tgctttcgga ggtaccagtg tcagtcatga caagctcccc 1380

aaagttcagt gttacgatca gtgtgaaaac aggtggactg taccggccac ctgtccccag 1440

ccctggcgtt acacagcagc agctgtgctg gggaaccaga tttttattat ggggggtgat 1500

acagaattct ctgcctgctc tgcttataaa ttcaacagtg agacttacca gtggaccaag 1560

gtgggagatg tgacagcaaa gcgcatgagc tgccatgctg tggcctctgg aaacaaactc 1620

tacgtggttg gaggatactt tggcattcag cgatgcaaga ctttggactg ctacgatcca 1680

acattagacg tgtggaacag catcaccact gtcccgtact cgctgattcc tactgcattt 1740

gtcagcacct ggaaacatct gccttcttaa 1770

<210> 2

<211> 589

<212> PRT

<213> human (Homo sapiens)

<400> 2

Met Ser Val Ser Val His Glu Asn Arg Lys Ser Arg Ala Ser Ser Gly

1 5 10 15

Ser Ile Asn Ile Tyr Leu Phe His Lys Ser Ser Tyr Ala Asp Ser Val

20 25 30

Leu Thr His Leu Asn Leu Leu Arg Gln Gln Arg Leu Phe Thr Asp Val

35 40 45

Leu Leu His Ala Gly Asn Arg Thr Phe Pro Cys His Arg Ala Val Leu

50 55 60

Ala Ala Cys Ser Arg Tyr Phe Glu Ala Met Phe Ser Gly Gly Leu Lys

65 70 75 80

Glu Ser Gln Asp Ser Glu Val Asn Phe Asp Asn Ser Ile His Pro Glu

85 90 95

Val Leu Glu Leu Leu Leu Asp Tyr Ala Tyr Ser Ser Arg Val Ile Ile

100 105 110

Asn Glu Glu Asn Ala Glu Ser Leu Leu Glu Ala Gly Asp Met Leu Glu

115 120 125

Phe Gln Asp Ile Arg Asp Ala Cys Ala Glu Phe Leu Glu Lys Asn Leu

130 135 140

His Pro Thr Asn Cys Leu Gly Met Leu Leu Leu Ser Asp Ala His Gln

145 150 155 160

Cys Thr Lys Leu Tyr Glu Leu Ser Trp Arg Met Cys Leu Ser Asn Phe

165 170 175

Gln Thr Ile Arg Lys Asn Glu Asp Phe Leu Gln Leu Pro Gln Asp Met

180 185 190

Val Val Gln Leu Leu Ser Ser Glu Glu Leu Glu Thr Glu Asp Glu Arg

195 200 205

Leu Val Tyr Glu Ser Ala Ile Asn Trp Ile Ser Tyr Asp Leu Lys Lys

210 215 220

Arg Tyr Cys Tyr Leu Pro Glu Leu Leu Gln Thr Val Arg Leu Ala Leu

225 230 235 240

Leu Pro Ala Ile Tyr Leu Met Glu Asn Val Ala Met Glu Glu Leu Ile

245 250 255

Thr Lys Gln Arg Lys Ser Lys Glu Ile Val Glu Glu Ala Ile Arg Cys

260 265 270

Lys Leu Lys Ile Leu Gln Asn Asp Gly Val Val Thr Ser Leu Cys Ala

275 280 285

Arg Pro Arg Lys Thr Gly His Ala Leu Phe Leu Leu Gly Gly Gln Thr

290 295 300

Phe Met Cys Asp Lys Leu Tyr Leu Val Asp Gln Lys Ala Lys Glu Ile

305 310 315 320

Ile Pro Lys Ala Asp Ile Pro Ser Pro Arg Lys Glu Phe Ser Ala Cys

325 330 335

Ala Ile Gly Cys Lys Val Tyr Ile Thr Gly Gly Arg Gly Ser Glu Asn

340 345 350

Gly Val Ser Lys Asp Val Trp Val Tyr Asp Thr Leu His Glu Glu Trp

355 360 365

Ser Lys Ala Ala Pro Met Leu Val Ala Arg Phe Gly His Gly Ser Ala

370 375 380

Glu Leu Lys His Cys Leu Tyr Val Val Gly Gly His Thr Ala Ala Thr

385 390 395 400

Gly Cys Leu Pro Ala Ser Pro Ser Val Ser Leu Lys Gln Val Glu His

405 410 415

Tyr Asp Pro Thr Ile Asn Lys Trp Thr Met Val Ala Pro Leu Arg Glu

420 425 430

Gly Val Ser Asn Ala Ala Val Val Ser Ala Lys Leu Lys Leu Phe Ala

435 440 445

Phe Gly Gly Thr Ser Val Ser His Asp Lys Leu Pro Lys Val Gln Cys

450 455 460

Tyr Asp Gln Cys Glu Asn Arg Trp Thr Val Pro Ala Thr Cys Pro Gln

465 470 475 480

Pro Trp Arg Tyr Thr Ala Ala Ala Val Leu Gly Asn Gln Ile Phe Ile

485 490 495

Met Gly Gly Asp Thr Glu Phe Ser Ala Cys Ser Ala Tyr Lys Phe Asn

500 505 510

Ser Glu Thr Tyr Gln Trp Thr Lys Val Gly Asp Val Thr Ala Lys Arg

515 520 525

Met Ser Cys His Ala Val Ala Ser Gly Asn Lys Leu Tyr Val Val Gly

530 535 540

Gly Tyr Phe Gly Ile Gln Arg Cys Lys Thr Leu Asp Cys Tyr Asp Pro

545 550 555 560

Thr Leu Asp Val Trp Asn Ser Ile Thr Thr Val Pro Tyr Ser Leu Ile

565 570 575

Pro Thr Ala Phe Val Ser Thr Trp Lys His Leu Pro Ser

580 585

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Unknow)

<400> 3

cgagtctgca attaactgga t 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Unknow)

<400> 4

ctctctaaag caggtagaac a 21

Claims

1. An application of a KLHL37 gene in preparing a medicine for treating neuroblastoma, which is characterized in that the nucleotide sequence of the KLHL37 gene is shown as SEQ ID NO: 1.

2. An application of a polypeptide targeting KLHL37 gene in preparing a neuroblastoma treatment medicament is characterized in that the polypeptide sequence of the targeting KLHL37 gene is shown as SEQ ID NO: 2.

3. The application of interfering siRNAs targeting KLHL37 gene in preparing a neuroblastoma treatment medicament is characterized in that the nucleotide sequences of the interfering siRNAs are respectively as follows:

SEQ ID NO:3：5’CGAGTCTGCAATTAACTGGAT 3’

SEQ ID NO:4：5’CTCTCTAAAGCAGGTAGAACA 3’。

4. the use according to any one of claims 1 to 3, wherein the medicament is formulated as a liquid formulation or a solid formulation.