CN115125247A - Combined promoter p alpha 2-alpha 2 and application thereof - Google Patents
Combined promoter p alpha 2-alpha 2 and application thereof Download PDFInfo
- Publication number
- CN115125247A CN115125247A CN202210671305.XA CN202210671305A CN115125247A CN 115125247 A CN115125247 A CN 115125247A CN 202210671305 A CN202210671305 A CN 202210671305A CN 115125247 A CN115125247 A CN 115125247A
- Authority
- CN
- China
- Prior art keywords
- promoter
- expression
- alpha
- gene
- alkaline protease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention obtains a novel combined promoter p alpha 2-alpha 2 with improved strength by analyzing and modifying a promoter from bacillus subtilis. The invention also provides an expression vector and an expression system containing the combined promoter. The combined promoter is used for controlling gene expression, is particularly applied to the field of bacillus amyloliquefaciens metabolic engineering, can improve the expression activity of alkaline protease by 144 percent, lays a foundation for mediating the expression of heterologous alkaline protease genes in a bacillus amyloliquefaciens expression system, and promotes the high-efficiency expression and the industrial production of the alkaline protease.
Description
Technical Field
The invention belongs to the technical field of microorganisms and genetic engineering, and particularly relates to a combined promoter p alpha 2-alpha 2 and application thereof.
Background
Alkaline proteases (Alkaline proteases), a class of enzymes that catalyze the hydrolysis of peptide bonds, whose active center contains serine, also known as serine proteases, enzymes that hydrolyze peptide bonds of proteins in the Alkaline range of pH, which not only hydrolyze peptide bonds but also hydrolyze amide bonds, ester bonds and transesterification and transpeptidation. The enzyme is widely present in animal pancreas, bacteria and mould, and the enzyme activity can be specifically inhibited by Diisopropylphosphoryl Fluoride (DFP), phenylmethylsulfonyl fluoride (PMSF) and Potato Inhibitor (PI).
The alkaline protease has wide application in the industries of food, washing, leather making and the like. As the microbial protease is extracellular enzyme, compared with the protease derived from animals and plants, the protease derived from animals and plants has the advantages of relatively simple downstream technical treatment, low price, wide sources, easy culture of thalli, high yield and the like, has all the characteristics of the protease derived from animals and plants, has stronger hydrolysis capacity and alkali resistance compared with neutral protease, has higher heat resistance and certain esterase activity, and is easy to realize industrial production.
The bacillus amyloliquefaciens is a gram-positive bacterium, is an ideal host for expressing and secreting foreign proteins in a prokaryotic expression system at present and becomes an important model strain in the prokaryotic expression system due to the characteristics of non-pathogenicity, strong protein secretion capacity and easy transfer of recombinant DNA and good fermentation foundation and production technology.
One of the key factors for achieving high expression of foreign proteins is the use of a strong and easily controlled promoter. The promoter (promoter) is a specific DNA sequence that is recognized, bound and initiates transcription by RNA polymerase (RNA Pol). The bacterial promoter is a target sequence combined with RNA polymerase, is an essential regulatory element for gene expression in bacteria, and determines the strength and the time of bacterial gene expression. The expression of bacterial genes can be changed by inserting or deleting the promoter, and the research on the growth and development of thalli and the metabolic regulation and control can be realized. The promoter is also the basis for constructing various expression systems and realizing the expression of heterologous genes. Therefore, screening for strong promoters is a very effective method for mediating the expression of protease genes and increasing the yield of alkaline proteases.
Disclosure of Invention
Aiming at the current industrial requirements and the defects of the prior art, the invention mainly aims to provide a promoter for realizing the high-efficiency expression of a target gene and a gene engineering bacterium expression system.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a combination promoter, the nucleotide sequence of which is shown in SEQ ID NO: 2, respectively.
In a second aspect, the present invention provides an expression vector comprising the combined promoter.
In a third aspect, the present invention provides an expression system comprising a combined promoter or expression vector as described above.
In a fourth aspect, the present invention provides the use of a combination of promoters as described above for controlling gene expression, particularly in the field of metabolic engineering of Bacillus amyloliquefaciens.
Has the advantages that:
the novel combined promoter with improved strength is obtained by analyzing and modifying a promoter from bacillus subtilis, is suitable for a bacillus amyloliquefaciens expression system, can improve the expression activity of alkaline protease by 144 percent, lays a foundation for mediating the expression of heterologous alkaline protease genes in the bacillus amyloliquefaciens expression system, and promotes the high-efficiency expression and the industrial production of the alkaline protease.
Drawings
FIG. 1: recovery and verification of each fragment of the recombinant vector in example 2; wherein, M: marker; 1: the promoter p alpha 2-alpha 2; 2: control promoter ply-2.
FIG. 2: the recombinant strains in example 2 express a comparison of alkaline protease activity.
Detailed Description
The invention is further described below by means of specific embodiments. Technical means, materials and the like to which the following embodiments refer may be known to those skilled in the art, and appropriate ones may be selected among known means and materials capable of solving the respective technical problems, unless otherwise specified. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention.
In a first aspect, the present invention provides a combination promoter, the nucleotide sequence of which is shown in SEQ ID NO: 2, respectively.
In a second aspect, the present invention provides an expression vector comprising the combined promoter. The backbone of the expression vector may be any Bacillus subtilis expression vector known in the art.
According to a preferred embodiment of the invention, the expression vector is pWB 980.
In a third aspect, the present invention provides an expression system comprising a combined promoter or expression vector as described above. The expression system may be any host suitable for the combined promoter or expression vector of the invention, for example, Bacillus amyloliquefaciens.
According to a preferred embodiment of the invention, the host is Bacillus amyloliquefaciens gene engineering bacterium delta 6 delta eps delta pgs delta 3049-3052 (the gene engineering bacterium is obtained by knocking out six extracellular protease genes aprE, bpr, vpr, mpr, nprE, epr, an extracellular polysaccharide gene cluster eps, a polyglutamic acid gene cluster pgs and a phage-associated gene 3049-3052 from CGMCC No.11218, and can be specifically referred to patent application 202111182462.6).
In a fourth aspect, the present invention provides the use of a combined promoter as described above for controlling gene expression, in particular for application in the field of metabolic engineering of Bacillus amyloliquefaciens.
According to a preferred embodiment of the present invention, the combined promoter is used to control the expression of the alkaline protease gene aprE in the bacillus amyloliquefaciens system, preferably, the nucleotide sequence of the alkaline protease gene is as shown in SEQ ID NO: 3, GenBank: FJ 940727.1.
The present invention will be described in more detail below by way of specific examples. Unless otherwise specified, in the following examples:
the culture medium and the enzyme activity determination method used by the invention are as follows:
seed culture medium: 5g/L of yeast powder, 10g/L of peptone and 5g/L of sodium chloride.
Fermentation medium: 64g/L of corn flour, 40g/L of bean cake powder, 4g/L of disodium hydrogen phosphate, 0.3g/L of monopotassium phosphate and 0.7g/L of high-temperature amylase.
B, preparing a culture medium by bacillus subtilis competence:
SP-A salt solution: (NH4) 2 SO 4 4g/L，K 2 HPO 4 ·3H2O 28g/L，KH 2 PO 4 12g/L, 2g/L sodium citrate;
SP-B salt solution: MgSO (MgSO) 4 ·7H 2 O 0.4g/L；
100 × CAYE solution: casein hydrolysate 20g/L, yeast powder 100 g/L;
SPI (200 mL): 98mL of SP-A salt solution, 98mL of SP-B salt solution, 2mL of 50% glucose and 2mL of 100 xCAYE;
SPII medium (600 mL): SPI 588mL, 50mmol/L CaCl 2 6mL，250mmol/L MgCl 2 6mL；
100 × EGTA solution: 10mmol/L EGTA solution.
Preparing a culture medium by bacillus amyloliquefaciens in a competent manner:
LBS culture medium: 5g/L of yeast powder, 10g/L of peptone, 5g/L of sodium chloride and 9.1085g/L of sorbitol;
recovering the culture medium: 5g/L of yeast powder, 10g/L of peptone, 5g/L of sodium chloride, 9.1085g/L of sorbitol and 6.92246g/L of mannitol.
The method for measuring the enzyme activity of the alkaline protease is carried out according to a Folin phenol method in GB/T23527-2009 appendix B, namely 1 enzyme activity unit (U/mL) is defined as the enzyme quantity required by 1mL of enzyme solution to hydrolyze casein for 1min to generate 1 mu g of tyrosine under the conditions of 40 ℃ and pH 10.5.
Example 1: novel combined promoter and construction of plasmid thereof
A promoter ply-2 (nucleotide sequence is shown as SEQ ID NO: 1) of a-amylase gene derived from bacillus subtilis is analyzed through promoter prediction analysis software iProEP, Softberry and the like, the promoter ply-2 is found to have two-10 regions and two-35 regions, two front and back fragments containing the-10 regions and the-35 regions are named as p alpha 1 and p alpha 2 respectively, two fragments p alpha 21 and p alpha 22 with homologous arms of the p alpha 2 are obtained through PCR amplification by taking the ply-2 as a template, the two fragments are further combined in series, a novel combined promoter is named as p alpha 2-alpha 2, and the nucleotide sequence is shown as SEQ ID NO: 2, respectively. The primers used are shown in the table below (note: capital letters indicate homology arms).
| Name of primer | Primer sequences | Annealing temperature |
| Pα2-F1 | TATGGTTTTGGTCGGCACTtgaagctggcttacagaagagc | 52℃ |
| Pα2-R1 | TTCTGTAAGCCAGCTTCATC ttgacactccttatttgatt | 52℃ |
| pWB980-F | TCAAATAAGGAGTGTCAAGAccaggagggctggaa | 52℃ |
| pWB980-R | TCTTCTGTAAGCCAGCTTCAagtgccgaccaaaac | 52℃ |
| Pα2-F2 | AATCAAATAAGGAGTGTCaagatgaagctggcttacagaag | 52℃ |
| Pα2-R2 | GCTTCTTCCAGCCCTCCTGGtcttgacactccttatttgattt | 52℃ |
The annealing temperature of the promoter fragment was 52 ℃ and the extension time corresponded to the gene length, and the reaction procedure was as follows:
the annealing temperature of the vector was 52 ℃ and the extension time corresponded to the gene length, and the reaction procedure was as follows:
the linear pWB980 vector was linked to a promoter by a seamless cloning procedure as follows:
1) extracting pWB980 plasmid, and carrying out PCR by using the pWB980 plasmid as a template;
2) recovering and purifying the target fragment by glue;
3) and (3) connecting the recovered promoter fragments p alpha 21 and p alpha 22 with the linear pWB980 vector fragment, performing connection in a water bath at 50 ℃ for 15min, and rapidly placing on ice for standing for several minutes.
The linking system is as follows:
vector 2uL
Promoter fragment 3uL
Seamless cloning enzyme 10uL
Ligation products were transformed into Bacillus subtilis WB600 by the following method:
1) selecting a newly activated Bacillus subtilis WB600 single colony to be cultured in 5mL of LB liquid culture medium at 37 ℃ at 220r/min overnight;
2) transferring 100 μ L of culture medium into 5mL of SPI medium, culturing at 37 deg.C and 220r/min until logarithmic final growth OD600 is 1.2 (about 3-4 h);
3) putting 200 μ L of culture solution growing to end of logarithmic phase into 2mL of SPII culture medium, culturing at 37 deg.C and 100r/min for 1.5 h;
4) adding 20 μ L10 mmol/L EGTA into thallus of the SPII culture medium, culturing at 37 deg.C and 100r/min for 10 min;
5) adding the connecting product into the SPII, and culturing at 37 ℃ at 100r/min for 30 min;
6) regulating the rotating speed to 220r/min, continuously culturing for 1.5h, taking bacterial liquid, coating the bacterial liquid on an LB screening plate containing 100 mu g/mL kanamycin, culturing for 12h at 37 ℃, and screening positive transformants for verification.
Example 2: recombinant alkaline protease gene engineering bacteria
Alkaline protease gene aprE (GenBank: FJ940727.1) is amplified by PCR by taking an alkaline bacillus alkalophilus genome as a template.
The reaction system used for amplification of the gene of interest was 50. mu.L, as follows:
the annealing temperature of aprE was 58 ℃ and the extension time corresponded to the gene length, and the reaction procedure was as follows:
respectively carrying out enzyme digestion on alkaline protease gene aprE and a p alpha 2-pWB980 plasmid containing a combined promoter, then connecting, constructing a recombinant expression vector containing promoter p alpha 2-alpha 2 and aprE gene expression cassettes, and transferring the recombinant expression vector into bacillus subtilis WB 600; extracting plasmids, transferring the recombinant plasmids into a bacillus amyloliquefaciens gene engineering bacterium delta 6 delta eps delta pgs delta 3049-3052 in an electrotransfer mode (the gene engineering bacterium is obtained by knocking out six extracellular protease genes aprE, bpr, vpr, mpr, nprE, epr, an extracellular polysaccharide gene cluster eps, a polyglutamic acid gene cluster pgs and a phage related gene 3049-3052 from CGMCC No.11218, and can be particularly referred to patent application 202111182462.6) to obtain the recombinant strains for heterologous expression of the alkaline protease.
The enzyme digestion system is as follows:
the restriction enzyme digestion of the expression vector and the connection with the target gene are as follows:
1) extracting a vector plasmid p alpha 2-pWB980 containing the combined promoter, and then carrying out double enzyme digestion on the plasmid according to the required restriction enzymes (Hind III, Sph I), wherein the enzyme digestion conditions are 37 ℃ and 2 hours;
2) carrying out the same double enzyme digestion on the target gene, and carrying out gel recovery and purification on the fragments;
3) connecting the recovered target gene fragment with the linearized p alpha 2-pWB980 fragment under the connection condition of 16 ℃ for 6h or overnight, wherein the connection system is as follows:
target gene fragment 4.5. mu.L
Linear p α 2- α 2-pWB980 fragment 0.5 μ L
Solution I 5.0μL；
The ligation product was transformed into Bacillus subtilis WB600 by the following method;
1) selecting a newly activated Bacillus subtilis WB600 single colony to be cultured in 5mL LB liquid medium at 37 ℃ and 220r/min overnight;
2) transfer 100 μ L of the culture medium to 5mL SPI medium, incubate at 37 ℃ at 220r/min until the end of logarithmic growth OD600 is 1.2 (about 3-4 h);
3) putting 200 μ L of culture solution growing to the end of logarithmic phase into 2mL of SPII culture medium, culturing at 37 deg.C and 100r/min for 1.5 h;
4) adding 20 μ L10 mmol/L EGTA into thallus of the SPII culture medium, culturing at 37 deg.C and 100r/min for 10 min;
5) adding the connecting product into the SPII, and culturing at 37 ℃ at 100r/min for 30 min;
6) regulating the rotation speed to 220r/min, continuously culturing for 1.5h, taking the bacterial liquid, coating the bacterial liquid on an LB screening plate containing 100 mu g/mL kanamycin, culturing for 12h at 37 ℃, and screening positive transformants for verification.
The recombinant plasmid in WB600 was extracted and electrotransferred to Bacillus amyloliquefaciens Δ 6. DELTA. eps. DELTA. pgs. DELTA. 3049-3052 by the following method:
1) cleaning the electric rotating cup with 75% alcohol, irradiating for more than 20min under ultraviolet, and pre-cooling on ice;
2) 100 u L competence and 10ng plasmid DNA mixture into the electric rotating cup, ice placed for 2 min;
3)2500V electric shock, wherein the electric shock time is generally 4-6 ms;
4) immediately after electric shock, 1ml of recovery medium was added, and recovery was carried out at 37 ℃ for 3 hours. Plating, culturing at 37 ℃ for 12h, and screening positive transformants for verification (the recovery verification of the fragment is shown in FIG. 1).
Meanwhile, the recombinant bacteria of the same expression system constructed by the promoter ply-2 are used as control bacteria, and the difference between the two bacteria is only that the promoters of alkaline protease genes are different.
Example 3: expression and analysis of recombinant alkaline protease gene engineering bacteria
Single colonies of the recombinant genetically engineered bacteria and the control bacteria on the fresh plates are inoculated into 50mL kanamycin-resistant seed culture medium, subjected to shaking culture at 37 ℃ and 220rpm for 12h, inoculated into a fermentation culture medium containing kanamycin resistance in the same inoculum size, and subjected to fermentation culture at 37 ℃ and 220 rpm.
The enzyme activity of the alkaline protease in the fermentation supernatant of the recombinant genetic engineering bacteria is determined according to a national standard GB/T23527-2009 appendix B Folin phenol method, fermentation broths of the recombinant bacteria for 12h, 24h, 36h, 48h and 60h are respectively taken for fermentation culture, and the activity of the recombinant alkaline protease in the fermentation supernatant of the recombinant bacteria containing the combined promoter reaches 25686U/mL to the maximum when the fermentation broth is determined for 48h, and is 144% of the expression activity of a control bacterium (shown in figure 2). The invention provides a combined promoter p alpha 2-alpha 2 with higher strength, and the promoter can be used for obviously improving the expression activity of alkaline protease in a bacillus subtilis system.
Although the present invention has been disclosed in the form of preferred embodiments, it is not intended to limit the present invention, and those skilled in the art may make various changes, modifications, substitutions and alterations in form and detail without departing from the spirit and principle of the present invention, the scope of which is defined by the appended claims and their equivalents.
Sequence listing
<110> Tianjin university of science and technology
SHANDONG LONCT ENZYMES Co.,Ltd.
<120> combined promoter p alpha 2-alpha 2 and application thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 596
<212> DNA
<213> Bacillus subtilis
<400> 1
cattatgttt gaatttccgt ttaaagaatg ggctgcaagc cttgtgtttt tgttcatcat 60
tatcttatat tactgcatca gggctgcggc atccggaatg ctcatgccga gaatagacac 120
caaagaagaa ctgcaaaaac gggtgaagca gcagcgaata gaatcaattg cggtcgcctt 180
tgcggtagtg gtgcttacga tgtacgacag ggggattccc catacattct tcgcttggct 240
gaaaatgatt cttcttttta tcgtctgcgg cggcgttctg tttctgcttc ggtatgtgat 300
tgtgaagctg gcttacagaa gagcggtaaa agaagaaata aaaaagaaat catctttttt 360
gtttggaaag cgagggaagc gttcacagtt tcgggcagct ttttttatag gaacattgat 420
ttgtattcac tctgccaagt tgttttgata gagtgattgt gataatttta aatgtaagcg 480
ttaacaaaat tctccagtct tcacatcggt ttgaaaggag gaagcggaag aatgaagtaa 540
gagggatttt tgactccgaa gtaagtcttc aaaaaatcaa ataaggagtg tcaaga 596
<210> 2
<211> 588
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgaagctggc ttacagaaga gcggtaaaag aagaaataaa aaagaaatca tcttttttgt 60
ttggaaagcg agggaagcgt tcacagtttc gggcagcttt ttttatagga acattgattt 120
gtattcactc tgccaagttg ttttgataga gtgattgtga taattttaaa tgtaagcgtt 180
aacaaaattc tccagtcttc acatcggttt gaaaggagga agcggaagaa tgaagtaaga 240
gggatttttg actccgaagt aagtcttcaa aaaatcaaat aaggagtgtc aagatgaagc 300
tggcttacag aagagcggta aaagaagaaa taaaaaagaa atcatctttt ttgtttggaa 360
agcgagggaa gcgttcacag tttcgggcag ctttttttat aggaacattg atttgtattc 420
actctgccaa gttgttttga tagagtgatt gtgataattt taaatgtaag cgttaacaaa 480
attctccagt cttcacatcg gtttgaaagg aggaagcgga agaatgaagt aagagggatt 540
tttgactccg aagtaagtct tcaaaaaatc aaataaggag tgtcaaga 588
<210> 3
<211> 1143
<212> DNA
<213> Alkaliphilic Bacillus (Bacillus alcalophilus)
<400> 3
atgaagaaac cgttggggaa aattgtcgca agcaccgcac tactcatttc tgttgctttt 60
agttcatcga tcgcatcggc tgctgaagaa gcaaaagaaa aatatttaat tggctttaat 120
gagcaggaag ctgtcagtga gtttgtagaa caagtagagg caaatgacga ggtcgccatt 180
ctctctgagg aagaggaagt cgaaattgaa ttgcttcatg aatttgaaac gattcctgtt 240
ttatccgttg agttaagccc agaagatgtg gacgcgcttg aactcgatcc agcgatttct 300
tatattgaag aggatgcaga agtaacgaca atggcgcaat cagtgccatg gggaattagc 360
cgtgtgcaag ccccagctgc ccataaccgt ggattgacag gttctggtgt aaaagttgct 420
gtcctcgata caggtatttc cactcatcca gacttaaata ttcgtggtgg cgctagcttt 480
gtaccagggg aaccatccac tcaagatggg aatgggcatg gcacacatgt ggccgggacg 540
attgctgctt taaacaattc gattggcgtt cttggcgtag cgccgagcgc ggaactatac 600
gctgttaaag tattaggggc gagcggttca ggttcggtca gctcgattgc ccaaggattg 660
gaatgggcag ggaacaatgg catgcacgtt gctaatttga gtttaggaag cccttcgcca 720
agtgccacac ttgagcaagc tgttaatagc gcgacttcta gaggcgttct tgttgtagcg 780
gcatctggga attcaggtgc aggctcaatc agctatccgg cccgttatgc gaacgcaatg 840
gcagtcggag ctactgacca aaacaacaac cgcgccagct tttcacagta tggcgcaggg 900
cttgacattg tcgcaccagg tgtaaacgtg cagagcacat acccaggttc aacgtatgcc 960
agcttaaacg gtacatcgat ggctactcct catgttgcag gtgcagcagc ccttgttaaa 1020
caaaagaacc catcttggtc caatgtacaa atccgcaatc atctaaagaa tacggcaacg 1080
agcttaggaa gcacgaactt gtatggaagc ggacttgtca atgcagaagc ggcaacacgc 1140
taa 1143
<210> 4
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tatggttttg gtcggcactt gaagctggct tacagaagag c 41
<210> 5
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttctgtaagc cagcttcatc ttgacactcc ttatttgatt 40
<210> 6
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcaaataagg agtgtcaaga ccaggagggc tggaa 35
<210> 7
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcttctgtaa gccagcttca agtgccgacc aaaac 35
<210> 8
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aatcaaataa ggagtgtcaa gatgaagctg gcttacagaa g 41
<210> 9
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gcttcttcca gccctcctgg tcttgacact ccttatttga ttt 43
<210> 10
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ccaagcttat gaagaaaccg ttggggaaaa ttg 33
<210> 11
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ggcatgctta gcgtgttgcc gcttctgc 28
Claims (7)
1. The combined promoter is characterized in that the nucleotide sequence of the combined promoter is shown as SEQ ID NO: 2, respectively.
2. An expression vector comprising the combination promoter of claim 1.
3. The expression vector of claim 2, wherein the backbone of the expression vector is pWB 980.
4. An expression system comprising the combination promoter of claim 1 or the expression vector of claim 3.
5. The expression system of claim 4, wherein the host of the expression system is Bacillus amyloliquefaciens.
6. The expression system of claim 5, further comprising a polynucleotide having a nucleotide sequence set forth in SEQ ID NO: 3 under the control of the combined promoter.
7. The use of the combination promoter of claim 1 in the field of metabolic engineering of bacillus amyloliquefaciens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210671305.XA CN115125247B (en) | 2022-06-14 | 2022-06-14 | Combined promoter palpha 2-alpha 2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210671305.XA CN115125247B (en) | 2022-06-14 | 2022-06-14 | Combined promoter palpha 2-alpha 2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115125247A true CN115125247A (en) | 2022-09-30 |
| CN115125247B CN115125247B (en) | 2023-10-13 |
Family
ID=83378937
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210671305.XA Active CN115125247B (en) | 2022-06-14 | 2022-06-14 | Combined promoter palpha 2-alpha 2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115125247B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108004239A (en) * | 2017-10-27 | 2018-05-08 | 天津科技大学 | A kind of Novel promoter of high efficient expression protease |
| CN108795937A (en) * | 2018-06-14 | 2018-11-13 | 天津科技大学 | The startup sub-portfolio and its genetic engineering bacterium of efficient heterogenous expression alkali protease |
| CN109852615A (en) * | 2019-01-17 | 2019-06-07 | 天津科技大学 | A kind of bidirectional promoter that can express alkali protease, application, plasmid and genetic engineering bacterium |
| CN112522173A (en) * | 2020-12-23 | 2021-03-19 | 天津科技大学 | Engineering bacterium for producing heterologous alkaline protease and construction method thereof |
| CN113151270A (en) * | 2021-04-02 | 2021-07-23 | 天津科技大学 | Promoter for efficiently expressing alkaline protease and application thereof |
-
2022
- 2022-06-14 CN CN202210671305.XA patent/CN115125247B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108004239A (en) * | 2017-10-27 | 2018-05-08 | 天津科技大学 | A kind of Novel promoter of high efficient expression protease |
| CN108795937A (en) * | 2018-06-14 | 2018-11-13 | 天津科技大学 | The startup sub-portfolio and its genetic engineering bacterium of efficient heterogenous expression alkali protease |
| CN109852615A (en) * | 2019-01-17 | 2019-06-07 | 天津科技大学 | A kind of bidirectional promoter that can express alkali protease, application, plasmid and genetic engineering bacterium |
| CN112522173A (en) * | 2020-12-23 | 2021-03-19 | 天津科技大学 | Engineering bacterium for producing heterologous alkaline protease and construction method thereof |
| CN113151270A (en) * | 2021-04-02 | 2021-07-23 | 天津科技大学 | Promoter for efficiently expressing alkaline protease and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115125247B (en) | 2023-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108795937B (en) | Promoter combination for high-efficiency heterologous expression of alkaline protease and gene engineering bacteria thereof | |
| CN112522173B (en) | Engineering bacterium for producing heterologous alkaline protease and construction method thereof | |
| CN111763676B (en) | Promoter for improving activity of heterologous expression enzyme of keratinase and application thereof | |
| CN113151270A (en) | Promoter for efficiently expressing alkaline protease and application thereof | |
| CN111153968B (en) | Signal peptide mutant for improving expression quantity of exogenous alkaline protease and construction method and application thereof | |
| CN115124604B (en) | Recombinant antibacterial peptide E-EJ97, recombinant expression vector, engineering bacteria and application thereof | |
| CN109234299B (en) | Method for expressing and preparing lactobiose phosphorylase | |
| CN110106128B (en) | Genetically engineered bacterium for producing recombinant alkaline protease and construction method thereof | |
| CN110144319B (en) | Gene engineering bacterium for high-efficiency heterologous expression of alkaline protease and construction method thereof | |
| CN101463358A (en) | Nitrile hydratase gene cluster and use thereof | |
| CN110283797B (en) | Tyrosinase, gene, engineering bacterium and preparation method thereof | |
| CN110484480B (en) | Preparation and transformation method of bacillus subtilis competent cells | |
| CN115125247B (en) | Combined promoter palpha 2-alpha 2 and application thereof | |
| CN115125248B (en) | Combined promoter pctsR-alpha 2 and application thereof | |
| JP2021177752A (en) | LOW-TEMPERATURE ACIDIC PROTEASE PsAPA, AND PREPARATION METHOD AND APPLICATION OF THE SAME | |
| CN115927267B (en) | Bile acid complex enzyme preparation and application thereof | |
| CN115820613B (en) | Keratinase preparation containing eucommia ulmoides leaf extract and application thereof | |
| CN115820612B (en) | Keratinase, bile acid enzyme preparation containing keratinase and application of bile acid enzyme preparation | |
| CN116042497B (en) | Bacillus amyloliquefaciens chassis strain and application thereof | |
| CN116179499B (en) | Dipeptide synthetase mutant, recombinant thereof and application thereof in continuous circulation catalysis of high-concentration substrate | |
| CN117511836A (en) | Chassis strain lacking sasA gene and application thereof | |
| CN116286568A (en) | Bacillus subtilis chassis bacteria and application thereof | |
| CN117487735A (en) | Chassis strain lacking yycI gene and application thereof | |
| CN117568341A (en) | Mutant promoter Pre10 and application thereof | |
| CN118369432A (en) | Genetically engineered bacterium and method for preparing L-ornithine by using genetically engineered bacterium |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |