CN112138163B

CN112138163B - Application of PPARG activator and SIRP alpha antibody in preparation of tumor immune drugs

Info

Publication number: CN112138163B
Application number: CN202010864072.6A
Authority: CN
Inventors: 侯永忠; 董晨; 苟倩; 史娟娟
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2020-08-25
Filing date: 2020-08-25
Publication date: 2022-08-23
Anticipated expiration: 2040-08-25
Also published as: CN112138163A

Abstract

The invention relates to the field of tumor immunotherapy, in particular to application of a PPARG activator and a SIRP alpha antibody in preparation of tumor immune medicaments. The invention provides a new application of a PPARG activator combined antibody drug SIRP alpha in a tumor immunotherapy drug. A large number of experiments prove that the PPARG activator can obviously reduce the protein level of CD47 and inhibit the gene and protein expression of CD47, so that the tumor immunotherapy effect of the SIRP alpha antibody can be improved when the SIRP alpha antibody medicament is combined, and the tumor growth can be better inhibited. Compared with single SIRPa antibody treatment, the PPARG activator and the SIRPa antibody disclosed by the invention can obviously inhibit the growth level of tumors in mice, and is obviously higher than that of a common antibody drug which is singly used. Has obvious effect on the aspect of tumor immunotherapy effect.

Description

Application of PPARG activator and SIRP alpha antibody in preparation of tumor immune drugs

Technical Field

The invention relates to the field of tumor immunotherapy, in particular to application of a PPARG activator and SIRP alpha antibody in preparation of tumor immune medicaments.

Background

Cancer has become the main death disease at present, and the cancer treatment mainly adopts radiotherapy, chemotherapy and surgical resection, but the treatment methods have the limitations of drug resistance, easy relapse and the like of patients. Numerous studies have shown that carcinogenesis is associated with a decline in the body's autoimmune system function, and cancer immunotherapy has become increasingly significant in recent years and the fourth leading strategy for current cancer therapy. Despite its superior efficacy relative to conventional therapies, immunotherapy has certain drawbacks, such as that antibody drugs (e.g., PD-1) approved by the U.S. Food and Drug Administration (FDA) and acting on immune checkpoints are effective in treating over 25 types of cancer, but less than 40% of cancer patients do not respond to the antibody drugs.

The host immune system is able to kill tumor cells and protect against tumor formation through innate or adaptive immunity. The surface of the tumor cell expresses CD47 protein, which is combined with macrophage SIRP alpha receptor, thereby inhibiting the phagocytosis of the tumor cell by the macrophage. Thus, CD47 is a "don't eat me" key signaling protein in the innate immune system. Numerous clinical studies have shown that overexpression of CD47 inhibits immunotherapy or enhances tumor cell immune escape.

As one of the nuclear receptor protein members, the peroxisome proliferator-activated receptor g (pparg) plays an important role in the regulation of metabolism, tumorigenesis, inflammation, and the like. In most tissues, the PPARG protein is widely expressed. The results of the existing research show that the PPARG activator can enhance the PPARG to inhibit the tumor growth. However, whether the PPARG activator enhances SIRPa antibody-mediated tumor immunotherapy is not clear at present.

Disclosure of Invention

In view of the above, the invention provides an application of PPARG activator and SIRP alpha antibody in preparation of tumor immune drugs. According to the invention, researches show that the PPARG activator has a remarkable inhibition effect on the expression of the CD47 protein, and the PPARG activator and the SIRPa antibody can obviously inhibit the growth of tumor cells and enhance the application of the SIRPa antibody in tumor immunotherapy.

The invention provides application of a PPARG activator and SIRPa antibody in preparation of a tumor treatment drug, and compared with single SIRPa, the PPARG activator and SIRPa antibody can obviously inhibit tumor growth.

The invention provides application of PPARG activator and SIRPa antibody in preparation of a medicine for treating tumors by regulating expression of CD47 protein.

In a specific embodiment, the PPARG activator is a substance that increases the transcriptional activity of PPARG, and further, the PPARG activator is a thiazolidinedione, preferably Pioglitazone (Pioglitazone), Rosiglitazone (Rosiglitazone) or Troglitazone (Troglitazone).

In a particular embodiment, the tumor is colon cancer or breast cancer.

The invention also provides a pharmaceutical composition for treating tumors, which comprises effective doses of PPARG activator and SIRPa monoclonal antibody.

The PPARG activator is a thiazolidinedione drug.

Further, the PPAR δ activator is Pioglitazone, Rosiglitazone or Troglitazone.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a new application of a PPARG activator and SIRP alpha antibody in tumor immunity drugs. A large number of experiments prove that the PPARG activator can obviously reduce the protein level of CD47 and inhibit the gene expression of CD47, so that the combined application of the SIRPa antibody can improve the tumor immunotherapy effect of the SIRPa antibody and better inhibit the tumor growth. Compared with single SIRPa antibody treatment, the PPARG activator and the SIRPa antibody disclosed by the invention can obviously inhibit the growth level of tumors in mice, and is obviously higher than that of a common antibody drug which is singly used. Has obvious effect on the aspect of tumor immunotherapy effect, in particular to the treatment of colon cancer.

Drawings

FIG. 1 shows the result of Western blot analysis of the PPARG activator on CD47 protein; in the figure, A is the analysis of CD47 protein in SW620 cells by different PPARG activators; panel B is a graph of the analysis of CD47 protein in SW620 cells by Pioglitazone at different doses; FIG. C is a graph of Pioglitazone analysis of CD47 protein in different tumor cells;

FIG. 2 is the results of flow cytometry analysis of the CD47 protein by PPARG activator;

FIG. 3 is the results of gene expression level of PPARG activator on CD 47; in the figure, A is a qPCR analysis result graph, B is a dual fluorescence report analysis result graph;

FIG. 4 shows the effect of PPARG activator in combination with SIRPa antibody on tumor growth; in the figure, a is a tumor volume map; b is the result of analyzing the expression level of the CD47 protein in tumor tissues by Western blot, wherein Tubulin is an internal reference protein.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It is further understood that the terms and phrases used herein have the ordinary meaning as is known to those skilled in the art and, notwithstanding the fact that the present invention is intended to be more fully described and interpreted herein, it is to be understood that such terms and phrases, if not inconsistent with such known meanings, will be given the full breadth of the meaning of the present invention as set forth herein. The term "activator" refers to a substance that increases the transcriptional activity of PPARG.

The present invention has been described generally and/or specifically with respect to materials used in testing and testing methods. Although many materials and methods of operation are known in the art for the purpose of carrying out the invention, the invention is nevertheless described herein in as detail as possible. It will be apparent to those skilled in the art that the materials and methods of operation used in the present invention are well known in the art, unless otherwise specified.

The experimental reagent:

the methods, devices and materials used in the examples which follow are, unless otherwise indicated, all conventional methods, devices and materials known in the art and are commercially available. SW480, HCT-116, MCF-7, CT-26 cancer cells were all purchased from ATCC, PPARG activators Pioglitazone, Rosglitazone, Troglitazone were purchased from CSNpharm (China); 0.25% pancreatin (containing EDTA) was purchased from Gibco. Tubulin, CD47, and PPARG antibodies were all purchased from Santa Cruz. Fetal Bovine Serum (FBS) and DMEM complete medium are all common medicines used by those skilled in the art, and the preparation and use methods are all common knowledge in the field. The total RNA extraction kit was purchased from Biotechnology engineering (Shanghai) Co., Ltd, and the qPCR reaction kit was purchased from Baozi physician Biotechnology (Beijing) Co., Ltd.

The sequences of the CD47 and Actin primers used in the present invention are as follows:

the sequence of the upstream primer of CD47 is shown as SEQ ID NO. 1, namely: GTTGGAGCCATTCTTTTCGTCCC, the sequence of the downstream primer is shown as SEQ ID NO. 2, namely: ATACACGCCGCAATACAGAGACT, respectively;

the sequence of the upstream primer of beta-actin is shown as SEQ ID NO. 3, namely: GGTGGGCATGGGTCAGAAGGAT, the sequence of the downstream primer is shown in SEQ ID NO. 4, namely: GCCACACGCAGCTCATTGTAGAAG are provided.

Example 1: PPARG activators reduce protein levels of CD47

The effect of the PPARG activator on the protein level of CD47 was demonstrated in this example. Respectively culturing SW620, HCT-116 and MCF-7 cells in DMEM complete culture medium containing 10% Fetal Bovine Serum (FBS) by conventional method, digesting with 0.25% pancreatin when microscopic examination reaches 80% fusion degree, inoculating the cells in 6-well plate, and placing at 37 ℃ and 5% CO ₂ After overnight in the incubator and when the density reached 70% -90% of the wells, the cells were treated for 12 hours using Dimethylsulfoxide (DMSO) as a control group and Pioglitazone, Rosiglitazone, Troglitazone as a test group, respectively.

(1) Cell lysis and Western blot analysis of CD47 protein expression;

(2) cells were collected, centrifuged, and cells were filtered using a 40 μm filter, 2 × 10 ⁵ Cells were incubated with a fluorescently labeled CD47 antibody, incubated at room temperature for 30 minutes, cells were washed several times with PBS, and the effect of PPARG activator Pioglitazone on the expression level of CD47 membrane protein was analyzed using a flow cytometer.

FIG. 1 is a Western blot analysis of PPARG activator on CD47 protein; in the figure, panel A is an analysis of CD47 protein in SW620 cells by different PPARG activators; fig. B is a graph of the analysis of CD47 protein in SW620 cells by Pioglitazone at different doses; panel C is a graph of Pioglitazone (50. mu.M) analysis of CD47 protein in SW620, HCT-116, MCF-7 cells. Wherein the PPARG is an endogenous PPARG protein; tubulin is an internal reference protein. As can be seen from FIG. 1, after SW620 cells were treated with PPARG activators Pioglitazone (50. mu.M), Rosiglitazone (50. mu.M) and Troglitazone (50. mu.M), respectively, the expression of CD47 protein in SW620 cells was inhibited to various degrees; after SW620 cells are treated by PPARG activator Pioglitazone with different doses (0-50 mu M), the expression of CD47 protein is weakened along with the increase of the concentration of the Pioglitazone; pioglitazone inhibits CD47 protein expression in SW620 cells, HCT-116 cells, and MCF-7 cells.

FIG. 2 is a diagram of a flow cytometric analysis of the CD47 protein by PPARG activator; results are expressed as mean ± SEM (n = 3), P < 0.05. As shown in FIG. 2, the fluorescence intensity of PPARG activator Pioglitazone (50. mu.M) was significantly reduced compared to control DMSO, indicating that PPARG activator Pioglitazone significantly reduces the levels of CD47 protein in SW620, HCT-116, and MCF-7 cells.

Example 2: PPARG activator for inhibiting CD47 gene expression

In this example, the effect of the PPARG activator Pioglitazone (PIOG) (50. mu.M) on the expression of CD47 gene was examined. SW620, HCT-116 and MCF-7 cancer cells are cultured in DMEM complete culture medium containing 10% Fetal Bovine Serum (FBS) in a conventional way, when the fusion degree reaches 80% under a microscope, the cancer cells are digested by 0.25% pancreatin, inoculated in a 6-well plate and placed at 37 ℃ and 5% CO ₂ After overnight in the incubator and when the density reached 70% -90% of the wells, the cells were treated with DMSO as a control and PIOG (50. mu.M) as an experimental group, respectively.

(1) After the cells are treated for 12h, the cells are cracked, and the expression of the CD47 gene is analyzed by qPCR;

(2) cells are transfected with a CD47 reporter gene plasmid, the cells are lysed after 30 hours, and the transcriptional activity of the CD47 gene is analyzed through a double-fluorescence report. FIG. 3 is a graph of the gene expression level of PPARG activator on CD 47; in the figure, A is a qPCR analysis result graph, B is a dual fluorescence report analysis result graph; results are expressed as mean ± SEM (n = 3), P < 0.05. As can be seen from FIG. 3, PPARG activator significantly reduced the level of CD47 gene expression in SW620, HCT-116 and MCF-7 cells. In addition, double fluorescence report analysis shows that PPARG activator remarkably reduces the transcriptional activity of CD47 gene in SW620, HCT-116 and MCF-7 cells.

Example 3: PPARG activator combined with SIRP alpha antibody for remarkably inhibiting tumor growth

In this example, the effect of PPARG activator pioglitazone (piog) in combination with sirpa antibody on tumor growth was verified. CT-26 cells (2X 10) ⁵ ) C57BL/6 mice were inoculated subcutaneously and the inoculated mice were randomly divided into four groups, each: IgG (control), sirpa antibody, PIOG, and sirpa antibody + PIOG; IgG/SIRP α antibody (200. mu.g/mouse) was injected subcutaneously every three days, and PIOG (20mg/kg/day) was gavaged every day. Tumor volumes were measured weekly for 4 weeks, and finally mice were sacrificed by cervical dislocation. Tumor volume calculation formula = 1/2 (length × width) ² ). And analyzing the expression level of CD47 protein in the tumor tissue lysate by using Western blot, wherein Tubulin is an internal reference protein.

FIG. 4 is a graph of the effect of PPARG activator in combination with a SIRPa antibody on tumor growth; in the figure, a is a tumor volume map; b is a graph of expression level of CD47 protein in tumor tissues analyzed by Western blot, wherein Tubulin is an internal reference protein.

As can be seen from fig. 4, the sirpa antibody + PIOG group can significantly inhibit the growth of tumor tissue and the expression level of CD47 protein in tumor tissue is reduced, compared to the sirpa antibody group and PIOG group alone. It is known that the PPARG activator Pioglitazone (PIOG) and the SIRPa antibody can inhibit the growth of tumors by combining application, particularly has obvious inhibition effect on the growth of colon cancer, and is related to the reduction of the expression of CD47 protein in tumor tissues.

It should be noted that, in this example, cancer cells SW620, HCT-116 and MCF-7 were used as specific cell lines to verify the effect of the combined application of the sirpa antibody and the PPARG activator on the expression of CD47 protein on the surface of tumor cells, and it is clear to those skilled in the art that the selection of SW620, HCT-116 and MCF-7 cells is only an exemplary selection to verify the effect of the combined application of the sirpa antibody and the PPARG activator on CD47 protein, and cannot be used as a limitation to the tumor type in the application of the sirpa antibody and the PPARG activator as tumor immunotherapy drugs.

The above description is only for the preferred embodiment of the present invention, and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention shall fall within the protection scope of the present invention.

Sequence listing

<110> Jiangsu university

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gttggagcca ttcttttcgt ccc 23

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atacacgccg caatacagag act 23

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtgggcatg ggtcagaagg at 22

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gccacacgca gctcattgta gaag 24

Claims

Use of a PPARG activator which is Pioglitazone in combination with a SIRPa antibody for the manufacture of a medicament for the immunotherapy of tumours, wherein the cells of said tumours are CT-26.