CN111035765A

CN111035765A - Application of PPAR α activator and PD-1 antibody in preparation of tumor immunotherapy drug

Info

Publication number: CN111035765A
Application number: CN201911347854.6A
Authority: CN
Inventors: 侯永忠; 贾晓; 苟倩; 董晨; 史娟娟
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2020-04-21

Abstract

The invention relates to the field of tumor immunotherapy, in particular to application of a PPAR α activator and a PD-1 antibody in preparing a tumor immunotherapy medicament, and researches show that a cell peroxisome proliferator-activated receptor α (PPAR α) activator can reduce the protein level of PD-L1 so as to increase the tumor immunotherapy of the PD-1 antibody, thereby inhibiting the tumor growth, and further show that the PPAR α activator can obviously enhance the tumor immunotherapy effect of the PD-1 antibody medicaments and the like.

Description

Application of PPAR α activator and PD-1 antibody in preparation of tumor immunotherapy drug

Technical Field

The invention relates to the field of tumor immunotherapy, in particular to application of a PPAR α activator and a PD-1 antibody in preparing a tumor immunotherapy medicament.

Background

A great deal of research shows that the human immune system can recognize and kill tumor cells, so that when the function of the immune system is reduced, the tumor is induced, and the cancer can be effectively inhibited by improving the immunity of the organism. Currently, tumor immunotherapy has become a hot spot of research, and a large number of immunotherapy-related drugs are being researched and developed or are already put into clinical use. PD-1 (programeddeath-1) antibody/PD-L1 antibody belong to immune checkpoint blockade drugs. PD-1 is another important immunoprinted transmembrane protein expressed on the surface of T cells, a member of the CD28 superfamily, originally cloned from the apoptotic mouse T cell hybridoma 2B 4.11. PD-1 has two ligands, PD-L1 and PD-L2, PD-L1 is expressed more broadly than PD-L2, in the microenvironment of tumor, tumor cells can express PD-L1 or PD-L2. Although immunotherapy has a higher efficacy than conventional therapies, it still has some drawbacks, such as that antibody drugs approved by the U.S. Food and Drug Administration (FDA) and acting on immune checkpoints (immuncheck points) can effectively treat more than 25 types of cancers, but nearly 40% of cancer patients do not respond to the above antibody drugs acting on immune checkpoints.

PPAR α is one of the members of the Peroxisome-Proliferator-activated receptors (PPARs) family, which plays a key role in regulating tumor, inflammation, metabolism.

Disclosure of Invention

The invention researches PPAR α activator and tumor immune check point blocking medicine, and finds that PPAR α activator can obviously reduce the protein level of PD-L1 and inhibit the gene expression of PD-L1, and PPAR α activator and PD-1 antibody can obviously enhance the tumor immunotherapy capability of PD-1 antibody.

The invention provides application of a PPAR α activator in combination with a PD-1 antibody in preparation of a tumor immunotherapy medicament.

Further, the PD-1 antibody is an anti-human PD-1 monoclonal antibody, the PPAR α activator is Clofibrate or wy-14,643, and the tumor is colon cancer.

The invention also provides a pharmaceutical composition for treating tumors, which comprises effective doses of PPAR α activator and PD-1 antibody, wherein the PPAR α activator in the pharmaceutical composition is Clofibrate or Wy-14,643, and the PD-1 antibody is anti-human PD-1 monoclonal antibody.

Compared with the prior art, the invention has the beneficial effects that:

the research of the invention finds that the activator of a peroxisome proliferator-activated receptor α (PPAR α) of cells can reduce the protein level of PD-L1 and further increase the tumor immunotherapy of a PD-1 antibody so as to inhibit the tumor growth, and further finds that the activator of PPAR α can obviously enhance the tumor immunotherapy effect of the PD-1 antibody.

Drawings

FIG. 1 shows the analysis results of the effect of PPAR α activator on the expression of PD-L1 protein, wherein A is a Western blot analysis chart and B is a flow cytometry analysis chart;

FIG. 2 shows the results of analysis of the gene expression level of PD-L1 by PPAR α activator, wherein A is a graph showing the results of qPCR analysis and B is a graph showing the results of dual fluorescence reporter analysis;

FIG. 3 shows the effect of PPAR α activator in combination with PD-1 antibody on tumor growth, wherein A is a graph comparing tumor volumes and B is a graph showing the result of Western blot analysis.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It is further to be understood that the various terms and phrases used herein have the ordinary meanings commonly known to those skilled in the art, and that even so, it is intended that the present invention be more fully described and explained herein, and that reference to such terms and phrases is not to be construed as consistent with the known meanings, based on the meaning of the present invention as expressed herein, the term "activator" refers to a substance that specifically binds to PPAR α protein and modulates PPAR α transcriptional activity.

The present invention has been described generally and/or specifically with respect to materials used in testing and testing methods. Although many materials and methods of operation are known in the art for the purpose of carrying out the invention, the invention is nevertheless described herein in as detail as possible. It will be apparent to those skilled in the art that the materials and methods of operation used in the present invention are well known in the art, unless otherwise specified.

Experimental reagent:

SW480, HCT-116, CT-26 mouse colon cancer cells were purchased from ATCC of America, Actin, PD-L1, PPAR α antibodies were purchased from Shanghai bioengineering Co., Ltd, Clofurate, wy-14,643 was purchased from CSNpharm (China), 0.25% pancreatin (containing EDTA) was purchased from Gibco, Fetal Bovine Serum (FBS) and DMEM complete medium were all commonly used drugs by those skilled in the art, preparation and application methods are common knowledge in the art.

The sequences of PD-L1 and Actin primers used in the invention are as follows:

the upstream primer sequence of PD-L1-Lu is shown as SEQ ID NO:1, namely: CGGGGTACCGAAGCAAAAGTGGCAAGCAGGG, the sequence of the downstream primer is shown in SEQ ID NO. 2, namely: CCGCTCGAGACAGAAGCGCGGCTGGTGCGG, respectively;

the sequence of the upstream primer of PD-L1 is shown in SEQ ID NO:3, namely: TGGCATTTGCTGAACGCATTT, the sequence of the downstream primer is shown in SEQ ID NO. 4, namely: TGCAGCCAGGTCTAATTGTTTT, respectively;

the sequence of the upstream primer of Actin is shown as SEQ ID NO. 5, namely: GGTGGGCATGGGTCAGAAGGAT, the sequence of the downstream primer is shown in SEQ ID NO. 6, namely: CACACGCAGCTCATTGTAGAAGGT are provided.

Example 1 PPAR α activator reduces protein levels of PD-L1

In this example, dimethyl sulfoxide (DMSO) was used as a control group, Clofibrate (Clofibrate) and wy-14,643 were used as experimental groups to verify the effect of PPAR α activators on the protein level of PD-L1 SW480, HCT-116 and CT-26 cells were each routinely cultured in DMEM complete medium containing 10% Fetal Bovine Serum (FBS) and when 80% confluence was reached by microscopic examination, digested with 0.25% pancreatin 12-well plates and placed in 37 ℃ and 5% CO in 12-well plates₂After overnight in the incubator, and when the density reached 70% -90% of the wells, the cells were treated for 12 hours in the control group, experimental group (5 μ M).

(1) Cell lysis and Western blot analysis of PD-L1 protein expression, wherein PPAR delta is endogenous PPAR delta protein; actin is an internal reference protein;

(2) the cells were collected, centrifuged, and the cells were filtered through a 40 μm filter. 2X 10⁵Cells were incubated with fluorescently labeled PD-L1 antibody against IgG1 control for 30 min at room temperature, cells were washed several times with PBS, and finally PD-L1 membrane protein expression levels were analyzed by flow cytometry, with mean ± SEM (n = 3); P<0.05。

FIG. 1 is a graph showing the effect of PPAR α activator on the expression of PD-L1 protein, wherein A is a Western blot analysis graph of SW480, HCT-116 and CT-26 cells, and B is a comparison graph of the expression level of PD-L1 analyzed by flow cytometry, from FIG. 1, it can be seen that the PPAR α activator Clofibrate, wy-14,643 can significantly reduce the protein level of SW480, HCT-116, CT-26 colon cancer cell lines PD-L1, and the flow cytometry analysis result also shows that Clofibrate, wy-14,643 can significantly reduce the protein level of SW480, HCT-116, CT-26 colon cancer cell lines cell membranes PD-L1.

Example 2 inhibition of PD-L1 Gene expression by PPAR α activator

In this example, DMSO was used as a control, and Clorofibrate (5. mu.M) and wy-14,643 (5. mu.M) were used as experimental groups to verify that PPAR α activator pairs the PD-L1 geneThe effect of expression. Conventionally culturing SW480, HCT-116 and CT-26 cells in DMEM complete culture medium containing 10% Fetal Bovine Serum (FBS), digesting with 0.25% pancreatin when microscopic examination shows that 80% fusion degree is achieved, inoculating the cells into a 12-well plate, and placing the 12-well plate at 37 ℃ and 5% CO₂After overnight in the incubator, and the density reached 70% -90% of the wells.

(1) After the cells are treated for 12 hours, the cells are cracked, and the expression level of the PD-L1 gene is analyzed by qPCR; results are expressed as mean ± SEM (n = 3). +P<0.05。

(2) SW480, HCT-116 and CT-26 cells are transfected with PD-L1 reporter gene plasmid, and after 30 hours, the transcriptional level of PD-L1 gene is analyzed by double fluorescence report.

FIG. 2 is a graph showing the gene expression level of PPAR α activator to PD-L1, wherein A is a graph showing the results of qPCR analysis and B is a graph showing the results of dual fluorescence reporter analysis, and it can be seen from FIG. 2 that PPAR α activator Clofibrate, wy-14,643 significantly decreased the mRNA level of SW480, HCT-116, CT-26 colon cancer cell line PD-L1, and further, that Clofibrate, wy-14,643 significantly decreased the transcription level of SW480, HCT-116, CT-26 colon cancer cell line PD-L1 gene.

Example 3 PPAR α activator in combination with PD-1 antibody significantly inhibited tumor growth

The effect of PPAR α activator in combination with PD-1 antibody on tumor growth was demonstrated in this example.

CT-26 mouse colon cancer cells (5X 10)⁵) The mice were inoculated subcutaneously into nude mice, and the inoculated mice were randomly divided into four groups: IgG (control), PD-1, Clofurate and PD-1+ Clofurate groups; IgG/PD-1 antibody (200. mu.g/mouse) was injected subcutaneously every three days and Clofibrate (20mg/kg/day) was gavaged daily. Tumor volumes were measured weekly every day for 4 weeks, and finally mice were sacrificed by cervical dislocation. Taking tumor tissue for detection, the tumor volume calculation formula = 1/2 (length × width)²). Results are expressed as mean ± SEM (n = 8). +,P<0.05. and analyzing the expression level of PD-L1 protein in the tumor tissue lysate by using Western blot, wherein Actin is an internal reference protein.

FIG. 3 is a graph showing the effect of PPAR α activator in combination with PD-1 antibody on tumor growth, wherein A is a graph showing the comparison of tumor volume and B is a graph showing the expression level of PD-L1 protein in tumor tissues by Western blot analysis, it can be seen from FIG. 3 that the tumor volume of the mice of PD-1+ Clofurate group is significantly smaller than that of the mice of PD-1 group and Clofurate group, and the combined use of PD-1 antibody and PPAR α activator Clofurate enhances the tumor immunotherapy of PD-1 antibody.

The above examples are only for illustrating the technical idea and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the content of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered in the protection scope of the present invention.

Sequence listing

<110> university of Jiangsu

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cggggtaccg aagcaaaagt ggcaagcagg g 31

<210>2

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccgctcgaga cagaagcgcg gctggtgcgg 30

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tggcatttgc tgaacgcatt t 21

<210>4

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgcagccagg tctaattgtt tt 22

<210>5

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggtgggcatg ggtcagaagg at 22

<210>6

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cacacgcagc tcattgtaga aggt 24

Claims

The application of PPAR α activator and PD-1 antibody in preparing tumor immunotherapy medicine.
2. The use as claimed in claim 1 wherein the PPAR α activator is Clofibrate or wy-14,643.
3. The use as claimed in claim 1 wherein the tumour is colon cancer.
4. A pharmaceutical composition for treating tumors comprising an effective amount of a PPAR α activator and a PD-1 antibody.
5. The pharmaceutical composition of claim 4, wherein the PPAR α activator is Clofibrate or Wy-14,643.