CN115125279B

CN115125279B - Recombinant microorganism and method for producing 2' -deoxycytidine

Info

Publication number: CN115125279B
Application number: CN202210818438.5A
Authority: CN
Inventors: 江君君; 利爱利; 田锋; 黄祝渊
Original assignee: Suzhou Biosynthetica Co ltd
Current assignee: Suzhou Biosynthetica Co ltd
Priority date: 2022-07-12
Filing date: 2022-07-12
Publication date: 2024-04-12
Anticipated expiration: 2042-07-12
Also published as: CN115125279A

Abstract

The invention provides a recombinant microorganism and a method for producing 2' -deoxycytidine, belonging to the technical field of biology. The invention unexpectedly discovers that the coding gene udk of the cytidine/uridine kinase (Udk) can be knocked out to improve the yield of 2 '-deoxycytidine, and Udk has the activity of catalyzing the 2' -deoxycytidine to generate dCMP through an in vitro reaction. The recombinant microorganism can be used for industrial production of 2' -deoxycytidine, and is easy to operate, thereby achieving the purpose of producing 2' -deoxycytidine in a green environment-friendly and low-cost way and providing a new thought and method for producing 2' -deoxycytidine.

Description

Recombinant microorganism and method for producing 2' -deoxycytidine

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a recombinant microorganism and a method for producing 2' -deoxycytidine.

Background

2' -deoxycytidine is pyrimidine 2' -deoxyribonucleoside with cytosine as base, and consists of cytosine and 2' -deoxyribose, and has molecular formula of C ₉ H ₁₅ N ₃ O ₄ The molecular weight is 227.22, the white powder is easy to dissolve in water. 2' -deoxycytidine is an important pharmaceutical intermediate, mainly used for chemically synthesizing various drugs, such as decitabine (Dacog ^TM 5-aza-2' -deoxycytidine) for the treatment of myelodysplastic syndrome (a type of disease in which certain blood cells are dysfunctional), acute myeloid leukemia, etc. In addition, 2' -deoxycytidine is also used for synthesizing monomers of deoxynucleotide, and preparing oligodeoxynucleotide, which is widely applied to nucleic acid and genetic engineering, such as dNTP, various primers and the like.

At present, 2 '-deoxycytidine is mainly chemically synthesized, alpha-D-2-deoxyribose and uracil are used as starting materials, and target 2' -deoxycytidine is obtained through 6 steps of methylglycosidation, esterification, chlorination, nucleophilic substitution, efficient ammoniation, hydrolysis deprotection and the like, and through one-time recrystallization. However, the chemical method for producing 2' -deoxycytidine is relatively complicated, the cost is high, and the product yield is low. The cost effectiveness of producing 2' -deoxycytidine using microorganisms is better than that of chemical production processes, and has gradually become a hot spot in recent years. For example, lee et al constructed genetically engineered Corynebacterium ammoniagenes for 2' -deoxycytidine production by chemical mutagenesis (Lee YB, baek H, kim SK, hyun HH et al Deoxyytidine production by metabolically engineered Corynebacterium ammonia plants J Microbiol 49:53-57 (2011)). In addition, kim et al carried out 2' -deoxycytidine production by knocking out a series of genes such as deoA, udp, deoD, dcd, cdd, codA and over-expressed genes nrdBCA, yfbR and pyrG on the genome of E.coli BL21 (DE 3) (Kim, JS., koo, BS., hyun, HH.et al Deoxydine production by a metabolically engineered Escherichia coli strain Microb Cell face 14,98 (2015)).

However, the recombinant microorganism strain fermentation method reported in the above document is used to produce 2' -deoxycytidine with limited yield improvement, and the plasmid is high copy, easy to lose with the prolonged fermentation time, and further has difficulty in strain amplification. Therefore, there is a need to find a method for improving the yield of 2' -deoxycytidine produced by microbial fermentation, which is easy to operate and applicable to industrial production.

Disclosure of Invention

In view of the above problems, the present invention provides a recombinant microorganism and a method for producing 2' -deoxycytidine. The invention unexpectedly found that knocking out the coding gene udk of cytidine/uridine kinase (Udk) can increase the yield of 2' -deoxycytidine. The recombinant microorganism can be used for industrial production of 2 '-deoxycytidine, and is easy to operate, so that the aim of producing 2' -deoxycytidine in a green environment-friendly and low-cost way is fulfilled.

Terminology:

1. 2' -deoxycytidine: the English abbreviation "dCR" in the present invention refers to 2' -deoxidized cells unless otherwise specifiedGlycosides of formula C ₉ H ₁₅ N ₃ O ₄ The molecular weight is 227.22, and the structural formula is shown in the following formula (1).

2. Recombinant microorganism: if not specified, the Chinese name "recombinant microorganism" in the invention refers to a microorganism which is artificially treated; such human treatment includes, but is not limited to: gene knockout, gene suppression, gene silencing, gene insertion, gene mutation, exogenous expression or over-expression of genes, and the like.

3. Host bacteria: the Chinese name "host bacteria" in the present invention refers to microorganisms to be artificially treated unless otherwise specified.

4. Seed liquid: if not specified, the Chinese name "seed liquid" in the invention refers to a microorganism culture liquid which is obtained by activating microorganisms through a test tube inclined plane, culturing in a flat or shake flask or culturing in a seed tank in a gradual expansion mode and contains a certain number of microorganisms and has better activity and quality.

5. High yield: "high yield" in the present invention means that the yield of 2' -deoxycytidine is higher than that of the parent microorganism, unless otherwise specified.

6. Low yield: "Low yield" in the present invention means that the yield of 2' -deoxycytidine is lower than that of the parent microorganism, unless otherwise specified.

7. Exogenous expression or overexpression: any increase in expression of a protein (including nucleic acid expression) as compared to the expression level of the protein(s) (including nucleic acid (s)) of the parent microorganism under the same conditions should be considered broadly as being included in relation to the use of the invention. It should not be considered to mean that the protein (or nucleic acid) is expressed at any particular level.

8. A parent microorganism: is a microorganism from which the microorganism of the present invention is derived. The microorganism of the present invention may be produced by any method such as artificial or natural selection, mutation or gene recombination. The parent microorganism may be a naturally occurring microorganism (i.e., a wild-type microorganism) or a microorganism that has been previously modified, but does not produce or overproduce 2' -deoxycytidine.

9. And (3) a carrier: it should be construed broadly to include any nucleic acid (including DNA and RNA) suitable for use as a vehicle for transferring genetic material into cells, including plasmids, viruses (including phages), cosmids, and artificial chromosomes. The vector may include one or more regulatory elements, origins of replication, multiple cloning sites, and/or selectable markers.

10. Convention for protein and gene names: the English protein names related in the invention are all capital letters; the English gene names related in the invention are all initial lower case positive.

In order to achieve the above object, the present invention has the following technical scheme:

in one aspect, the invention provides the use of cytidine/uridine kinase to catalyze the conversion of 2' -deoxycytidine to deoxycytidine monophosphate.

Specifically, the cytidine/uridine kinase is Udk.

In another aspect, the invention provides the use of agents and/or methods for knocking down or knocking out cytidine/uridine kinase in increasing 2' -deoxycytidine production.

Specifically, the cytidine/uridine kinase is Udk.

In yet another aspect, the present invention provides a recombinant microorganism comprising the following features: a reduced level or activity of cytidine/uridine kinase, and/or a reduced deletion, inactivation, or viability of a gene encoding the cytidine/uridine kinase; the recombinant microorganism is used for producing 2' -deoxycytidine.

Specifically, the cytidine/uridine kinase is Udk.

Specifically, the recombinant microorganism further comprises the following characteristics: the ribonucleoside diphosphate reductase (ribonucleoside-diphosphate reductase) and thioredoxin have increased levels or activity and/or the ribonucleoside diphosphate reductase and thioredoxin have increased coding genes, copy numbers or activity.

Further specifically, the ribonucleoside diphosphate reductase is ribodiphosphate reductase NrdB and NrdA derived from T4 phage, and the thioredoxin is NrdC.

Specifically, the microorganisms include, but are not limited to, escherichia coli (Escherichia coli), bacillus (Bacillus), corynebacterium glutamicum (Corynebacterium glutamicum), salmonella (Salmonella), and Saccharomyces (Yeast).

In yet another aspect, the present invention provides the use of the recombinant microorganism described above for the production of 2' -deoxycytidine.

In yet another aspect, the present invention provides a method for producing 2' -deoxycytidine, comprising fermentatively producing 2' -deoxycytidine using the above recombinant microorganism or producing 2' -deoxycytidine using the above recombinant microorganism whole cell product-catalyzed substrate.

Specifically, the whole cell products include, but are not limited to: culture fluid, cell lysate, supernatant fraction of cell lysate, pellet fraction of cell lysate, etc. It should be noted that the operation method of whole cell products and the new technology of specific product types in future technical development are also within the scope of the present invention as claimed above.

Specifically, the method comprises the following steps:

activating the recombinant microorganism to prepare seed liquid;

adopts shaking flask fermentation: inoculating 1-5% of the inoculum size into fermentation medium, culturing at 37deg.C with shaking table at 250rpm for 3-5 hr, adding 1mM final concentration of IPTG, adjusting shaking table temperature to 34 deg.C, and fermenting for 18-22 hr.

More specifically, the inoculation amount is 1-2%.

Further specifically, the fermentation medium comprises the following components: 20-40g of glucose, 180-220mL of 5N-5 times salt solution, 0.5-1.5mL of TM2 solution, 8-12mg of ferric citrate, 240-250mg of magnesium sulfate heptahydrate, 105-115mg of calcium chloride and 0.5-1.5 mug of thiamine in per liter of culture medium, and fixing the volume to 1L by sterile deionized water; wherein the 5N-5 times of salt solution is 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate, 2.5g of sodium chloride and 25g of ammonium chloride, and the volume is fixed to 1L by ionized water; the TM3 solution was zinc chloride tetrahydrate 2.0g, calcium chloride hexahydrate 2.0g, sodium molybdate dihydrate 2.0g, copper sulfate pentahydrate 1.9g, boric acid 0.5g, hydrochloric acid 100mL, deionized water to a volume of 1L.

More specifically, the fermentation period is 20h.

Further specifically, the fermentation medium comprises the following components: 30g of glucose, 200mL of 5N-5 times salt solution, 1mL of TM2 solution, 10mg of ferric citrate, 246mg of magnesium sulfate heptahydrate, 111mg of calcium chloride and 1 mug of thiamine are added into each liter of culture medium, and the volume is fixed to 1L by sterile deionized water.

Compared with the prior art, the invention has the following positive and beneficial effects:

(1) The invention surprisingly discovers that in the actual production process, cytidine/uridine kinase catalyzes 2' -deoxycytidine to deoxycytidine monophosphate, and the conclusion is proved by in vitro enzyme catalysis experiments, and no related report exists before. On the basis, the cytidine/uridine kinase can be knocked out to obviously improve the yield of 2 '-deoxycytidine, and provides a new thought and method for the production of 2' -deoxycytidine.

(2) The recombinant microorganism adopted to produce 2 '-deoxycytidine has higher yield, short fermentation period and high production strength, and can be used for large-scale industrial production of the 2' -deoxycytidine.

(3) The construction method of the recombinant microorganism provided by the invention is a directional rational strain construction method, and is more efficient and convenient compared with the traditional mutagenesis method, and has strong operability.

Drawings

FIG. 1 is a schematic diagram of the metabolic pathway of 2' -deoxycytidine.

Wherein, pyrE: orotic acid phosphoribosyl transferase; nrdA, nrdB: nucleoside diphosphate reductase; nrdC: thioredoxin; yfbR: dCMP phosphohydrolase; dcd: dCTP deaminase; cdd: cytidine/deoxycytidine deaminase; tdk: thymidine/deoxyuridine kinase; udk: uridine/cytidine kinase; dut: deoxynucleotide triphosphatase; thyA: thymidylate synthase; deoA: thymidine phosphorylase; OMP: orotic acid-5' -monophosphate; UMP: uracil ribonucleotides; UDP: uridine diphosphate; UTP: uridine triphosphate; CR: cytidine; cytosine: cytosine; CMP: cytidine monophosphate; CDP: cytidine diphosphate; CTP: cytidine triphosphate; dUDP: deoxyuridine diphosphate; dUTP: deoxyuridine triphosphate; dCDP: deoxycytidine diphosphate; dCTP: deoxycytidine triphosphate; dCMP: deoxycytidine monophosphate; dCR:2' -deoxycytidine; dUMP: deoxyuridine monophosphate; dUR: deoxyuridine; dTMP: deoxythymidine monophosphate; dTDP: deoxythymidine diphosphate; dTTP: deoxythymidine triphosphate.

FIG. 2 shows the corresponding HPLC peak pattern of the product and by-product.

FIG. 3 is a graph showing the results of Udk in vitro enzyme catalysis experiments.

Detailed Description

The present invention will be described in further detail with reference to the following examples, which are not intended to limit the present invention, but are merely illustrative of the present invention. The experimental methods used in the following examples are not specifically described, but the experimental methods in which specific conditions are not specified in the examples are generally carried out under conventional conditions, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

The technical scheme of the invention can be applied to escherichia coli, bacillus subtilis, corynebacterium glutamicum, lactobacillus or other microorganisms, and the technical scheme is further described below by taking escherichia coli as an example.

Experimental method 1: gene knockout method

The invention adopts the Datsenko method to knock out the microorganism gene, and based on a Red recombination system, uses a primer with 50-nt homologous extension to replace a target gene sequence by an optional antibiotic drug resistance gene generated by PCR, thereby achieving the purpose of gene knockout. The specific gene knockout methods employed in the present invention are described in the literature: K.A.Datsenko, B.L.Wanner.One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.Proceedings of the National Academy Sciences of the USA,2000,97 (12): 6640-6645. Corresponding gene knockout primers are shown in Baba 2006.Mol Syst Biol,2 (1) 0008.

Experimental method 2: method for producing 2' -deoxycytidine by shake flask fermentation verification recombinant strain

1. Reagent(s)

(1) Fermentation medium: 30g of glucose, 200mL of 5N-5 times salt solution, 1mL of TM3 solution, 10mg of ferric citrate, 246mg of magnesium sulfate heptahydrate, 111mg of calcium chloride and 1 mug of thiamine are added into each liter of culture medium, and the volume is fixed to 1L by sterile deionized water.

Wherein, the 5N-5 times of salt solution is 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate per liter, 2.5g of sodium chloride and 25g of ammonium chloride, and the volume is fixed to 1L by ionized water; the TM3 solution was zinc chloride tetrahydrate 2.0g, calcium chloride hexahydrate 2.0g, sodium molybdate dihydrate 2.0g, copper sulfate pentahydrate 1.9g, boric acid 0.5g, hydrochloric acid 100mL, deionized water to a volume of 1L.

Sterilizing the above solution with high pressure steam at 121deg.C for 20-30min.

(2) LB medium: each liter of the culture medium contains 5g of yeast powder, 10g of sodium chloride, 10g of peptone and deionized water to a volume of 1L (J.Sam Brookfield Huang Peitang translation, molecular cloning guide 2002,1595).

2. Instrument: constant temperature shaking incubator.

3. The method comprises the following steps:

the shaking flask fermentation process is as follows: (1) Inoculating the recombinant strain into 4mL of LB culture medium containing antibiotics, and culturing at 37 ℃ with a shaking table at 250 rpm; (2) Transferring 500 mu L of the seeds after 16h of culture to 2mL of LB liquid medium containing antibiotics, and culturing for 4h at a shaking table of 250rpm at 37 ℃; (3) 2.5mL of the secondary seeds are all transferred into a shake flask filled with 18mL of fermentation medium, placed in a shaking table at 37 ℃ and cultured for 4 hours at 250 rpm; (4) Adding IPTG to a final concentration of 1mM, regulating the temperature of the shaking table to 34 ℃, continuously culturing for about 20 hours, taking 1mL of fermentation liquor, centrifuging (12000 rpm,1 min), taking supernatant for detection, and the detection method is shown in the experimental method 3.

Experimental method 3: HPLC determination of 2' -deoxycytidine in fermentation broth

The broth was diluted with water to a certain multiple, centrifuged through a 0.22 μm filter and detected by High Performance Liquid Chromatography (HPLC). The HPLC parameters were as follows: adopting XBidgeC 18.6 x 150mM5um, wherein the mobile phase is methanol and 10mM ammonium acetate or PBS (pH 4.0), the ratio of the mobile phase is 0.01-4.5 min, the ratio of the methanol is 2% and is increased to 20%, the ratio of the methanol is 4.5-4.6 min, the ratio of the methanol is reduced to 2% from 20%, the ratio of the methanol is maintained to 2% from 4.6-8 min, and the detection wavelength is 260nm by using an ultraviolet detector; the flow rate of the initial mobile phase is 1.0mL/min, the loading amount of the fermentation liquid is 2 mu L, and the column temperature is 30 ℃. The peak time of 2' -deoxycytidine was 6.55 min, the peak time of orotic acid was 2.48 min, and the peak time of cytidine was 4.16 min, and the HPLC chart was shown in FIG. 2.

Example 1: construction of recombinant E.coli incapable of utilizing and degrading 2' -deoxycytidine

As shown in FIG. 1, there are two flow directions of 2' -deoxycytidine in E.coli: the first path is that 2 '-deoxycytidine enters a dUMP refill path, the generated 2' -deoxycytidine is converted into deoxyuridine dUR under the catalysis of cytidine/deoxycytidine deaminase (Cdd), dUMP is generated under the catalysis of deoxyuridine kinase (Tdk), dTMP is further generated under the catalysis of thymidylate synthase (ThyA), dTMP is regenerated into dTDP, dTTP and the like which are used as precursors for cell DNA synthesis; the second pathway is the degradation of 2' -deoxycytidine to cytosine catalyzed by thymidine phosphorylase (DeoA). Therefore, in order to accumulate 2' -deoxycytidine in cells more, it is necessary to knock out cdd, deoA and other genes and to intercept salvage and degradation pathways.

The present invention constructed strain SHA57 (W3110. DELTA. CddDELTA. DeoA) by knocking out the cdd and deoA genes that utilized and degraded 2' -deoxycytidine in W3110 according to Experimental method 1 using E.coli W3110 (ATCC 27325) as an initial strain (Table 1).

TABLE 1 construction of genetically engineered strains

Coli has three known pathways for aerobic de novo dUMP (substrate for dTMP synthesis): dCTP, dUTP and 2' -deoxycytidine pathways. dUMP in E.coli is 75-80% synthesized by the dCTP pathway (Neuhard, J., and R.Kelln.1996. Biosystemsis and conversions of pyrimidines, p.580-599.In F.C.Neidhardt,R.Curtiss III,J.L.Ingraham,E.C.C.Lin,K.B.Low,B.Magasanik,W.S.Reznikoff,M.Riley,M.Schaechter,and H.E.Umbarger (ed.), escherichia coli and Salmonella: cellular and molecular biology,2nd ed.ASM Press,Washington,DC.). The first step in the dCTP pathway is the conversion of dCTP to dUTP by dCTP deaminase encoded by the dcd gene, followed by dUTP bisphosphatase (Dut) which catalyzes the pyrophosphatalysis of dUTP to produce dUMP, the remainder of dUMP synthesis taking place primarily via the dUDP pathway, the 2' -deoxycytidine pathway being the salvage pathway. 2' -deoxycytidine is obtained by hydrolysis of dCMP, which is a dCTP diphosphate enzyme-catalyzed hydrolysis, and the precursors dCMP and dCTP are required to be added to increase the yield of 2' -deoxycytidine, so that dCTP flow to dUTP is required to be blocked, and most of metabolism flows to 2' -deoxycytidine. Thus, dcd was knocked out based on the strain SHA57 (W3110. DELTA.cddDELTA.deoA), and SHA60 (W3110. DELTA.cddDELTA.deoA. DELTA.dcd) was constructed (Table 1).

Coli W3110 shake flask fermentation did not detect 2 '-deoxycytidine, strain SHA60 shake flask fermentation detected very little 2' -deoxycytidine about 4.7mg/L, and also contained a large amount of orotic acid (-240 mg/L). Because in E.coli K-12, deletion of one base at the C-terminal of the rph gene upstream of orotate phosphoribosyl transferase (pyrE) causes frame shift mutation, premature termination of translation, resulting in insufficient expression of pyrE, accumulation of orotic acid occurs during pyrimidine synthesis, and thus expression defect caused by frame shift mutation of the upstream rph gene is relieved by over-expression of orotate phosphoribosyl transferase (pyrE) gene on plasmid or genome, and accumulation of orotic acid is reduced. The nucleoside/H+ cotransporter (nupG) can transfer extracellular nucleosides into cells, so that nupG can be knocked out to prevent 2 '-deoxycytidine from entering cells, more 2' -deoxycytidine is accumulated and increased, so that nupG is knocked out and Ptrc-pyrE-kanFRT is integrated at the same time, and finally, a strain SHA65 (W3110 delta cdddelta deoAdelta dcd delta nupG: ptrc-pyrE) is constructed, and no orotic acid accumulation is detected by fermentation.

The specific construction process for the SHA65 strain to integrate Ptrc-pyrE is as follows:

first an integrative base plasmid pEZ-pyrE-kanFRT was constructed: the W3110 genome and pKD4 are used as templates, the primers pyrE-F/pyrE-R, K-F/K-R in the following table 2 are used for amplifying fragments containing pyrE and KanFRT respectively to obtain fragments with the sizes of 680bp and 14990bp, no impurity band is generated by electrophoresis, column recovery and purification (a method for recovering and purifying the JieRui gel) are directly carried out, EZ cloning construction is carried out on the obtained fragments by the digestion and recovery of pEZ carrier fragments with the ratio of nanomole of 1:2 and NcoI/XhoI (a method for carrying out the digestion and the seamless cloning of the Gclart gene in Shenzhou, the recombinant cloning reaction solution is subjected to a water bath at 45 ℃ for 30min, then transferred to ice for 5min, transferred to TG1 conversion competent cells, thermally shocked at 42 ℃ for 2min, 800 mu L of recovery medium LB is added after 2min, 100mg/L of spectinomycin and 50mg/L of kanamycin resistant LB plate is centrifugally coated after recovery and culture for 1h, cloning culture is carried out on days, and plasmid construction is obtained by carrying out enzyme digestion and verification after extraction and final plasmid construction is carried out overnight.

Then, the integrated fragment was amplified and knocked out with primers nupG-KinF/nupG-KinR in Table 2 using pEZ-pyrE-kanFRT as a template to obtain a non-heterogeneous fragment of 2856bp, which was directly subjected to column recovery and purification, and about 500ng of electrically transformed competent cells to SHA60/pKD46 were obtained, mixed and transferred into a 0.1cm cuvette and subjected to electric transformation with a shock instrument. Electric shock conditions: 200 Ω,25 μF, 1.8kV shock voltage, 5ms shock time, 800 μL LB was added immediately after shock, and resuscitated at 37℃for 1h at 200rpm, then plated on LB plates containing 50ng/mL kanamycin, and incubated overnight at 37 ℃. The next day, the transformant obtained by electric transformation is verified by bacterial liquid PCR with nupG-200F/kan-YZR to obtain 2043bp fragment, the construction success of SHA65K is confirmed, and then pCP20 is transformed to eliminate resistance, and the SHA65 strain is finally obtained.

TABLE 2 construction and verification of primers for strain SHA65

Example 2: the overexpression of ribonucleoside diphosphate reductase and thioredoxin coding gene can obviously improve the yield of 2' -deoxycytidine

2 '-deoxycytidine in E.coli is mainly obtained by dCMP phosphohydrolase (YfbR) to catalyze dCMP hydrolysis as a salvage pathway for dUMP synthesis, and plasmid pEZ-yfbR is constructed for accumulating more 2' -deoxycytidine and over-expressing yfbR and named pX109. The recombinant strain of SHA57 transformed pX109 had a 2' -deoxycytidine yield of 15.7mg/L after shake flask fermentation, indicating that yfbR overexpression helps to accelerate dCMP to 2' -deoxycytidine hydrolysis and increase 2' -deoxycytidine yield. And the 2 '-deoxycytidine yield of the recombinant strain after the dcd gene knockout strain SHA60 converts pX109 is respectively increased to 43.8mg/L after shake flask fermentation, which proves that blocking the dCTP to dUTP path is beneficial to accumulating more 2' -deoxycytidine.

In patents US6777209 and US7387893, expression of T4 phage-derived ribodiphosphate reductase (NrdA, nrdB) and thioredoxin (NrdC) in a thymidine-producing escherichia coli host is disclosed, whereby the yield of thymidine is increased by increasing the content of dUTP directly or indirectly by increasing ddudp and dCDP, and Kim 2015 also overexpresses NrdCBA in the 2 '-deoxycytidine strain engineering, mainly pulling the rapid conversion of CDP to dCDP, and further phosphorylating to dCTP, ultimately to the precursor dCMP of 2' -deoxycytidine. Thus, this patent over-expressed nrdbA on the basis of pEZ07-yfbR constructs an expression plasmid pEZ-yfbR-nrdbA, named pHA289. The 2 '-deoxycytidine yield of the recombinant strain after SHA60 and SHA65 are respectively 215.6 mg/L and 220.9mg/L, the 2' -deoxycytidine yield of the control strain SHA60/pX109 is 52.6mg/L, and the 2 '-deoxycytidine yield is improved by about 4 times after the NrdBCA is over-expressed, which indicates that the over-expression of nucleoside diphosphate reductase and thioredoxin can help to quickly pull CDP to be converted into dCDDP, further to be phosphorylated into dCTP, and finally to be converted into 2' -deoxycytidine by dCMP phosphate hydrolase (YfbR).

TABLE 3 comparison of recombinant strain fermentation

Strain	dCR(mg/L)
		SHA60/pX109	52.6±7.08
SHA60/pHA289	215.6±12.54
		SHA65/pHA289	220.9±13.32

The construction of the expression plasmid is described below by taking the pX109 plasmid as an example:

plasmid pEZ07-yfbR was first constructed: the W3110 genome is used as a template, a yfbR fragment with the size of 642bp is obtained by amplification of a primer yfbR-F/yfbR-R in the following table 5, column recovery and purification (a JieRui gel recovery and purification kit) are directly carried out after electrophoresis without a miscellaneous zone, EZ cloning construction (a Gclonart seamless cloning kit for the Shenzhou gene) is carried out on the obtained fragment and a pEZ carrier fragment recovered by NcoI/XhoI digestion, a recombinant cloning reaction solution is subjected to incubation for 30min in a water bath at 45 ℃, then transferred to ice for 5min, transferred to TG 1-transformed competent cells, thermally shocked for 2min at 42 ℃, added with 800 mu L of recovery culture medium LB after 2min, and after recovery culture for 1h, a LB plate containing 100mg/L of spectinomycin resistance is centrifugally coated, the corresponding clone with the size of 1100bp is inoculated with a spectinomycin resistance culture medium for overnight after amplification verification by taking the primer pCL-F/pCL-R as a template, and finally plasmid pEZ-bfR is obtained after enzyme digestion verification. On the basis of this, the nrdbA was ligated to construct a coexpression plasmid pEZ-yfbR-nrdbA, designated pHA289.

TABLE 4 plasmid information Table

Numbering device	Plasmid information
		pEZ07	pSC101ori，aadA1
pX109	pEZ07-yfbR
		pHA289	pEZ07-yfbR-nrdBCA
pHA300	pEZ07-udk

TABLE 5 plasmid construction primers

Primer(s)	Sequence 5'-3'
		yfbR-F	GATTAAATAAGGAGGAATAAACCATGAAACAGAGCCATTTTTTTGCC
yfbR-R	GGTACCAGCTGCAGATCTCGAGTTACAGCGGTGAATCCTGGC
		pCL-F	GACATCATAACGGTTCTGGC
pCL-R	AAAACAGCCAAGCTGGAGAC

Example 3: knocking out uridine/cytidine kinase (Udk) can significantly improve 2' -deoxycytidine yield

The udk gene codes for cytidine/uridine kinase in E.coli, and is mainly involved in salvage pathways, catalyzing cytidine or uridine to the corresponding mononucleotide CMP or UMP. There is no current literature or data showing that udk catalyzes the production of dCMP from 2' -deoxycytidine and that no relevant introduction of a knockout of the udk gene to increase 2' -deoxycytidine production has been implicated in Kim 2015 in engineering strains producing 2' -deoxycytidine. The patent unexpectedly ferments when screening gene knockouts which help to increase 2 '-deoxycytidine yield, and udk knockouts can significantly increase 2' -deoxycytidine yield.

The Datsenko method is adopted on the cdd knockout strain SHA56 to respectively knock out the udk and deoA, so that SHA57 and SHA58 are constructed, and 2 modified strains are subjected to shake flask fermentation together with the starting strain SHA 56: the SHA56 did not detect substantially dCR, but dCR at 1.15mg/L and 2.09mg/L could be detected after the udk and deoA knockouts, respectively, indicating that the udk knockouts contributed to the accumulation of dCR, but the effect was not evident with the deoA knockouts. Subsequently, the udk was further knocked out on the deoA knockout strain, SHA57, while the udk and dCTP deaminase genes encoding dcd were knocked out, and SHA59 and SHA60 were constructed, respectively. Shake flask fermentation showed that SHA57 could accumulate 2.23mg/L of dCR, and on this basis the resulting strain from the knock-out of either udk or dcd could accumulate 3.98mg/L and 5.54mg/L of dCR, respectively, indicating that both udk and dcd knockouts could increase the accumulation of dCR. And selecting dcd knockout bacteria, namely SHA60, according to the effect of gene knockout to construct pyrE over-expression integrated strains to obtain SHA65, and finally performing udk gene knockout on the SHA65 strains to construct SHA85K (W3110 delta cdddelta deoA delta dcd delta nupG::: ptrc-pyrE delta udk::: kanFRT), wherein the yield of shake flask fermentation dCR is 14.78mg/L, and the dCR yield of contrast SHA60 is 5.67mg/L, which indicates that the udk knockout is helpful for accumulating more 2' -deoxycytidine. To verify this result, 2' -deoxycytidine production was measured up to 356.7mg/L after transformation of plasmid pHA289 by the resulting strain SHA85K, and 218.6mg/L of 2' -deoxycytidine production by the control strain SHA65/pHA289, whereby Udk could be presumed to be active on 2' -deoxycytidine, catalyzing the production of dCMP by 2' -deoxycytidine, and significantly increased 2' -deoxycytidine production after knocking out, but 25mg/L of by-product cytidine was detected by fermentation by the udk knock-out strain SHA85K/pHA289, whereby it was found that cytidine could not be catalyzed to CMP after the udk knocking out, and thus a certain cytidine was detected.

TABLE 6 comparison of fermentation before and after udk knockout

Strain	dCR(mg/L)
		SHA65/pHA289	218.6±7.89
SHA85K/pHA289	356.7±10.45

Example 4: uridine/cytidine kinase (Udk) overexpression strain detection

The results according to example 3 show that the cytidine/uridine kinase Udk encoding gene, udk, is responsible for increasing 2 '-deoxycytidine production after knockout, and thus the construction of the udk overexpression plasmid pEZ-udk, further confirming that the udk gene knockout is responsible for increasing 2' -deoxycytidine production.

As an example of the construction of the pX109 plasmid of example 3, the expression plasmid pEZ-udk was constructed and named pHA300. Empty plasmids pEZ and pHA300 transformed SHA85K, respectively. 3 single clones of the obtained recombinant strains SHA85K/pEZ07 and SHA85K/pHA300 are respectively picked and inoculated into LB test tubes containing spectinomycin resistance, shake flask fermentation is carried out according to the experimental method 2 shake flask fermentation mode, 3 empty control bottles are inoculated at the same time, bacteria equal amount of sterile water is added for culture, IPTG is added for induction, 2 '-deoxycytidine is added into all shake flasks at the same time, the final concentration is 1g/L, the sample preparation is finished after 24h of fermentation, the 2' -deoxycytidine content is detected, and then the average value of the 3 shake flasks is respectively taken. The result shows that the empty bottle control 2' -deoxycytidine content is 1.01 g/L+/-0.02, which is consistent with the expected addition amount, and the 2' -deoxycytidine content after the fermentation of SHA85K/pEZ07 is 0.98 g/L+/-0.07, and the reduction of the comparison amplitude of the empty bottle control 2' -deoxycytidine content with the control strain is basically negligible; whereas 2 '-deoxycytidine was 0.76 g/L.+ -. 0.03 after the end of SHA85K/pHA300 fermentation, it was found that the level of 2' -deoxycytidine was significantly reduced after the overexpression of udk compared with that of control strain SHA85K/pEZ07, indicating that Udk might be able to use 2 '-deoxycytidine as a substrate for the production of other substances, udk functions mainly as a kinase, catalyzing cytidine/uridine to form the corresponding nucleoside monophosphate, and the structural formulae of 2' -deoxycytidine and cytidine only differ in the hydroxyl group at the 2-position of ribose, so that Udk is presumed to be able to catalyze 2 '-deoxycytidine to form 2' -deoxycytidine monophosphate (dCMP). This is the first report on the activity of cytidine/uridine kinase Udk on 2' -deoxycytidine.

TABLE 7 detection of 2' -deoxycytidine degradation by overexpression of udk

Example 5: uridine/cytidine kinase (Udk) catalyzes the production of 2 '-deoxycytidine monophosphate (dCMP) from 2' -deoxycytidine

Coli cytidine-uridine kinase Udk, whose main function is to catalyze cytidine or uridine to form cytidine 5 '-monophosphate or uridine 5' -monophosphate with ATP or GTP as phosphate donor; coli also has thymidine/2 ' -deoxyuridine kinase Tdk, which catalyzes the production of thymidine or 2' -deoxyuridine to thymidine 5' -monophosphate or 2' -deoxyuridine 5' -monophosphate. Kim 2015 shows in the strain engineering to produce 2 '-deoxycytidine that the strain after BL21 (DE 3) knockout deoA, deoD, udp, dcd and cdd isogenic did not detect degradation after in vitro addition of 2' -deoxycytidine, but based on our udk gene knockout and over-expression results, it was speculated that uridine/cytidine kinase (Udk) may catalyze 2 '-deoxycytidine to 2' -deoxycytidine monophosphate, but there is no relevant report to date, and to verify this result, in vitro enzyme catalysis experiments were further performed with Udk enzyme fluid.

First, a pET28a-udk expression plasmid was constructed: the escherichia coli W3110 genome is used as a template, a 684bp udk fragment is obtained through amplification by using a primer pair udk-F, udk-R, no impurity band is generated through electrophoresis, column recovery and purification (a JieRui gel recovery and purification kit) are directly carried out, the obtained fragment is subjected to EZ cloning construction (a Suzhou Shenzhou gene GBclonart seamless cloning kit) by carrying out nanomolar ratio of 1:2 and NcoI/HindIII digestion and recovery on the pET28a carrier fragment, a host TG1 is transformed, and the successfully constructed expression plasmid pET28a-udk is obtained through bacterial liquid PCR and enzyme digestion verification. Then, pET28a and pET28a-udk are respectively transformed into competent cells of escherichia coli BL21 (DE 3) to obtain recombinant strains BL21 (DE 3)/pET 28a and BL21 (DE 3)/pET 28a-udk.

The recombinant strain overexpression flow is as follows: the recombinant E.coli was activated in LB medium (Green 2012) containing 50mg/L kanamycin, and the cultured overnight strains were transferred to 0.8% to 50mL of LB medium containing 50mg/L kanamycin, cultured at 37℃and 200rpm, and when grown to an OD of about 0.8, the final concentration was induced by adding IPTG to 0.4mM, and the temperature was lowered to 30℃to culture, and after overnight culture, the bacterial solution was collected by centrifugation, and cells were suspended in 5mL of 50mM PBS buffer pH 7.0. The recombinant bacterial cells of the above-obtained enzymes were disrupted by sonication under the following conditions: opening 2S, closing 4S,8min,30% power, crushing, centrifuging, respectively carrying out protein electrophoresis on the supernatant and the sediment to detect the protein expression condition, and directly using the supernatant enzyme solution after centrifuging for reaction detection of generating dCMP by 2' -deoxycytidine.

The empty control and Udk overexpressed enzyme solution obtained above were subjected to an enzyme-catalyzed reaction according to the reaction system of table 9: water was used as a negative control instead of enzyme solution, and BL21 (DE 3)/pET 28a-udk were added to the reaction, and the reaction was performed at 37℃for 1 hour with direct sampling dilution 2-fold.

As a result, as shown in FIG. 3, only 950mg/L of 2' -deoxycytidine was detected by using water instead of the enzyme solution, and the amount of the deoxycytidine was close to that of the enzyme solution; the samples added with the control BL21 (DE 3)/pET 28a enzyme solution have no 2' -deoxycytidine nor dCMP, which is probably not knocked out by the strain cdd, and the 2' -deoxycytidine is completely converted into 2' -deoxyuridine; while the samples added with Udk over-expressed BL21 (DE 3)/pET 28a-udk enzyme solution can detect 356mg/L dCMP and 165 mg/L2 ' -deoxycytidine, other 2' -deoxycytidine can be converted into 2' -deoxyuridine by cdd. This result shows that Udk can catalyze cytidine and uridine to generate corresponding nucleoside monophosphate and also can catalyze 2 '-deoxycytidine to generate dCMP, which is the first study and report about Udk with the function and provides a foundation for strain transformation of 2' -deoxycytidine.

TABLE 8 construction of primers for overexpression of udk

Primer(s)	Sequence 5'-3'
		udk-F	AACTTTAAGAAGGAGATATACCATGACTGATCAGTCTCATCAG
udk-R	CTCGAGTGCGGCCGCAAGCTTTATTCAAAGAACTGACTTATTTTCGC

TABLE 9 in vitro enzymatic reaction System

Composition of the components	Final concentration
		0.1M Tris-HCl(pH7.8)	0.1M
MgCl ₂ .H ₂ O	10mM
		ATP	3g/L
dCR	1g/L
		Enzyme solution or water	100ul

Example 6: coding gene knockouts such as uridine phosphatase (Udp) or cytidine deaminase (CodA) are detrimental to increased 2' -deoxycytidine production

The Udp gene encodes uridine phosphatase Udp in E.coli, which catalyzes the reversible conversion between uridine and uracil. The codA gene codes for cytidine deaminase, catalyzing the deamination of cytidine to uracil. The final engineering bacteria in Kim 2015 literature contained both udp and codA knockouts, so it was also examined whether both gene knockouts of udp and codA contributed to an increase in accumulation of 2' -deoxycytidine.

The strains SHA83K (W3110ΔcddΔdeoAΔdcd ΔnupG::: ptrc-pyrE Δudp::: kanFRT) and SHA84K (W3110ΔcddΔdeoAΔdcd ΔnupG:::: ptrc-pyrE ΔcodA::: kanFRT) were constructed separately on SHA65 strains. Transformation of plasmid pHA289 with SHA65, SHA83K and SHA84K, respectively, resulted in recombinant strains subjected to shake flask fermentation according to Experimental method 2, and the results showed that the 2' -deoxycytidine yield was reduced by 25% and 22% after the udp or codA knockout, respectively, and that the 2' -deoxycytidine yield was as shown in Table 10 below, so that the knockout of these two genes did not promote the production of 2' -deoxycytidine.

TABLE 10 fermentation of udp and codA knockout strains

Strain	dCR(mg/L)
		SHA65/pHA289	223.6
SHA83K/pHA289	167.8
		SHA84K/pHA289	173.7

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. Use of a reagent and/or method for knocking down or knocking out cytidine/uridine kinase in increasing the yield of 2' -deoxycytidine, characterized in that the use enables the production of 2' -deoxycytidine by fermentation of a recombinant microorganism or the production of 2' -deoxycytidine by a catalytic substrate by whole cells of a recombinant microorganism;

the recombinant microorganism takes escherichia coli W3110ATCC27325 as an initial strain, and the cytidine/deoxycytidine deaminase gene cdd, the thymidine phosphorylase gene deoA and the dCTP deaminase gene dcd, nucleoside/H are knocked out ⁺ The cotransporter gene nupG and the overexpressed orotic acid phosphoribosyl transferase gene pyrE are constructed.

2. A recombinant microorganism characterized in that: the recombinant microorganism comprises the following characteristics: a reduced level or activity of cytidine/uridine kinase, and/or a reduced deletion, inactivation, or viability of a gene encoding the cytidine/uridine kinase; the recombinant microorganism is used for producing 2' -deoxycytidine;

the recombinant microorganism is constructed by taking escherichia coli W3110ATCC27325 as an initial strain, knocking out cytidine/deoxycytidine deaminase gene cdd, thymidine phosphorylase gene deoA, dCTP deaminase gene dcd and nucleoside/H+ cotransporter gene nupG, and knocking out cytidine/uridine kinase gene udk after overexpressing orotate phosphoribosyl transferase gene pyrE.

3. Use of the recombinant microorganism of claim 2 for the production of 2' -deoxycytidine.

4. A method for producing 2' -deoxycytidine, characterized by: the method comprises the steps of fermenting and producing 2 '-deoxycytidine by using the recombinant microorganism according to claim 2 or producing 2' -deoxycytidine by using the whole cell catalytic substrate of the recombinant microorganism according to claim 2.