CN115125279A

CN115125279A - Recombinant microorganism and method for producing 2' -deoxycytidine

Info

Publication number: CN115125279A
Application number: CN202210818438.5A
Authority: CN
Inventors: 江君君; 利爱利; 田锋; 黄祝渊
Original assignee: Suzhou Biosynthetica Co ltd
Current assignee: Suzhou Biosynthetica Co ltd
Priority date: 2022-07-12
Filing date: 2022-07-12
Publication date: 2022-09-30
Anticipated expiration: 2042-07-12
Also published as: CN115125279B

Abstract

The invention provides a recombinant microorganism and a method for producing 2' -deoxycytidine, belonging to the technical field of biology. The invention unexpectedly discovers that the coding gene udk of cytidine/uridine kinase (Udk) is knocked out to improve the yield of 2' -deoxycytidine, and Udk shows that the 2' -deoxycytidine has the activity of catalyzing dCMP generated by the 2' -deoxycytidine through in vitro reaction. The recombinant microorganism can be used for industrial production of 2' -deoxycytidine, and is easy to operate, so that the aim of producing the 2' -deoxycytidine at low cost in an environment-friendly manner is fulfilled, and a new thought and a new method are provided for the production of the 2' -deoxycytidine.

Description

Recombinant microorganism and method for producing 2' -deoxycytidine

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a recombinant microorganism and a method for producing 2' -deoxycytidine.

Background

2' -deoxycytidine is a pyrimidine 2' -deoxyribonucleoside with cytosine as a base, consisting of cytosine and 2' -deoxyribose with the molecular formula C ₉ H ₁₅ N ₃ O ₄ Molecular weight 227.22, white-like powder, readily soluble in water. 2' -deoxycytidine is an important medical intermediate, mainly used for chemically synthesizing various medicines, such as decitabine (Dacogen) ^TM 5-aza-2' -deoxycytidine) for the treatment of myelodysplastic syndromes (a class of diseases in which the function of certain blood cells is dysfunctional) and acute myeloid leukemia, and the like. In addition, 2' -deoxycytidine is also used for synthesizing deoxynucleotide monomers and preparing oligodeoxynucleotide, and is widely applied to nucleic acid and genetic engineering, such as dNTP, various primers and the like.

At present, 2 '-deoxycytidine is mainly synthesized chemically, alpha-D-2-deoxyribose and uracil are used as initial raw materials, and the target 2' -deoxycytidine is obtained through 6 steps of methylation, esterification, chlorination, nucleophilic substitution, high-efficiency ammoniation, hydrolysis deprotection and the like and through one-time recrystallization. But the chemical method for producing the 2' -deoxycytidine is relatively complicated, the cost is high, and the product yield is lower. Compared with chemical production processes, the microbial production of 2' -deoxycytidine has better cost benefit, and gradually becomes a hot spot in recent years. For example, Lee et al constructed genetically engineered Corynebacterium ammoniagenes by chemical mutagenesis for the production of 2' -deoxycytidine (Lee YB, Baek H, Kim SK, Hyun HH. et al. Deoxytocin production by metabolic engineering Corynebacterium ammoniagenes. J. Microbiol 49: 53-57 (2011)). Furthermore, Kim et al produced 2' -deoxycytidine by knocking out a series of genes such as deoA, udp, deoD, dcd, cdd, codA, etc. and genes such as overexpressed genes nrdCA, yfBR, and pyrG on the genome of E.coli BL21(DE3) (Kim, JS., Koo, BS., Hyun, HH. et al. deoxycytidine production by a metabolic engineering strain. Microb Cell Fact 14,98 (2015)).

However, the fermentation method using the recombinant microorganism strain reported in the above documents has a limited yield increase of 2' -deoxycytidine, and the plasmid is high copy and easily lost with the increase of fermentation time, and further, has a difficulty in strain amplification. Therefore, a method for improving the yield of 2' -deoxycytidine by microbial fermentation, which is easy to operate and applicable to industrial production, is needed.

Disclosure of Invention

In view of the above problems, the present invention provides a recombinant microorganism and a method for producing 2' -deoxycytidine. The invention unexpectedly discovers that the coding gene udk of cytidine/uridine kinase (Udk) is knocked out to improve the yield of 2' -deoxycytidine. The recombinant microorganism can be used for the industrial production of 2 '-deoxycytidine, and is easy to operate, thereby achieving the purpose of producing the 2' -deoxycytidine with green, environmental protection and low cost.

The terms:

1. 2' -deoxycytidine: unless otherwise specified, the abbreviation "dCR" used herein refers to 2' -deoxycytidine having the molecular formula C ₉ H ₁₅ N ₃ O ₄ The molecular weight is 227.22, and the structural formula is shown as the following formula (1).

2. A recombinant microorganism: unless otherwise specified, the Chinese name "recombinant microorganism" in the present invention refers to a microorganism which has been artificially treated; the human treatment includes but is not limited to: gene knockout, gene suppression, gene silencing, gene insertion, gene mutation, exogenous expression or overexpression genes and other technical means capable of realizing gene operation in the field.

3. Host bacteria: unless otherwise specified, the Chinese name "host bacterium" in the present invention refers to a microorganism to be artificially treated.

4. Seed liquid: if not specifically stated, the Chinese name "seed solution" in the present invention refers to a microbial culture solution with a certain amount of microorganisms, and excellent activity and quality, which is obtained by activating microorganisms through a test tube slant, performing flat or shake culture or performing a seed tank step-by-step expansion culture.

5. High yield: as used herein, "high yield" means that the yield of 2' -deoxycytidine is higher than that of the parent microorganism, unless otherwise specified.

6. Low yield: unless otherwise specified, "low yield" in the present invention means that the production amount of 2' -deoxycytidine is lower than that of the parent microorganism.

7. Exogenous expression or overexpression: as used with respect to the present invention, is to be broadly construed to include any increase in the expression of one or more proteins (including one or more nucleic acids encoding the one or more proteins) of a parent microorganism as compared to the expression level of the protein (including nucleic acid expression) under the same conditions. Should not be taken to mean that the protein (or nucleic acid) is expressed at any particular level.

8. Parent microorganism: is a microorganism from which the microorganism of the present invention is derived. The microorganism of the present invention may be produced by any method such as artificial or natural selection, mutation or gene recombination. The parent microorganism may be a naturally occurring microorganism (i.e., a wild-type microorganism) or a microorganism that has been previously modified but does not produce or overproduce 2' -deoxycytidine.

9. Carrier: it should be taken broadly to include any nucleic acid (including DNA and RNA) suitable for use as a vehicle for transferring genetic material into a cell, including plasmids, viruses (including phages), cosmids, and artificial chromosomes. The vector may include one or more regulatory elements, an origin of replication, a multiple cloning site, and/or a selectable marker.

10. Convention for protein and gene names: the English protein names related in the invention are all capital letters; the English gene names related in the invention are all lower case initials.

In order to achieve the purpose of the invention, the technical scheme of the invention is as follows:

in one aspect, the invention provides the use of cytidine/uridine kinase to catalyze the conversion of 2' -deoxycytidine to deoxycytidine monophosphate.

Specifically, the cytidine/uridine kinase is Udk.

In another aspect, the present invention provides the use of an agent and/or method for knock-down or knock-out of cytidine/uridine kinase in the improvement of 2' -deoxycytidine production.

Specifically, the cytidine/uridine kinase is Udk.

In yet another aspect, the present invention provides a recombinant microorganism comprising the following features: a decrease in the level or activity of a cytidine/uridine kinase, and/or a deletion, inactivation or reduction in the activity of a gene encoding said cytidine/uridine kinase; the recombinant microorganism is used for producing 2' -deoxycytidine.

Specifically, the cytidine/uridine kinase is Udk.

In particular, said recombinant microorganism also comprises the following characteristics: the content or activity of ribonucleoside diphosphate reductase (riboside-diphosphate reductase) and thioredoxin is increased, and/or the number of copies or activity of genes encoding ribonucleoside diphosphate reductase and thioredoxin is increased.

More specifically, the ribonucleoside diphosphate reductases are T4 phage-derived ribonucleoside diphosphate reductases NrdB and NrdA, and the thioredoxin is NrdC.

Specifically, the microorganisms include, but are not limited to, Escherichia coli (Escherichia coli), Bacillus (Bacillus), Corynebacterium glutamicum (Corynebacterium glutamicum), Salmonella (Salmonella), and Yeast (Yeast).

In still another aspect, the present invention provides the use of the above recombinant microorganism for the production of 2' -deoxycytidine.

In still another aspect, the present invention provides a method for producing 2' -deoxycytidine, the method comprising producing 2' -deoxycytidine by fermentation using the above recombinant microorganism or producing 2' -deoxycytidine by catalyzing a substrate using a whole cell product of the above recombinant microorganism.

Specifically, the whole cell products include, but are not limited to: a culture medium, a cell lysate, a supernatant fraction of the cell lysate, a precipitate fraction of the cell lysate, and the like. It is to be noted that new technologies for the manipulation of whole-cell products and their specific product types in future technological developments are also within the scope of the present invention as claimed above without departing from the inventive aspects of the present invention.

Specifically, the method comprises the following steps:

activating the recombinant microorganism and preparing a seed solution;

adopting shake flask fermentation: inoculating to fermentation medium according to 1-5% inoculum size, culturing at 37 deg.C with shaking table at 250rpm for 3-5h, adding IPTG with final concentration of 1mM, adjusting shaking table temperature to 34 deg.C, and fermenting for 18-22 h.

More specifically, the inoculation amount is 1-2%.

More specifically, the fermentation medium comprises the following components: 20-40g of glucose per liter, 220mL of 5N-5 times salt solution 180-, 0.5-1.5mL of TM2 solution, 8-12mg of ferric citrate, 250mg of magnesium sulfate heptahydrate, 115mg of calcium chloride 105-, 0.5-1.5 mu g of thiamine, and the volume is fixed to 1L by sterile deionized water; wherein the salt solution with the volume of 5N-5 times is 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate, 2.5g of sodium chloride and 25g of ammonium chloride, and the volume is fixed to 1L by using ionized water; the TM3 solution is 2.0g of zinc chloride tetrahydrate, 2.0g of calcium chloride hexahydrate, 2.0g of sodium molybdate dihydrate, 1.9g of copper sulfate pentahydrate, 0.5g of boric acid, 100mL of hydrochloric acid, and the volume of deionized water is up to 1L.

More specifically, the fermentation period is 20 h.

More specifically, the fermentation medium comprises the following components: 30g of glucose, 200mL of 5N-5 times of salt solution, 1mL of TM2 solution, 10mg of ferric citrate, 246mg of magnesium sulfate heptahydrate, 111mg of calcium chloride and 1 mu g of thiamine in each liter of culture medium, and the volume is fixed to 1L by sterile deionized water.

Compared with the prior art, the invention has the positive and beneficial effects that:

(1) the invention unexpectedly discovers that in the actual production process, cytidine/uridine kinase catalyzes 2' -deoxycytidine to be converted into deoxycytidine monophosphate, and the conclusion is proved by in vitro enzyme catalysis experiments, which are not reported before. On the basis, the cytidine/uridine kinase knockout can obviously improve the yield of the 2 '-deoxycytidine and provide a new idea and method for the production of the 2' -deoxycytidine.

(2) The recombinant microorganism of the invention is adopted to produce 2 '-deoxycytidine, the yield is higher, the fermentation period is short, the production intensity is high, and the recombinant microorganism can be used for large-scale industrial production of 2' -deoxycytidine.

(3) The construction method of the recombinant microorganism provided by the invention is a directed rational strain construction method, and is more efficient, convenient and highly operable compared with the traditional mutagenesis method.

Drawings

FIG. 1 is a schematic diagram of the metabolic pathway of 2' -deoxycytidine.

Wherein, PyrE: orotate phosphoribosyl transferase; NrdA, NrdB: nucleoside diphosphate reductases; NrdC: thioredoxin; YfbR: dCMP phosphohydrolase; dcd: dCTP deaminase; cdd: cytidine/deoxycytidine deaminase; tdk: thymidine/deoxyuridine kinase; udk: uridine/cytidine kinase; dut: a deoxynucleotide triphosphatase; ThyA: thymidylate synthase; and (3) DeoA: thymidine phosphorylase; OMP: orotic acid-5' -monophosphate; UMP: a uracil ribonucleotide; UDP: uridine diphosphate; UTP: uridine triphosphate; CR: cytidine; cytosine: a cytosine; and (3) CMP: cytidine monophosphate; CDP: cytidine diphosphate; CTP: cytidine triphosphate; dUDP: deoxyuridine diphosphate; dUTP: deoxyuridine triphosphate; dCDP: deoxycytidine diphosphate; dCTP: deoxycytidine triphosphate; dCMP: deoxycytidine monophosphate; dCR: 2' -deoxycytidine; and (2) dUMP: deoxyuridine monophosphate; dUR: deoxyuridine; dTMP: deoxythymidine monophosphate; dTDP: deoxythymidine diphosphate; dTTP: deoxythymidine triphosphate.

FIG. 2 shows the peaks of the product and by-products by HPLC.

FIG. 3 is a diagram of Udk in vitro enzyme catalysis experiment results.

Detailed Description

The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.

The technical scheme of the invention can be applied to escherichia coli, bacillus subtilis, corynebacterium glutamicum, lactobacillus or other microorganisms, and the technical scheme is further explained by taking the escherichia coli as an example.

Experimental method 1: gene knockout method

According to the invention, a Datsenko method is adopted to knock out microbial genes, and based on a Red recombination system, a selectable antibiotic drug resistance gene generated by PCR through a primer with 50-nt homologous extension is used to replace a target gene sequence, so that the purpose of gene knock-out is achieved. Specific methods for gene knock-out employed in the present invention are described in the literature: K.A.Datsenko, B.L.Wanner.one-step inactivation of chromogenes in Escherichia coli K-12 using PCR products of the National Academy Sciences of the USA,2000,97(12): 6640-. Corresponding knock-out primers are found in Baba 2006.Mol Syst Biol,2(1) 0008.

Experimental method 2: method for verifying production of 2' -deoxycytidine by recombinant strain through shake flask fermentation

1. Reagent

(1) Fermentation medium: 30g of glucose, 200mL of 5N-5 times of salt solution, 1mL of TM3 solution, 10mg of ferric citrate, 246mg of magnesium sulfate heptahydrate, 111mg of calcium chloride and 1 mu g of thiamine in each liter of culture medium, and the volume is fixed to 1L by sterile deionized water.

Wherein the salt solution with the volume of 5N-5 times is 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate per liter, 2.5g of sodium chloride and 25g of ammonium chloride, and the volume is fixed to 1L by using ionic water; the TM3 solution is 2.0g of zinc chloride tetrahydrate, 2.0g of calcium chloride hexahydrate, 2.0g of sodium molybdate dihydrate, 1.9g of copper sulfate pentahydrate, 0.5g of boric acid, 100mL of hydrochloric acid, and deionized water with constant volume of 1L.

Sterilizing the above solution with high pressure steam at 121 deg.C for 20-30 min.

(2) LB culture medium: each liter of the culture medium contains 5g of yeast powder, 10g of sodium chloride, 10g of peptone and deionized water to a volume of 1L (American J. Shamebrook. Huangpetang, molecular cloning guide 2002,1595).

2. The instrument comprises the following steps: constant temperature shaking incubator.

3. The method comprises the following steps:

the shake flask fermentation process was as follows: (1) inoculating the recombinant strain into 4mL LB culture medium containing antibiotics, and culturing at 37 ℃ by a shaking table at 250 rpm; (2) transferring 500 mu L of the seeds cultured for 16h to 2mL of LB liquid culture medium containing antibiotics, and culturing for 4h at 37 ℃ by a shaker at 250 rpm; (3) transferring 2.5mL of the secondary seeds into a shake flask filled with 18mL of fermentation medium, placing the shake flask in a shaking table at 37 ℃, and culturing for 4 hours at 250 rpm; (4) after IPTG is added to the final concentration of 1mM, the temperature of the shaking table is adjusted to 34 ℃, the cultivation is continued for about 20h, 1mL of fermentation liquor is centrifuged (12000rpm, 1min), and the supernatant is taken for detection, wherein the detection method is detailed in experiment method 3.

Experimental method 3: HPLC determination of 2' -deoxycytidine in fermentation broth

Absorbing the fermentation liquor, diluting with water to a certain multiple, centrifuging through a 0.22 μm filter membrane, and detecting with High Performance Liquid Chromatography (HPLC). The HPLC parameters were as follows: adopting XBridgeC184.6 x 150mM5um, using methanol and 10mM ammonium acetate or PBS (pH 4.0) as mobile phase, increasing the methanol ratio from 2% to 20% in 0.01-4.5 minutes, decreasing the methanol ratio from 20% to 2% in 4.5-4.6 minutes, maintaining the methanol ratio at 2% in 4.6-8 minutes, and detecting the wavelength at 260nm by using an ultraviolet detector; the flow rate of the initial mobile phase is 1.0mL/min, the sample loading amount of the fermentation liquid is 2 mu L, and the column temperature is 30 ℃. The peak time of 2' -deoxycytidine was 6.55 minutes, the peak time of orotic acid was 2.48 minutes, the peak time of cytidine was 4.16 minutes, and the HPLC chromatogram was shown in FIG. 2.

Example 1: construction of recombinant E.coli incapable of utilizing and degrading 2' -deoxycytidine

As shown in FIG. 1, the flow direction of 2' -deoxycytidine in E.coli is two: the first path is that 2 '-deoxycytidine enters a dUMP anaplerosis path, the generated 2' -deoxycytidine is converted into deoxyuridine dUR under the catalysis of cytidine/deoxycytidine deaminase (Cdd), the dUR is generated into dUMP under the catalysis of deoxyuridine kinase (Tdk), dTMP is further generated under the catalysis of thymidylate synthase (ThyA), and dTMP is regenerated into dTDP, dTTP and the like to be used as a precursor for cellular DNA synthesis; the second route is the degradation of 2' -deoxycytidine to cytosine catalyzed by thymidine phosphorylase (DeoA). Therefore, in order to accumulate 2' -deoxycytidine in cells more, cdd, deoA, etc. genes need to be knocked out, and the repair and degradation pathways need to be cut off.

In the present invention, Escherichia coli W3110(ATCC27325) was used as a starting strain, genes cdd and deoA for utilizing and degrading 2' -deoxycytidine were knocked out in W3110 according to experiment 1, and a strain SHA57 (W3110. DELTA. cdd. DELTA. deoA) was constructed (Table 1).

TABLE 1 construction of genetically engineered strains

Coli has three known pathways for the aerobic de novo synthesis of dUMP (substrate for dTMP synthesis): dCTP, dUTP, and 2' -deoxycytidine pathway. 75-80% of dUMP In E.coli is synthesized by the dCTP pathway (Neuhard, J., and R.Kelln.1996.biosynthesis and conversion of pyramidines, p.580-599. In F.C.Neidhardt, R.Curtiss III, J.L.Ingraham, E.C.C.Lin, K.B.Low, B.Magasanik, W.S.Reznikoff, M.Riley, M.Schaechter, and H.E.Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology,2nd ed.ASM Press, Washington, DC.). The first step of the dCTP pathway is the conversion of dCTP to dUTP by dCTP deaminase encoded by the dcd gene, followed by dUTP diphosphatase (Dut) which catalyzes the pyrophosphate hydrolysis of dUTP to produce dUMP, with the remainder of dUMP synthesis proceeding primarily through the dUDP pathway, and the salvage pathway being that of the 2' -deoxycytidine pathway. 2' -deoxycytidine is obtained by hydrolysis of dCMP, dCMP is obtained by hydrolysis catalyzed by dCTP diphosphate, and in order to increase the yield of 2' -deoxycytidine, it is necessary to increase precursors dCMP and dCTP, and therefore, it is necessary to cut off the flow of dCTP to dUTP, and most of the metabolism is directed to 2' -deoxycytidine. Thus, deletion of dcd was performed based on the strain SHA57 (W3110. DELTA. cdd. DELTA. deoA) to construct SHA60 (W3110. DELTA. cdd. DELTA. deoA. DELTA. dcd) (Table 1).

2 '-deoxycytidine can not be detected by the shake flask fermentation of Escherichia coli W3110, and the shake flask fermentation of the strain SHA60 can detect about 4.7mg/L of 2' -deoxycytidine with a very small amount and contains a large amount of orotic acid (240 mg/L). Because in Escherichia coli K-12, the C-terminal of the rph gene upstream of orotate phosphoribosyltransferase (PyrE) is deleted by one base to cause frame shift mutation, translation is terminated early, the pyrE is underexpressed, and the orotate can be accumulated in the pyrimidine synthesis process, the expression defect caused by the frame shift mutation of the rph gene upstream is eliminated by overexpression of the orotate phosphoribosyltransferase (PyrE) gene on a plasmid or a genome, and the accumulation of orotate is reduced. The nucleoside/H + cotransporter (nupG) can transfer extracellular nucleoside into cells, knockout of nupG can prevent 2 '-deoxycytidine from entering cells, and further accumulation of more 2' -deoxycytidine is increased, so that the knockout of nupG is selected and Ptrc-pyrE-kanFRT is integrated at the same time, and finally, a strain SHA65(W3110 delta cdd delta deoA delta dcd delta nupG:: Ptrc-pyrE) is constructed, and no orotic acid accumulation is detected by fermentation.

The specific construction process of integration of Ptrc-pyrE by the strain SHA65 is as follows:

the integration base plasmid pEZ07-pyrE-kanFRT was first constructed: respectively taking W3110 genome and pKD4 as templates, respectively amplifying fragments containing pyrE and KanFR by using primers pyrE-F/pyrE-R, K-F/K-R in the following table 2, respectively obtaining fragments with the sizes of 680bp and 14990bp, directly carrying out column recovery and purification (a strap-down gel recovery and purification kit) by electrophoresis, carrying out EZ cloning construction on the obtained fragments and pEZ07 vector fragments which are subjected to enzyme digestion and recovery by NcoI/XhoI (Suzhou Shenzhou gene GBclonart seamless cloning kit), carrying out warm bath on a recombinant cloning reaction solution in a 45 ℃ water bath kettle for 30min, then transferring the recombinant cloning reaction solution to ice, placing the ice for 5min, transferring TG1 transformation competent cells, carrying out heat shock for 2min at 42 ℃, adding 800 muL recovery culture medium LB after ice bath for 2min, centrifugally coating LB plates containing 100mg/L spectinomycin and 50mg/L kanamycin resistance after recovery culture for 1h, the next day, the cloning culture was carried out overnight, the plasmid was extracted for restriction enzyme validation, and finally the plasmid pEZ07-pyrE-kanFRT was constructed.

Then, pEZ07-pyrE-kanFRT is used as a template, a primer nupG-KinF/nupG-KinR in the table 2 is used for amplifying and knocking out an integrated fragment to obtain a fragment without a miscellaneous band with the size of 2856bp, the fragment is directly subjected to column passing recovery and purification, about 500ng to SHA60/pKD46 of electric transformation competent cells are taken, mixed evenly, transferred into a 0.1cm electric shock cup and electrically transformed by an electric shock instrument. Electric shock conditions: 200 omega, 25 muF, shock voltage of 1.8kV, shock time of 5ms, adding 800 muL LB quickly after shock, resuscitating at 37 deg.C and 200rpm for 1h, then smearing on LB plate containing 50ng/mL kanamycin, and culturing at 37 deg.C overnight. The next day, the transformant obtained by the electrotransformation was subjected to bacteria liquid PCR verification by nupG-200F/kan-YZR to obtain a 2043bp fragment, the construction success of SHA65K was confirmed, and then pCP20 was transformed for elimination, and the SHA65 strain was finally obtained.

TABLE 2 construction and validation of primers for strain SHA65

Example 2: the over-expression of the ribonucleotide diphosphate reductase and the thioredoxin coding gene can obviously improve the yield of 2' -deoxycytidine

2 '-deoxycytidine in E.coli is mainly the salvage pathway for dUMP synthesis, obtained by dCMP phosphohydrolase (YfbR) catalyzed by dCMP hydrolysis, and for the accumulation of more 2' -deoxycytidine, yfbR is overexpressed, constructing plasmid pEZ07-yfbR, named pX 109. The yield of 2' -deoxycytidine after shake flask fermentation of the recombinant strain with the pX109 transformed by SHA57 was 15.7mg/L, which shows that overexpression of yfBR helps to accelerate hydrolysis of dCMP to 2' -deoxycytidine and increase the yield of 2' -deoxycytidine. And the yield of 2 '-deoxycytidine of the recombinant strain subjected to shake flask fermentation after the dcd gene knockout strain SHA60 is transformed into pX109 is respectively improved to 43.8mg/L, which indicates that the blockage of the path from dCTP to dUTP is favorable for accumulating more 2' -deoxycytidine.

Patents US6777209 and US7387893 disclose that T4 phage-derived ribose diphosphate reductases (NrdA, NrdB) and thioredoxin (NrdC) are expressed in thymidine-producing e.coli hosts, and that thymidine production is increased by increasing the content of dUTP, either directly or indirectly, by increasing dUDP and dCDP, and Kim 2015 also over-expresses NrdCBA in 2 '-deoxycytidine strain alteration, primarily by pulling CDP rapidly to dCDP, which is then phosphorylated to dCTP, and finally to dCMP, the precursor of 2' -deoxycytidine. This patent therefore constructed expression plasmid pEZ 07-yfbR-nrdca, designated pHA289, by overexpressing nrdca on the basis of pEZ 07-yfbR. After the SHA60 and the SHA65 are respectively transformed, the yield of the recombinant strain 2' -deoxycytidine is respectively 215.6 and 220.9mg/L, the yield of the control strain SHA60/pX109 2' -deoxycytidine is 52.6mg/L, and the yield of the 2' -deoxycytidine is improved by about 4 times after the NrdBCA is over-expressed, which indicates that the over-expression of nucleoside diphosphate reductase and thioredoxin is helpful for rapidly pulling CDP to be transformed into dCDP, then the CDP is phosphorylated into dCTP, finally the precursor dCMP of the 2' -deoxycytidine is transformed into the 2' -deoxycytidine under the catalysis of dCMP phosphohydrolase (YfbR).

TABLE 3 comparison of fermentation of recombinant strains

Bacterial strains	dCR(mg/L)
		SHA60/pX109	52.6±7.08
SHA60/pHA289	215.6±12.54
		SHA65/pHA289	220.9±13.32

The following description of the construction of the expression plasmid is given by way of example of the pX109 plasmid:

first, plasmid pEZ07-yfbR was constructed: using a W3110 genome as a template, amplifying by using a primer yfbFR-F/yfBR-R shown in the following table 5 to obtain a yfBR fragment with the size of 642bp, directly carrying out column-passing recovery and purification (a strap-down gel recovery and purification kit) on an electrophoresis non-impurity band, carrying out EZ cloning construction on the obtained fragment and an pEZ07 vector fragment recovered by NcoI/XhoI enzyme digestion (a Suzhou Shenzhou gene GBclonart seamless cloning kit), carrying out warm bath on a recombinant cloning reaction solution at 45 ℃ for 30min, then transferring the solution onto ice for 5min, transferring TG1 transformation competent cells, carrying out heat shock at 42 ℃ for 2min, adding 800 muL recovery culture medium LB after 2min of ice bath, centrifugally coating an LB plate containing 100mg/L spectinomycin resistance after recovery culture for 1h, picking a clone on the next day, carrying out amplification verification by using a primer pCL-F/pCL-R as a template, inoculating a corresponding spectinomycin culture medium with the size of 1100bp to culture overnight, and extracting the plasmid, carrying out enzyme digestion verification, and finally constructing to obtain the plasmid pEZ 07-yfbR. On this basis nrdcA was ligated to construct co-expression plasmid pEZ 07-yfBR-nrdcA, designated pHA 289.

TABLE 4 plasmid information Table

Numbering	Plasmid information
		pEZ07	pSC101ori，aadA1
pX109	pEZ07-yfbR
		pHA289	pEZ07-yfbR-nrdBCA
pHA300	pEZ07-udk

TABLE 5 plasmid construction primers

Primer and method for producing the same	Sequence 5 '-3'
		yfbR-F	GATTAAATAAGGAGGAATAAACCATGAAACAGAGCCATTTTTTTGCC
yfbR-R	GGTACCAGCTGCAGATCTCGAGTTACAGCGGTGAATCCTGGC
		pCL-F	GACATCATAACGGTTCTGGC
pCL-R	AAAACAGCCAAGCTGGAGAC

Example 3: knockout of uridine/cytidine kinase (Udk) can significantly improve 2' -deoxycytidine yield

The udk gene in E.coli encodes a cytidine/uridine kinase, which is mainly involved in the salvage pathway and catalyzes the production of the corresponding mononucleotide CMP or UMP from cytidine or uridine. There is no literature or data showing that udk can catalyze 2' -deoxycytidine to generate dCMP, and no description about how udk gene knockout can increase 2' -deoxycytidine production is involved in Kim 2015 for modifying 2' -deoxycytidine-producing strains. The method is used for accidental fermentation during screening of the gene knockout contributing to improving the yield of the 2 '-deoxycytidine, and the yield of the 2' -deoxycytidine can be remarkably improved through udk knockout.

Respectively knocking udk and deoA out on a cdd knockout strain SHA56 by adopting a Datsenko method, constructing and obtaining SHA57 and SHA58, and carrying out shake flask fermentation on 2 transformed strains and a development strain SHA 56: dCR was not detected in SHA56, but 1.15mg/L and 2.09mg/L of dCR could be detected after udk and deoA knockouts, respectively, indicating that udk knockouts contribute to accumulation of dCR, but the effect is not as pronounced as deoA knockouts. Subsequently, the deoA knockout strain, namely SHA57, is knocked out for udk continuously, and simultaneously, the gene codes dcd of udk and dCTP deaminase are knocked out, so as to respectively construct SHA59 and SHA 60. Shake flask fermentation shows that SHA57 can accumulate dCR of 2.23mg/L, and on the basis, the strain obtained after knocking out udk or dcd can accumulate dCR of 3.98mg/L and 5.54mg/L respectively, which indicates that both udk and dcd knocking out can improve accumulation of dCR. Selecting dcd knock-out bacteria, namely SHA60 according to the effect of gene knockout to construct pyrE over-expression integrated strain to obtain SHA65, and finally carrying out udk gene knockout on the SHA65 strain to construct SHA85K (W3110 delta cddelta deoA delta dcd delta nupG:: Ptrc-pyrE delta udk:: kanFRT), the yield of dCR by shake flask fermentation is 14.78mg/L, the yield of dCR by contrast SHA60 is 5.67mg/L, and the udk knockout is favorable for accumulating more 2' -deoxycytidine. In order to verify the result, after the obtained strain SHA85K is transformed into plasmid pHA289, the yield of 2' -deoxycytidine is detected to reach 356.7mg/L, and the yield of 2' -deoxycytidine of a control strain SHA65/pHA289 is detected to be 218.6mg/L, so that Udk can be presumed to have activity on the 2' -deoxycytidine and can catalyze the 2' -deoxycytidine to generate dCMP, and the yield of the 2' -deoxycytidine can be obviously improved after knockout is performed, but 25mg/L of by-product cytidine is detected by fermentation of a udk knockout strain SHA85K/pHA289, so that cytidine cannot be catalyzed to CMP after the udk knockout is performed, and certain cytidine is detected.

TABLE 6 comparison of fermentation before and after udk knockout

Bacterial strains	dCR(mg/L)
		SHA65/pHA289	218.6±7.89
SHA85K/pHA289	356.7±10.45

Example 4: uridine/cytidine kinase (Udk) overexpression strain detection

The results of example 3 show that the deletion of the udk gene encoding cytidine/uridine kinase Udk contributes to the improvement of 2 '-deoxycytidine production, and thus a udk overexpression plasmid pEZ07-udk was constructed to confirm that the deletion of the udk gene contributes to the improvement of 2' -deoxycytidine production.

As an example of the process for constructing the pX109 plasmid described in example 3 above, an expression plasmid pEZ07-udk was constructed, designated pHA 300. The empty plasmids pEZ07 and pHA300 were transformed with SHA85K, respectively. The recombinant strains SHA85K/pEZ07 and SHA85K/pHA300 are obtained, 3 monoclonals are respectively selected and inoculated into LB test tubes containing spectinomycin resistance, shake flask fermentation is carried out according to the experimental method 2, meanwhile, 3 bottle empty controls are inoculated, sterile water with the same amount of thalli is added for culture, IPTG is added for induction, 2 '-deoxycytidine is added into all shake flasks, the final concentration is 1g/L, sample preparation is finished after fermentation is 24h, the content of 2' -deoxycytidine is detected, and then 3 shake flasks are respectively averaged. The result shows that the content of the 2 '-deoxycytidine in the empty bottle is 1.01g/L +/-0.02, the content is consistent with the expected addition amount, the 2' -deoxycytidine is 0.98g/L +/-0.07 after the SHA85K/pEZ07 fermentation is finished, and the reduction amplitude is basically negligible compared with the control strain; and the 2 '-deoxycytidine is 0.76g/L +/-0.03 after the SHA85K/pHA300 fermentation is finished, so that the content of the 2' -deoxycytidine is obviously reduced compared with that of a control strain SHA85K/pEZ07 after udk overexpression, which indicates that Udk can possibly utilize the 2 '-deoxycytidine as a substrate to produce other substances, Udk mainly has the function of kinase to catalyze cytidine/uridine to generate corresponding nucleoside monophosphate, and the structural formulas of the 2' -deoxycytidine and the cytidine are only the difference of hydroxyl at the 2-position of ribose, so Udk is supposed to catalyze the 2 '-deoxycytidine to generate the 2' -deoxycytidine monophosphate (dCMP). This is the first report on the activity of cytidine/uridine kinase Udk on 2' -deoxycytidine.

TABLE 7 detection of 2' -deoxycytidine degradation by udk overexpression

Example 5: uridine/cytidine kinase (Udk) catalyzes the production of 2 '-deoxycytidine monophosphate (dCMP) from 2' -deoxycytidine

The Escherichia coli cytidine-uridine kinase Udk mainly has the functions of catalyzing cytidine or uridine to generate 5 '-cytidine monophosphate or 5' -uridine monophosphate by taking ATP or GTP as a phosphate donor; in addition, Escherichia coli has thymidine/2 ' -deoxyuridine kinase Tdk, which catalyzes the formation of 5 ' -monophosphate thymidine or 5 ' -monophosphate-2 ' -deoxyuridine from thymidine or 2' -deoxyuridine. Kim 2015 shows that in the transformation of a strain for producing 2 '-deoxycytidine, a strain with deoA, deoD, udp, dcd, cdd and the like knocked out by BL21(DE3) has no degradation after in vitro addition of 2' -deoxycytidine, but according to the knock-out and overexpression results of our udk genes, uridine/cytidine kinase (Udk) is presumed to possibly catalyze 2 '-deoxycytidine to generate 2' -deoxycytidine monophosphate, but no relevant report exists at present, and in-vitro enzyme catalysis experiments are further carried out by using Udk enzyme liquid to verify the result.

First, the pET28a-udk expression plasmid was constructed: using Escherichia coli W3110 genome as template, respectively using primer pair udk-F, udk-R to amplify 684bp udk fragment, directly carrying out column recovery and purification (strap-down gel recovery and purification kit) without electrophoresis, carrying out EZ cloning construction (Suzhou Shenzhou gene GBclonart seamless cloning kit) on the obtained fragment and pET28a vector fragment recovered by NcoI/HindIII enzyme digestion in a nanomolar ratio of 1:2, transforming host TG1, and obtaining successfully constructed expression plasmid pET28a-udk through bacterial liquid PCR and enzyme digestion verification. Then pET28a and pET28a-udk are respectively transformed into competent cells of Escherichia coli BL21(DE3) to obtain recombinant strains BL21(DE3)/pET28a and BL21(DE3)/pET28 a-udk.

The process of the recombinant strain overexpression is as follows: the recombinant Escherichia coli was activated in LB medium (Green2012) containing 50mg/L kanamycin, the overnight cultured strains were transferred to 0.8% to 50mL LB medium containing 50mg/L kanamycin, cultured at 37 ℃ and 200rpm, and when the OD reached about 0.8, IPTG was added to the cells to give a final concentration of 0.4mM for induction, and the cells were cultured while the temperature was lowered to 30 ℃ overnight, and then the cells were collected by centrifugation and suspended in 5mL of 50mM PBS buffer (pH 7.0). The obtained recombinant bacteria of each enzyme were disrupted by ultrasonication under the following conditions: opening 2S, closing 4S, 8min, 30% power, crushing, centrifuging, respectively carrying out protein electrophoresis detection on the supernatant and the precipitate to detect the protein expression condition, and directly using the supernatant enzyme solution after centrifuging for the reaction detection of the 2' -deoxycytidine for generating dCMP.

The above obtained empty control and Udk overexpressed enzyme solution were subjected to enzyme-catalyzed reaction according to the reaction system shown in Table 9: water was used as a negative control instead of the enzyme solution, and the enzyme solutions of BL21(DE3)/pET28a and BL21(DE3)/pET28a-udk were added to carry out the reaction, and the reaction was carried out at 37 ℃ for 1 hour, and the sample was directly diluted 2-fold to carry out the detection.

As shown in FIG. 3, only 950mg/L of 2 '-deoxycytidine was detected when the enzyme solution was replaced with water, which is similar to the amount of 2' -deoxycytidine added; the sample to which the control BL21(DE3)/pET28a enzyme solution was added was detected neither 2' -deoxycytidine nor dCMP, and it was possible that the strain cdd had no knock-out and 2' -deoxycytidine was completely converted to 2' -deoxyuridine; while the sample added with Udk over-expressing BL21(DE3)/pET28a-udk enzyme solution can detect 356mg/L dCMP and 165 mg/L2 ' -deoxycytidine, and other 2' -deoxycytidine can be converted into 2' -deoxyuridine through cdd. The result shows that Udk can not only catalyze cytidine and uridine to generate corresponding nucleoside monophosphate, but also catalyze 2 '-deoxycytidine to generate dCMP, which is the first research and report about Udk having the function and provides a basis for strain modification of 2' -deoxycytidine.

TABLE 8 udk overexpression construction primers

Primer and method for producing the same	Sequence 5 '-3'
		udk-F	AACTTTAAGAAGGAGATATACCATGACTGATCAGTCTCATCAG
udk-R	CTCGAGTGCGGCCGCAAGCTTTATTCAAAGAACTGACTTATTTTCGC

TABLE 9 in vitro enzymatic reaction System

Composition (A)	Final concentration
		0.1M Tris-HCl(pH7.8)	0.1M
MgCl ₂ .H ₂ O	10mM
		ATP	3g/L
dCR	1g/L
		Enzyme solution or water	100ul

Example 6: the knockout of encoding genes such as uridine phosphatase (Udp) or cytidine deaminase (CodA) is not favorable for increasing the yield of 2' -deoxycytidine

The Udp gene in escherichia coli encodes the uridine phosphatase Udp, catalyzing reversible transformation between uridine and uracil. The codA gene codes cytidine deaminase, which catalyzes cytidine deamination to generate uracil. The final engineered bacteria in the Kim 2015 literature contain a udp knockout and a codA knockout, and therefore it was also examined whether both the udp and codA gene knockouts contribute to the increase in 2' -deoxycytidine accumulation.

The udp and codA were knocked out on the strain SHA65, respectively, and strains SHA83K (W3110. DELTA. cdd. DELTA. deoA. DELTA. dcd. DELTA. nupG:: Ptrc-pyrE. DELTA. udp:: kanFRT) and SHA84K (W3110. DELTA. cdd. DELTA. deoA. DELTA. dcd. DELTA. nupG: Ptrc-pyrE. DELTA. codA:: kanFRT) were constructed, respectively, as shown in Table 1. The SHA65, SHA83K and SHA84K were transformed into plasmid pHA289, respectively, and the recombinant strains obtained were subjected to shake flask fermentation according to experiment 2, and the results showed that the yields of 2' -deoxycytidine were reduced by 25% and 22% respectively after udp or codA knockout, and the yields of 2' -deoxycytidine were as shown in table 10 below, so that the knockout of these two genes did not promote the production of 2' -deoxycytidine.

TABLE 10 fermentation of udp and codA knockout strains

Bacterial strains	dCR(mg/L)
		SHA65/pHA289	223.6
SHA83K/pHA289	167.8
		SHA84K/pHA289	173.7

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Claims

1. Use of cytidine/uridine kinase in the catalysis of the conversion of 2' -deoxycytidine to deoxycytidine monophosphate.

2. Use according to claim 1, characterized in that: the cytidine/uridine kinase is Udk.

3. Use of a reagent and/or method for knock-down or knock-out of cytidine/uridine kinase for increasing the yield of 2' -deoxycytidine.

4. Use according to claim 3, characterized in that: the cytidine/uridine kinase is Udk.

5. A recombinant microorganism characterized by: the recombinant microorganism comprises the following characteristics: a decrease in the content or activity of a cytidine/uridine kinase, and/or a deletion, inactivation or reduction in the activity of a gene encoding said cytidine/uridine kinase; the recombinant microorganism is used for producing 2' -deoxycytidine.

6. The recombinant microorganism according to claim 5, wherein: the cytidine/uridine kinase is Udk.

7. Use of a recombinant microorganism according to any one of claims 5 to 6 for the production of 2' -deoxycytidine.

8. A method for producing 2' -deoxycytidine, which comprises: the method comprises the step of producing 2 '-deoxycytidine by fermentation using the recombinant microorganism of any one of claims 5 to 6 or the step of producing 2' -deoxycytidine by catalyzing a substrate with the whole-cell product of the recombinant microorganism of any one of claims 5 to 6.